Advertisement

Can someone please help me with these questions and also explain the.pdf

Apr. 1, 2023
Can someone please help me with these questions and also explain the.pdf
Upcoming SlideShare
1 Explain the principle behind 5 RACE Describe in detail .pdf1 Explain the principle behind 5 RACE Describe in detail .pdf
Loading in ... 3
1 of 1
Advertisement

More Related Content

More from sales88(20)

Advertisement

Can someone please help me with these questions and also explain the.pdf

  1. Can someone please help me with these questions and also explain the answer for 1. Most sequencing method require the amplification of target DNA. Which of the following primer pairs would be the most appropriate to amplify this sequence for sequencing? GCAGGAGTTTCAAACTTTACGACACATAATAAAAGTAGTAAATAATAATGACAGTA TCTCAAATCAG TGCAGGGGGGAAAGGCCTACTAATACCTTACCACCCTAGAAAGGCATGATGAAAAT TTAAGATAGA AGGAAAATATAAATTGAAAAAAAAAAACCTAAATATTCTAAGAAAAAAGGAATCTA GTTTGTCAAAA TGTGACTTGAATTAATAGATAAGGAGAGTCACTTAACAAATGATTCTGACAAATATC TTCTCTTTCCA GGGAGAATCACTGAGCCAGAATAAAATTGAACAGATGATAAGAGGGTCAAAATTAT GTTTATCTTA GGAAAAGTAGAATAGAAAATTTATAAGCAGATTAAAATTTTCCCAACATTCTTGTGA AATATGACA CATCCCAATCTTAACAGATGTGATGGTGGGATAATTGGATAGCAATATGGGAAAAG ATATATTTAAT TTCCGTTGCTACACCAAATGCCATCATTTGGGATACTGTACTTGTGAGTGGAAGTGT GGTACTATTTC ACCAAATGCCA A B C You are planning a Next Generation Sequencing (NGS) experiment to study the mechanism of tumorigenesis. Formation of tumor could happen due to overexpression of an oncogene, translocation leading to a fusion gene or reduced expression of tumor suppressor gene. Which of the following order of NGS experiments would be most appropriate? A. WGS--MethylSeq-- RNASeq--CLiPSeq B. MethylSeq-WES-RNASeq-CLiPSeq C. WES-- MethylSeq-RNASeq- CliPSeq D. RNASeq-WES-MethylSeq--CliPSeq
Advertisement