Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...
S0730 gary gibson
1. CRISPR/Cas9 RNA directed gene editing
• Brief history
• Basic gene editing
• New developments to improve CRISPR applications
• New uses for CRISPR techniques
75 publications in Nature and 31 in Science since I was invited to present last
September.
3. 1987. Five highly homologous sequences of 29 nucleotides were arranged as direct
repeats with 32 nucleotides as spacing. Maybe stabilize the mRNA.
GGAGGGAGTTCTACCGCAGAGGCGGGGGAACTCCAAGTGATATCCATCATCGCATCCAGTGCGCC (1,451)
(1,452) CGGTTTATCCCCGCTGATGCGGGGAACACCAGCGTCAGGCGTGAAATCTCACCGTCGTTGC (1,512)
(1,513) CGGTTTATCCCTGCTGGCGCGGGGAACTCTCGGTTCAGGCGTTGCAAACCTGGCTACCGGG (1,573)
(1,574) CGGTTTATCCCCGCTAACGCGGGGAACTCGTAGTCCATCATTCCACCTATGTCTGAACTCC (1,634)
(1,635) CGGTTTATCCCCGCTGGCGCGGGGAACTCG (1,664)
GG
consensus: CGGTTTATCCCCGCT CGCGGGGAACTC
AA
Ishino, Y., Shinagawa, H., Makino, K., Amemura, M., and Nakata, A. 1987.
Nucleotide sequence of the iap gene, responsible for alkaline phosphatase
isozyme conversion in Escherichia coli, and identification of the gene product.
J. Bacteriol. 169, 5429–5433.
4. Mojica reported the very similar peculiar sequence in salt tolerant
archeae. (Mojica, F.J.M., Juez, G., and Rodrı´guez-Valera, F. (1993). Transcription at different salinities of
Haloferax mediterranei sequences adjacent to partially modified PstI sites. Mol. Microbiol. 9, 613–621). This
was followed up with demonstration of these sequences and CRISPR
associated genes (Cas) in a large variely of bacteria and archeae.
In 2005 in a series of landmark papers it was recognized that spacer
sequences seen in CRISPR loci were identical to sequences from
phages, suggesting their function as an adaptive immune system.
Small CRISPR RNAs. Stan J. J. Brouns et al, 2008 Science, 321, 960-964.
5. A Programmable Dual-RNA–Guided DNA Endonuclease in Adaptive Bacterial Immunity
Martin Jinek, Krzysztof Chylinski, Ines Fonfara, Michael Hauer, Jennifer A. Doudna,
Emmanuelle Charpentier. 17 August 2012, Science
crRNA (CRISPR RNA)
tracrRNA (trans acting crRNA)
Cas9 (CRISPR associated protein)
PAM (protospacer adaptor motif) self v
non-self recognition NGG.
6. crRNA (CRISPR RNA)
tracrRNA (trans acting crRNA)
PAM (protospacer adaptor motif) self v
non-self recognition NGG.
Cas9 (CRISPR associated protein)
crRNA-tracrRNA chimera (guide RNA)
Double strand DNA breaks repaired by
non-homologous end joining (NHEJ)
usually resulting in a mutation.
7. “Our study further demonstrates that the Cas9 endonuclease family
can be programmed with single RNA molecules to cleave specific
DNA sites, thereby raising the exciting possibility of developing a
simple and versatile RNA-directed system to generate dsDNA breaks
for genome targeting and editing.”
8. CRISPR/Cas provides critical functions of acquired immunity, memory
and pathogen elimination.
Sorek, Lawrence and Wiedenheft, CRISPR-Mediated Adaptive Immune Systems,
Ann Rev Biochem 2013
PAM protospacer adaptor motif
9. This paper was followed within months by papers in Science and Nature
describing the adaptation of CRISPR/Cas9 technology to gene editing in
mouse and human cells.
Cas9 sequence was modified to optimize expression in mammalian cells.
sgRNA was modified for greater efficiency.
These improvements have continued at an unrelenting pace.
Feng Zhang’s group, Broad Institute has been perhaps the most prolific author
of developments in CRISPR/Cas9 techniques.
A huge benefit of his developments has been the availability of all his reagents
via the non-profit organization Addgene.
11. Gene knockout in chondrocytes.
Problems with using the CRISPR/Cas9 system in chondrocytes.
