Genotipo y fenotipo

5,618 views

Published on

Published in: Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
5,618
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
33
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Genotipo y fenotipo

  1. 1. Genotipo y fenotipoToda la información contenida en los cromosomas se conoce como genotipo, sin embargodicha información puede o no manifestarse en el individuo. El fenotipo se refiere a laexpresión del genotipo más la influencia del medio.El botánico holandés Wilhelm Johannsen acuñó tanto el término gen como la distinciónentre genotipo y fenotipo. Normalmente se refiere al genotipo de un individuo con respectoa un gen de interés particular y, en individuos poliploides, se refiere a la combinación de losalelos que porta el individuo (homocigoto y heterocigoto). Un cambio en un cierto genprovocará normalmente un cambio observable en un organismo, conocido como elfenotipo. Los términos genotipo y fenotipo son distintos por al menos dos razones: 1. Para distinguir la fuente del conocimiento de un observador (uno puede conocer el genotipo observando el ADN; uno puede conocer el fenotipo observando la apariencia externa de un organismo). 2. El genotipo y el fenotipo no están siempre correlacionados directamente. Algunos genes solo expresan un fenotipo dado bajo ciertas condiciones ambientales. Inversamente, algunos fenotipos pueden ser el resultado de varios genotipos. La distinción entre genotipo y fenotipo se constata a menudo al estudiar los patrones familiares para ciertas enfermedades o condiciones hereditarias, por ejemplo la hemofilia. Algunas personas que no tienen hemofilia pueden tener hijos con la enfermedad, porque ambos padres "portaban" los genes de la hemofilia en su cuerpo, aunque éstos no tenían efecto en la salud de los padres. Los padres, en este caso, se llaman portadores . La gente sana que no es portadora y la gente sana que es portadora del gen de la hemofilia tienen la misma apariencia externa (es decir, no tienen la enfermedad), y por tanto se dice que tienen el mismo fenotipo. Sin embargo, los portadores tienen el gen y el resto de la gente no (tienen distintos genotipos).(c) Genotipo y FenotipoLlamamos fenotipo al conjunto de caracteres morfológicos, funcionales, bioquímicos,conductuales, etc., que presenta un ser vivo. Gran parte del fenotipo es hereditario, esto es,corresponde a las características que un ser vivo recibe de sus progenitores; pero no todo elfenotipo lo es. Por ejemplo, una persona que ha aprendido a tocar el piano puede llegar ahacerlo muy bien a través del ejercicio y del aprendizaje. Saber tocar el piano es sin dudauna característica fenotípica; sin embargo, ésta característica fenotípica no se hereda. Por,el contrario, el grupo sanguíneo, que también es una característica fenotípica, estádeterminado por los grupos sanguíneos de los progenitores.El genotipo es el conjunto de genes que presenta un individuo. Muy frecuentemente estosgenes determinan características que aparecen en el fenotipo; otras veces los genes nollegan a manifestarse. Así, una persona que tenga el grupo sanguíneo A puede tener ungenotipo A0, es decir, un gen parental determina la presencia del carácter A y el otro genparental 0; pero en este caso la presencia de A (carácter dominante) se impone a la
  2. 2. característica 0 (carácter recesivo); el individuo es fenotípicamente A aunque tambiéntenga el gen correspondiente al grupo 0.El genotipo es un conjunto de información, es decir, una serie de instrucciones concretasmediante las cuales el ser vivo construye su fenotipo. Hoy sabemos que esta informacióntiene una estructura análoga al lenguaje (hablado o escrito) pero con cuatro letras (A,T,G yC) en lugar de las 26 del alfabeto latino. Esta información está constituída por unamacromolécula lineal, el ácido desoxirribonucleico (ADN, DNA), que es un polímeroconstituído por la unión de monómeros de cuatro tipos distintos (los mencionados comoA,T, G y C), de manera que una "frase" escrita en "lenguaje DNA" sería algo como esto: ATTCGGCTTACGTTGAACTGTCCATCGAGGTAACTTCCTTTTACCG

×