Endocrine-Related Cancer (2008) 15 183–190



Association of the T1799A BRAF mutation
with tumor extrathyroidal invasion, ...
Y Wang, M Ji et al.: BRAF mutation in thyroid cancer

the BRAF gene, which is the most common oncogenic             from 1...
Endocrine-Related Cancer (2008) 15 183–190

3700 DNA Analyzer (Applied Biosystems) for mutation           Table 1 Prevalen...
Y Wang, M Ji et al.: BRAF mutation in thyroid cancer


Table 2 Relationship between the T1799A BRAF mutation and various c...
Endocrine-Related Cancer (2008) 15 183–190


Table 4 Relationship of extrathyroidal invasion of papillary thyroid cancer (...
Y Wang, M Ji et al.: BRAF mutation in thyroid cancer




Figure 1 Immunohistochemical staining for PDGF-B in papillary thy...
Endocrine-Related Cancer (2008) 15 183–190

stages, higher peripheral platelet counts, and increased          Hu S, Liu D,...
Y Wang, M Ji et al.: BRAF mutation in thyroid cancer

Namba H, Nakashima M, Hayashi T, Hayashida N, Maeda S,           San...
Upcoming SlideShare
Loading in …5
×

Association of the T1799A BRAF mutation with tumor ...

516 views

Published on

Published in: Health & Medicine
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
516
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
3
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Association of the T1799A BRAF mutation with tumor ...