Cas 9 is large, 4104 bp.
Chondrocytes have a poor transfection efficiency.
Approach:
Created a permanent RCS line expressing Cas 9 using a Flp-In System
engineered in RCS cells by Tamayuki Shinomura, Tokyo Medical and Dental
University.
17. RCS Cas 9 cells were transfected with a guide RNA complimentary to a
region in rat aggrecan 3rd exon (underlined seq) that contains a PstI site
(highlighted as green) right at the 3’ end of the target site. A correctly
targeted site will lose the restriction site. Note the ‘AGG’ site of the
protospacer adaptor motif (PAM) right after the target site.
Aggrecan exon 3
19. Cas 9
Rat chondrosarcoma
cell with Flp-In site
RCS Cas 9
cell line
RCS Cas 9 cell
line with Acan
knockout
Acan targeted
gRNA
Puromycin
selection
FACS
20. PstI cleavage of a
PCR product
from 3rd exon of
Acan gene
RCS Cas9 + + + +
guide RNA transfection - + + +
FACS sorting - - - +
Approximately 90% of
the transfected the
transfected cells had
a mutation in the
Acan gene.
22. 04-1 TTCAGAACAGCGCCATCATCGCCACCCCTGAGCAA - - - CAGGCCGCCTATGAGGA -3
04-2 TTCAGAACAGCGCCATCATCGCCACCCCTGA - - - - - TGCAGGCCGCCTATGGGGA -5
rACAN TTCAGAACAGCGCCATCATCGCCACCCCTGAGCAACTGCAGGCCGCCTATGAGGA
I I A T P E Q L Q A A Y
I I A T P E Q L Q A A Y
rACAN TTCAGAACAGCGCCATCATCGCCACCCCTGAGCAAC- TGCAGGCCGCCTATGAGGA
06-4 TTCAGAACAGCGCCATCATCGCCACCCCTGAGCAAC - -GCAGGCCGCCTATGAGGA -2
06-1 TTCAGAACAGCGCCATCATCGCCACCCCTGAGCAACGTGCAGGCCGCCTATGAGGA +1
06-2 TTCAGAACAGCGCCATCATCGCCACCCCTGAGCAAC- - - - - AGGCCGCCTATGAGGA -5
Cas9 clone4 clone6
23. RCS Acan KO
Safranin O Cherry Red CD11b inflammatory marker
RCS Acan KORCS Acan KO
Chondrosarcoma developed by subcutaneous injection in nude mice
24. •RCS Cas9 cells allow us to generate permanent chondrocyte lines with
deletion or specific modification in almost any gene or ncRNA by simply
transfecting with guide RNA.
•Transfection of KO or gene modified RCS cells with new guide RNAs
enables modification of additional or multiple genes or ncRNAs and
provide definition of molecular pathways.
•Almost unlimited quantities of RCS cells with specifically modified DNA
can be generated.
•The RCS cells will also produce a chondrosarcoma
with cartilage like matrix when injected
subcutaneously.
25. Cas 9
Rat chondrosarcoma
cell with Flp-In site
RCS Cas 9
cell line
RCS Cas 9 cell
line with specific
gene knockouts
Acan
KO miR-
140 KO
Ship2 KO Jamie
Fitzgerald HFH
Col 6a1KO, Col6a2KO, Col6a3KO Jamie
Fitzgerald HFH
Gene targeted
gRNA
Has2 KO Warren Knudson, East Carolina Uni.
Kank1 KO Bill Horton, Shriners, Portland
27. Specificity
• The gRNA recognized a 20-nt sequence and could tolerate mismatches of up to
several nucleotide positions with potentially thousands of off-target sites. Many
developments have reduced off-target site cleavage dramatically. These include:
• reducing gRNA length to 17 or 18 nt, paired Cas9 nickases.
• software developed by the Broad Institute from analysis of thousands of gRNAs
enables the design of gRNAs with minimal off target activity.
• High fidelity Cas9 has been engineered by two groups. From analysis of Cas9
crystal structure and then systematic engineering of amino acids they identified
several amino acids that bind to the DNA target or non-target strand. Specific
disruption of these by substitution of specific amino acids, including
neutralization of positive charges generated two distinct Cas9s with robust on-
target activity and vastly diminished off-target cleavage.
