DNA translation and Protein Synthesis
1. For the following strands of DNA write out the corresponding mRNA
strand.
a. TACT...
4. Part of the amino acid sequence of the A chain of insulin is "glutaminecysteine-cysteine-alanine". Use the genetic code...
Upcoming SlideShare
Loading in …5
×

Dna translation and protein synthesis

264 views

Published on

0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
264
On SlideShare
0
From Embeds
0
Number of Embeds
4
Actions
Shares
0
Downloads
1
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Dna translation and protein synthesis

  1. 1. DNA translation and Protein Synthesis 1. For the following strands of DNA write out the corresponding mRNA strand. a. TACTTCGAGTACCATATT b. TACATGGCTAGTCTGATT 2. For the parent strand of DNA listed below write out the mRNA strand and then the polypeptide (protein chain) encoded by the strand. (Once you have transcribed the strand – look for the start codon, start there and continue until there is a stop codon) GTAGCGTACAGCTGACGAACGTGCATTGCGACG 3. For the following RNA strand – write the corresponding DNA that would have served as a template for it. AUGCGGUACUACGGU
  2. 2. 4. Part of the amino acid sequence of the A chain of insulin is "glutaminecysteine-cysteine-alanine". Use the genetic code chart (Figure 17.4) to decide which of the following DNA strands could encode this tetrapeptide. a) 5'-CCCCCGCAGAAG-3' b) 5'-GGCATCGTGGAG-3' c) 5'-CAGTGCTGTGCC-3' d) 5'-CTGCCCCGACAC-3' e) 5'-GTCACGACACGG-3'

×