  1. 1. Endocrine-Related Cancer (2008) 15 183–190 Association of the T1799A BRAF mutation with tumor extrathyroidal invasion, higher peripheral platelet counts, and over- expression of platelet-derived growth factor-B in papillary thyroid cancer Yangang Wang1,2, Meiju Ji1, Wei Wang 2, Zhimin Miao 2, Peng Hou1, Xinyan Chen 2, Feng Xu 2, Guangwu Zhu 2, Xianlu Sun 2, Yujun Li 2, Steven Condouris1, Dingxie Liu1, Shengli Yan 2, Jie Pan 2 and Mingzhao Xing1 1 Division of Endocrinology and Metabolism, The Johns Hopkins University School of Medicine, 1830 East Monument Street, Suite 333, Baltimore, Maryland 21287, USA 2 Affilated Hospital of Qingdao University School of Medicine, Qingdao 266003, People’s Republic of China (Correspondence should be addressed to M Xing; Email: mxing1@jhmi.edu) Y Wang and M Ji contributed equally to this work Abstract The relationship among BRAF mutation, platelet counts, and platelet-derived growth factor (PDGF) with respect to clinicopathological outcomes of papillary thyroid cancer (PTC) may play a role in PTC pathogenesis but remains undefined. We examined the T1799A BRAF mutation by direct genomic DNA sequencing in 108 primary PTC samples from a Chinese cohort and analyzed its relationship with clinicopathological, hematological, and other laboratory results as well as the levels of expression of PDGF in tumors. We found that the BRAF mutation was significantly associated with extrathyroidal invasion and advanced tumor stages III and IV. Specifically, extrathyroidal invasion was seen in 30/54 (56%) PTC with BRAF mutation versus 18/54 (33%) PTC without the mutation (PZ0.02). Tumor stages III and IV were seen in 16/54 (30%) PTC with BRAF mutation versus 7/54 (13%) PTC without the mutation (PZ0.04). The BRAF mutation was also significantly associated with a higher platelet count, with 249.28G53.76!109/l in the group of patients with BRAF mutation versus 207.79G58.98!109/l in the group without the mutation (PZ0.001). An association of higher platelet accounts with extrathyroidal invasion was also seen, with 242.66G51.85!109/l in patients with extrathyroidal invasion versus 218.49G59.10!109/l in patients without extrathyroidal invasion (PZ0.03). The BRAF T1799A- positive PTC tissues harbored a significantly higher level of PDGF-B than BRAF T1799A-negative PTC tissues. The data suggest that the BRAF T1799A mutation is associated with aggressive pathological outcomes of PTC in which high platelet counts and increased PDGF production may play a role. Endocrine-Related Cancer (2008) 15 183–190 Introduction thyroid cancer (PTC), which accounts for w80% of all Thyroid cancer is the most common endocrine thyroid cancers. As in other human cancers, genetic malignancy with a rapidly rising incidence worldwide alterations are the driving force for PTC tumorigenesis. in recent decades (Hundahl et al. 1998, Liu et al. 2001, Recent several years have seen a major progress in Davies et al. 2002, Davies & Welch 2006, Mazzaferri understanding the genetic basis of PTC. In particular, 2006, Sandeep et al. 2006). This increase is virtually numerous studies have consistently shown a high completely attributed to the diagnosis of papillary prevalence of the T1799A point mutation in exon 15 of Endocrine-Related Cancer (2008) 15 183–190 DOI: 10.1677/ERC-07-0182 1351–0088/08/015–183 q 2008 Society for Endocrinology Printed in Great Britain Online version via http://www.endocrinology-journals.org
  2. 2. Y Wang, M Ji et al.: BRAF mutation in thyroid cancer the BRAF gene, which is the most common oncogenic from 1996 to 2005. Preoperative hematological panel, genetic alteration in PTC and plays an important role in including peripheral blood platelet count, was routinely the tumorigenesis of this cancer (Xing 2005). performed within 3 days prior to thyroid surgery using Since the initial report of BRAF mutations in human an automated particle counter (CELL-DYN-1700). cancer (Davies et al. 2002), more than 40 point mutations Thyroid-stimulating hormone, free tri-iodothyronine in BRAF gene have been identified, with the T1799A (FT3), free thyroxine (FT4), thyroid peroxidase antibody mutation accounting for about 90% of them (Garnett & (TPO-Ab), and thyroglobulin antibody (TG-Ab) Marais 2004). This mutation causes a valine-to-glutamic were determined by RIA, with the range of intra- and acid amino acid change in codon 600 of the BRAF inter-assay coefficient of variability being 2.5–5.5% and protein kinase, confers BRAFV600E oncogenic function 5.0–12.0% respectively. by constitutively activating the kinase activity, and leads to tumorigenesis through aberrant activation of the Genomic DNA isolation Ras/Raf/MEK/OMAP kinase/ERK pathway Paraffin-embedded PTC samples were microdissected (Davies et al. 2002, Garnett & Marais 2004). In thyroid and DNA isolated as previously described (Xing et al. tumors, the T1799A BRAF mutation occurred virtually 2005). Briefly, after an 8-h treatment at room temperature only in PTC with an average prevalence of 44% with xylene to remove paraffin, samples were subjected (Xing 2005). Its tumor-initiating function for PTC to protein digestion with a digestion solution containing tumorigenesis was well demonstrated in transgenic 1% SDS and 0.5 mg/ml proteinase K at 48 8C for 48 h. mouse model (Knauf et al. 2005). Most clinicopatholo- A few mid-interval spiking aliquots of concentrated gical studies have showed its close association with SDS-proteinase K were added to facilitate the digestion. aggressive clinicopathological characteristics and tumor DNA was subsequently isolated by