28. By weakening the interaction of Cas9 with the DNA backbone they proposed to
force the enzyme to rely to a greater extent on the gRNA-DNA pairing to recognize
and cut its target.
29. Weakened interaction
between Cas9 and
gRNA/DNA.
Weakened interaction
between Cas9 and DNA
non-target strand
Engineered Cas9 with minimal off-target activity
Rationally engineered Cas9 nucleases with improved specificity
Slaymaker, Gao, Zetsche, Scott, Yan, Zhang. Science; January. 2016. Available at AddGene.
High-fidelity CRISPR-Cas9 nucleases with no detectable
genome-wide off-targets. Kleinstiver, Pattanayak, Prew, Tsai,
Nguyen, Zheng & Joung, Nature, January 2016
30. Combined with good gRNA design using the software developed these new
Cas9 variants effectively eliminate off-target mutations.
Weakened interaction
between Cas9 and
gRNA/DNA.
Weakened interaction
between Cas9 and DNA
non-target strand
31. Homology Directed Repair (HDR)
NHEJ very efficient 80-90% in our hands. HDR much less efficient maybe 1%.
HDR can produce precise genetic modification. It’s more difficult but it is what is
required to treat genetic disease.
32. Richardson, Ray, DeWitt, Curie, Corn. Enhancing homology-directed genome editing by
catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 2016
Jan 20.
RuvC
HNH
Nuclease domains
Cas9
Non-target
Target
PAM
gRNA
A detail analysis of the interaction of Cas9 gRNA and target DNA showed Cas9
binds very tightly to DNA, even after cutting (6h lifetime). But while remaining
bound, it lets go of one strand of the cut DNA
33. Richardson, Ray, DeWitt, Curie, Corn. Enhancing homology-directed genome editing by
catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 2016
Jan 20.
RuvC
HNH
Nuclease domains
Cas9
Non-target
Target
PAM
gRNA
This released strand flaps out (3’ end of the non-target strand), and exogenous
single-stranded DNA could be annealed to that strand . Very efficient
sequence replacement HDR c60% was obtained by designing editing
templates to anneal to the released strand.
34. CRISPR/Cas9 for Activation or Repression
Inactive Cas9 (dCas9) targeting promoter sequences or fused to a
repressor domain, such as KRAB domain, results in c90% inhibition.
Repression CRISPRi
35. CRISPR/Cas9 for Activation or Repression
Activation
Fusion of dCas9 to a transcriptional activator. Fusion to VP16 can
increase gene expression by 25 fold.
36. Gene Screening
Using a panel of thousands of gRNAs targeting nearly all genes multiple
times it is possible to identify genes that are essential for specific cellular
functions.
37. Alexander Agrotis and Robin Ketteler* Frontiers in Genetics, September
2015
Gene Screening
Typical library from
Addgene contains
76,441 guides (4
guides/gene)
targeting 19,114
genes.
Cas9 158kDa
39. The libraries and screening technology has advanced rapidly since the
technique was first described in 2014.
Multiple libraries, both knockout and activator, are available from
Addgene.
They provide the ability to ask what gene is essential for a given cells,
• survival,
• growth,
• differentiation,
• homeostasis.
• ……
40. • Identified a large number of essential genes not previously
characterized.
• Identified a small number of cell line-, cancer- specific
essential genes were identified. Targets for therapy.
Three recent papers have demonstrated the value of the
genes screening technology and described essential genes
in tumor cells.
Wang et al. ….Lander and Sabatini Science October 2015.
Hart et al…..Moffat, Cell December 2015
Weber et al….Rad. PNAS November 2015
41. CRISPR/Cas9 technology continues to develop rapidly.
The availability of these tools to the research community
will help continue this development and expand an
already amazing array of gene manipulation tools.
43. Animal Models
CRISPR/Cas has had an enormous effect on the ability to develop mouse
models of human disease.
The technique makes generation of genetically engineered quicker (c11 weeks)
and cheaper.
It also enables the generation of complex models, large deletions, inversions,
duplications, mice carrying mutations in multiple genes and disruption of large
topologic domains that would be very difficult and time consuming by traditional
methods.
Many hundreds of genetically modified mice have been generated using this
technique.
