Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

The NeSL-1 5\' UTR Pseudoknot_Ribozyme

126 views

Published on

A brief presentation of my analysis of the 5\'UTR in NeSL-1. The mRNA secondary structure characteristics are illustrated.

Published in: Technology
  • Be the first to comment

  • Be the first to like this

The NeSL-1 5\' UTR Pseudoknot_Ribozyme

  1. 1. Caenorhabitis elegans
  2. 2.  5’-3’GCTCACTTTCTATCGTGTTAACCGTACGTTTACACTCCCAGTGAGTGTAATAAAGGTTATTCGATAGAGGGTGTCTCCCTCTTTCTTGGGTAATTCTTCGGCGGTCCGGGGTCTCTCCCTCGTCTTTTTTTTAAACTTTTCTTTCTCATCCACTCTTTTGCTCCTTTTTACTAACTCTTGTACTCTATAGTCTTTTCTCATCCCCCATCCGCCGTTGGGCAAAGTTTATTTACTTTGTTAAATCCATATTTTATCTCTCTCACCCGTACAGAAAGCGTCTCCTTCTCAAACGCTTTTCTGTACTTTTTCTTATATTTTCATTAACATATTTTTCCTGTTTATACTAACCTAACCTCCATTGTCAATTACTAACTAACTTGTACAACGGATTTCGATG-3’ Dot-bracket...((((((((((((...(((((......((((((((.....))))))))....)))))..))))))))))))...(((........))).........(((((...((((.........................................................(((........)))......((......))...))))...)))))((((((((((((......))))))............................(((((((((((((...........)))).)))))))))............................................)))))).(((.((((((((((.....))).))).)))).)))........
  3. 3.  http://varna.lri.fr/demo.html
  4. 4. ORF Start 53 Frame 2 L T F Y R V N R T F T L P V S V I K V I R Stop R V S P S F L G N S S A V R G L S L V F F L N F S F S S T L L L L F T N S C T L Stop S F L I P H P P L G K V Y L L C Stop I H I L S L S P V Q K A S P S Q T L F C T F S Y I F I N I F F L F I L T Stop P P L S I T N Stop L V Q R I S Met L R R K G R H R Met V Met V N S V K W Q P S A H A E A I G T G K S W A P Q R S Q A S E H G W Q S N A Met F D P P N R I L F A R D S W S L N Q S T H L Q N Q R S G S G L G I R P G Q V R N N Met V G G G P H R A G D P K R R V E L V S I Q G S E V T V R T I Y P S D E I F S C Y S K S C D I K T K A G Y G P E D L K H L T R H I K N E H G L K A R W A Y Q C G L C N E K S D P S V S E G H K W Met E A H Met V A V H Q S

×