standard phenol– recurrence (Namba et al. 2003, Nikiforova et al. 2003, chloroform extraction and ethanol precipitation. Xing et al. 2005, Kim et al. 2006, Xing 2007). In the present report, we investigated the relation- ship of the T1799A BRAF mutation with clinicopatho- Detection of BRAF mutation logical characteristics of PTC and peripheral platelet The T1799A transversion BRAF mutation in exon 15 was counts which are often associated with aggressiveness analyzed by direct DNA sequencing. Using genomic of other human cancers (Hernandez et al. 2000, Ikeda DNA as the template, exon 15 of the BRAF gene et al. 2002, Verheul & Pinedo 2003, Shimada et al. was PCR amplified using the following primers: 2004, Brown et al. 2005, Bensalah et al. 2006) to ACCTAAACTCTTCATAATGCTTGCT (forward) examine the role of this mutation in PTC in Chinese and CTGATTTTTGTGAATACTGGGAACT (reverse). where this mutation has not been well studied. This PCR was run with a step-down protocol: 95 8C for 5 min for one cycle; 95 8C for 1 min, 60 8C for 1 min, and 72 8C for 1 min for two cycles; 95 8C for 1 min, 58 8C for Materials and methods 1 min, and 72 8C for 1 min for two cycles; and 95 8C for 1 min, 56 8C for 1 min, and 72 8C for 1 min for 35 cycles; Tumor samples and clinicopathological followed by a final extension at 72 8C for 5 min. The and laboratory data collection reaction mixture, in a 30 ml volume, contained, in final With institutional approval, a series of 108 paraffin- concentration, 16.6 mm ammonium sulfate, 67 mm Tris embedded primary PTC samples were collected from the (pH 8.8), 10 mm 2-mercaptoethanol, 1.5 mm each Affiliated Hospital of Qingdao University School of deoxynucleotide triphosphate, 6.7 mm MgCl2, 5% Medicine in Qingdao, China, including 94 conventional, dimethylsulfoxide, 1.67 mm each primers (forward and 11 tall cell, and 3 follicular-variant PTC subtypes. The reverse), 60 ng genomic DNA, and 0.5 U platinum DNA histopathological diagnoses and subtype classification of Taq polymerase (Life Technologies Inc., Gaithersburg, PTC tumors were examined and agreed upon by two MD, USA). The specificity and integrity of the PCR were experienced pathologists (Xianlu Sun & Yujun Li). confirmed by a single band of PCR product with expected Anaplastic and undifferentiated thyroid cancers were molecular weight on a 1.5% agarose gel. The PCR excluded from this study. Children under the age of 18 products were subsequently subjected to sequencing years at diagnosis of thyroid cancer were also excluded. PCR with Big Dye terminator V 3.0 cycle sequencing The clinicopathological and laboratory data of the reagents (Applied Biosystems, Foster City, CA, USA) corresponding patients, as shown in the tables, were with the following cycles: 95 8C for 30 s for one cycle, collected by a retrospective review of the records of the and 95 8C for 15 s, 50 8C for 15 s, and 60 8C for 4 min for patients who underwent total or near-total thyroidectomy 35 cycles. The samples were analyzed on an ABI PRISM 184 www.endocrinology-journals.org
  3. 3. Endocrine-Related Cancer (2008) 15 183–190 3700 DNA Analyzer (Applied Biosystems) for mutation Table 1 Prevalence of the T1799A BRAF mutation in various identification. subtypes of papillary thyroid cancer (PTC) in Chinese patients T1799A BRAF mutation Tissue immunohistochemical (IHC) staining Subtypes of PTC (n /N (%)) IHC staining for platelet-derived growth factor-A Conventional PTC (NZ94) 45/94 (48) (PDGF-A) and PDGF-B was performed in PTC samples. Tall cell PTC (NZ11) 8/11 (73) For the analysis of PDGF expression by IHC staining, 30 Follicular variant PTC (NZ3) 1/3 (33) Total (NZ108) 54/108 (50) BRAF T1799A-positive and 30 BRAF T1799A-negative samples were randomly selected. Tissue sections were incubated with 1:500 primary antibodies against conventional PTC, 8/11 (73%) tall cell PTC, 1/3 (33%) PDGF-A or PDGF-B (Boster Bioengineering Ltd, follicular variant PTC, and 54/108 (50%) total PTC in Wuhan, China) at 37 8C for 3 h. Development of color this Chinese cohort, being most common in the was achieved with DBA after incubation with the aggressive tall cell PTC. To further explore the role of secondary antibody at 37 8C for 20 min. Negative the BRAF mutation in PTC tumorigenesis in the Chinese controls were processed similarly except with the population, we analyzed its relationship with various removal of the primary antibodies. Staining intensity clinicopathological characteristics of PTC, including the was expressed as IHC scores as follows: 0, no staining; 1, patient age at diagnosis, gender, tumor size, multi- weak or focal staining; 2, moderate staining in most cells; focality, extrathyroidal invasion, lymph node metastasis, and 3, strong staining in most cells. and tumor stages. As shown in Table 2, the T1799A BRAF mutation was significantly associated with Statistical analysis extrathyroidal invasion and advanced tumor stages III and IV. Specifically, extrathyroidal invasion was seen in Categorical data were summarized using frequencies and 30/54 (56%) PTC with BRAF mutation versus 18/54 percents. Parametric continuous data were expressed as (30%) PTC without the mutation (PZ0.02). Tumor meanGS.D. TPO-Ab, TG-Ab, and tumor sizes were stages III and IV were seen in 16/54 (30%) PTC with summarized with medians and interquartile as they BRAF mutation versus 7/54 (13%) PTC without the lacked normal distribution. Comparisons of two groups mutation (PZ0.04). Except for older patient age, of categorical variables were performed using c2-test. no significant association of BRAF mutation with