CRISPR/Cas9 has also generated several models of disease and disease
resistance in other species including, goats, cattle, ferrets, fish, elephants.
44. • Human organs for transplantation by growing them in pigs.
• Porcine endogenous retrovirus (PERV) embedded in the pig genome.
• CRISPR/Cas 9 modification of 62 genes in pig embryos.
• May have produced a pig suitable non-human organ donor without virus.
Church’s group also modified more than 20 genes in a separate set of pig
embryos, including genes that encode cell-surface proteins known to trigger
a human immune response or cause blood clotting.
eGenesis is one of several new companies developing pigs for organ
transplantation.
45. Long C. et al. ….. Olsen. Postnatal genome editing partially restores dystrophin expression in a
mouse model of muscular dystrophy. Science. 2015 Dec 31.
Nelson CE et al…..Gersbach. In vivo genome editing improves muscle function in a
mouse model of Duchenne muscular dystrophy. Science. 2015 Dec 31.
Tabebordbar M et al….Church, Wagers. In vivo gene editing in dystrophic mouse muscle
and muscle stem cells. Science. 2015 Dec 31.
Correcting mutations causing diseases
Duchenne muscular dystrophy.
Frame shift mutation in dystrophin causing progressive muscle wasting and death
at about 30.
Three papers published in Science in December showed muscle function could
be partially restored in a mouse model by using systemic or local injection of AAV
carrying Cas9 and two gRNAs.
47. Gene Drives
A gene drive has the capacity to force a genetic modification
through a population within a few generations.
49. Valentino M. Gantz* and Ethan Bier. The mutagenic chain reaction: A
method for converting heterozygous to homozygous mutations. Science, 24 April 2015:
348, 442-444.
Mendelian
inheritance
Gene drive
50. These developments offer incredible opportunities.
Several laboratories have identified candidate gene disruptions or transgenes
that interfere with the transmission of malaria and other well-studied diseases
(Basu et al PNAS 2015, Hall et al. Science 2015, Hammond et al. December
2015, Gantz et al. PNAS 2016) some have created gene drives that would
eliminate disease transmission if released.
Aedes aegypti
Anopheles gambiae
Eradicating insect-borne diseases
51. Potential applications of RNA-guided gene drives.
Kevin M Esvelt et al. eLife Sciences 2014;3:e03401
52. Valentino M. Gantz* and Ethan Bier. The mutagenic chain reaction: A
method for converting heterozygous to homozygous mutations. Science, 24 April 2015:
348, 442-444.
Mendelian
inheritance
Gene drive
US director of intelligence
James Clapper warned in an
annual threat-assessment report
last month that emerging gene
manipulation technology should
be listed as danger similar to
nuclear test in North Korea or
clandestine chemical weapons
in Syria.
Had any of the flies escaped, it
has been estimated that
approximately one in five to one
in two of all the fruit flies in the
world would be yellow today.
54. CRISPR/Cas9 technology has amazing capacity
• to facilitate the description of gene function and interacting pathways,
• to provide development of new animal models,
• to treat human disease,
• to control invasive species and disease vectors.
It is powerful technology and some applications need to be carefully
regulated.
56. Most bacteria and
archaea have this
system.
Although the basic
mechanism are
common to all CRISPR
systems the proteins
and nucleotide
sequences mediating
this are diverse.
Sorek, Lawrence and Wiedenheft,
CRISPR-Mediated Adaptive
Immune Systems,
Ann Rev Biochem 2013
57. Makarova, Kira S., et al.
“An updated evolutionary
classification of CRISPR-
Cas systems.” Nature
Reviews Microbiology
(2015).
60. Host gene, WWP2 minimal change.
Mature miR not expressed. Precursor expression increased.
61. •RCS Cas9 cells allow us to generate permanent chondrocyte lines with
deletion or specific modification in almost any gene or ncRNA by simply
transfecting with guide RNA.
•Transfection of KO or gene modified RCS cells with new guide RNAs
enables modification of additional or multiple genes or ncRNAs and
provide definition of molecular pathways.
•Almost unlimited quantities of RCS cells with specifically modified DNA
can be generated.
•The RCS cells will also produce a chondrosarcoma
with cartilage like matrix when injected
subcutaneously.
64. A Platform for Rapid Exploration of Aging and Diseases in a
Naturally Short-Lived Vertebrate, Harel et al. Cell February 2015.
Short-lived (6 months) vertebrate (cf
zebrafish ~5 years).
They have developed a CRISPR/Cas9
based platform for rapid exploration of
age-dependent traits and diseases in
vertebrates.
Produce stable fish lines with mutations
in known aging genes in 2-3 months.
As proof of principle they created telomerase mutations. In disease-causing
mutations these are caused by variants leading to single amino acid residue
change. They can do that and also look at longevity variants.
65. SH Sternberg et al. Nature 507,62–67 March 2014
Cas9 binds very
strongly to PAM
sites
Cas9 crRNA bounces along DNA binding strongly to PAM sequences but unbinds
quickly when there is no target sequence providing very efficient target recognition.
When it recognizes target sequences unwinding and cleavage of DNA rapidly
follows.
By weakening the interaction of Cas9 with the DNA backbone they forced the
enzyme to rely to a greater extent on the gRNA-DNA pairing to recognize and cut its
target.
66. Kleinstiver, Pattanayak, Prew, Tsai, Nguyen,
Zheng & Joung, Nature, January 2016
The modifications of selected
basic amino acids effectively
eliminated off-target mutations.
67. Rationally engineered Cas9 nucleases with improved specificity
Slaymaker, Gao, Zetsche, Scott, Yan, Zhang. Science; January. 2016. Available at AddGene.
By weakening the interaction of Cas9 with the DNA backbone they forced the
enzyme to rely to a greater extent on the gRNA-DNA pairing to recognize and cut its
target.
68. By also targeting repressible promoter
elements this enabled enhancement and
inhibition of multiple target genes in a
single cell population.
The ability of a single Cas9 protein to
regulate RNA production while also
maintaining the capacity to cleave DNA
provides the ability to decipher complex
biological circuits.
70. Alexander Agrotis and Robin
Ketteler* Frontiers in Genetics,
September 2015
Gene Screening
Cas9 158kDa
Typical updated library from
AddGene contains 76,441
guides (4 guides/gene)
targeting 19,114 genes.
71. Multiplexing
Cas9 gRNA engineering for genome editing, activation and repression. Samira Kiani……..
…George Church, Nature Methods, November 2015.
Using CRISPR/Cas9 to repress and inhibit multiple targets in a cell.
14-16nt gRNA did not affect
Cas9 binding but blocked
nuclease activity.
14-nt gRNA
72. For example. Wang et al…Zhang, Jaenisch. Cell, May 2013
Mice with mutations in 5 genes (Tet1, 2, 3, Sry and Uty).
73. • Cattle resistant to trypanosome parasites responsible for sleeping
sickness.
• Farmaceutical production in animals. Anticlotting agent in goat milk,
cholesterol drugs from chicken eggs.
• Transform endangered Indian elephants into woolly mammoths.
• Faster growing fish that are not able to reproduce for safe fish farming.
74. New Disease Models
Ferrets used for influenza transmission can now be genetically modified to
study their susceptibility and mechanisms of viral transmission.
Neuroscience studies with marmosets and monkeys. CRISPR-induced
mutation in MECP2, the gene associated with the neurodevelopmental
disorder Rett syndrome. Genes Cells. 2015 Dec;20(12):992-1005.
76. RNA tracking
Researchers have modified components of CRISPR so that they snap on
to a specified mRNA within the nucleus, then enter the cytoplasm as a
complex where its fluorescent signal can be tracked. dCas9 fused with
RNA binding protein. Allows the study of RNA processing in disease or
for identifying drugs that reverse defects in RNA processing.
78. These developments offer incredible opportunities.
Eradicating insect-borne diseases
Malaria affects about 200 million annually and kills 500,000 mostly children.
It also has a devastating affect on the economic growth of many
underdeveloped communities.
Dengue, yellow fever, chikungunya, trypanosomiasis, leishmaniasis, Chagas,
and Lyme disease are also spread by insects.
Several laboratories have identified candidate gene disruptions or transgenes
that interfere with the transmission of malaria and other well-studied diseases
(Basu et al PNAS 2015, Hall et al. Science 2015, Hammond et al. December
2015, Gantz et al. PNAS 2016) and have created gene drives and would
eliminate disease transmission if released.
Aedes aegyptiAnopheles gambiae