Comparisons of two groups of continuous parametric other clinicopathological characteristics of PTC was data were performed using t-test. Comparisons of non- seen (Table 2). parametric data of two groups with continuous variables were performed by Mann–Whitney U test. Multivariate Association of BRAF mutation in PTC with higher Cox regression analysis was used to examine the peripheral blood platelet counts independent significance of certain parameters. Linear regression analysis was used to determine the correlation Prompted by previous findings that elevated peripheral between two factors. A P value !0.05 was considered to blood platelet count was associated with some human be statistically significant. All statistical analyses were cancers and their aggressiveness (Hernandez et al. 2000, performed using the SPSS statistical package (11.5, Ikeda et al. 2002, Verheul & Pinedo 2003, Shimada et al. Chicago, IL, USA). 2004, Brown et al. 2005, Bensalah et al. 2006), we analyzed the relationship of the BRAF mutation with platelet count and several other hematological and Results biochemical parameters. This represented an attempt to see if a higher platelet count played any role in BRAF Association of BRAF mutation with aggressive mutation-associated tumor aggressiveness of PTC. As clinicopathological characteristics of PTC shown in Table 3, BRAF mutation was significantly The T1799A BRAF mutation is mostly associated with associated with a higher peripheral blood platelet count. more aggressive tall cell and conventional PTC and is Specifically, the platelet count was 249.28G53.76!109/l rarely seen in follicular variant PTC in various ethnic in PTC patients harboring the T1799A mutation versus populations (Xing 2005). This distribution pattern has not 207.79G58.98!109/l in patients without the mutation been well examined in the Chinese population. (PZ0.001). The BRAF mutation was not associated with We therefore first used the current Chinese cohort to other hematological parameters, including blood leuko- explore further this issue. As shown in Table 1, we cyte, neutrophil, erythrocyte, and hemoglobin. Similarly, found the T1799A BRAF mutation in 45/94 (48%) no association of BRAF mutations was seen with several www.endocrinology-journals.org 185
  4. 4. Y Wang, M Ji et al.: BRAF mutation in thyroid cancer Table 2 Relationship between the T1799A BRAF mutation and various clinicopathological parameters in Chinese patients with papillary thyroid cancer (PTC; n (%)) T1799A BRAF (NZ54) Wild-type BRAF (NZ54) P value Age at diagnosis (years; meanGS.D.) 48.57G14.32 42.00G15.10 0.02 Gender (male/female) 14/40 13/41 0.82 Tumor size (cm2; medians (interquartile ranges)) 2.97 (2.53–3.40) 3.46 (2.70–4.23) 0.52 Multifocality 14 (26) 11 (20) 0.49 Lymph node metastasis 18 (33) 16 (30) 0.67 Extrathyroidal invasion 30 (56) 18 (33) 0.02 Tumor stage I 6 (11) 11 (20) II 32 (59) 36 (67) III–IV 16 (30) 7 (13) 0.04 thyroid function parameters and thyroid autoimmune including patient age and gender, tumor size, multi- antibodies (Table 3). These results suggest that the focality, lymph node metastasis, tumor stage, and blood association of the T1799A BRAF mutation with higher leukocyte. We performed multivariate analysis on the platelet counts was a specific phenomenon. association with extrathyroidal invasion for these factors. After adjustment for all these factors, including platelet Association of extrathyroidal invasion of PTC count, the odd ratios for the association of BRAF with higher platelet counts mutation with extrathyroidal invasion was 4.410 (95% CI: 1.571–12.377; PZ0.005). When adjusted for these Since BRAF mutations were associated with both poor factors, including BRAF mutation, the odd ratios for the pathological behaviors of PTC and higher peripheral association of platelet count with extrathyroidal invasion blood platelet counts as shown above, we next examined was 1.121 (95% CI: 1.010–1.210; PZ0.012). Although whether there was a correlation between elevated platelet this latter association was statistically significant, the low counts and poor clinicopathological characteristics of odd ratios suggest that increased platelet count plays a PTC. Indeed, as shown in Table 4, extrathyroidal role largely secondary to BRAF mutation in the invasion of PTC was closely associated with higher development of extrathyroidal invasion of PTC. None peripheral blood platelet counts. Specifically, the platelet of the remaining factors was significantly associated with count was 242.66G51.85!109/l in PTC patients with extrathyroidal invasion. extrathyroidal invasion versus 218.49G59.10!109/l in PTC patients without extrathyroidal invasion (PZ0.03). Association of BRAF mutation with PDGF-B Other hematological or thyroid function parameters were expression not associated with extrathyroidal invasion of PTC (Table 4), suggesting a specific role of high platelet Having demonstrated the association of BRAF mutation counts in the development of this aggressive pathological with higher platelet counts, we next explored whether the behavior of PTC. Except for BRAF mutation and expression of platelet-released PDGF, a well-known extrathyroidal invasion, none of other factors was tumor-promoting growth factor, is altered in relation to significantly associated with increased platelet count, BRAF mutation. Using IHC staining, we examined the Table 3 Relationship between BRAF mutation and various hematological and thyroid function parameters in papillary thyroid cancer (PTC; meanGS.D.) T1799A BRAF (NZ54) Wild BRAF (NZ54) P value Platelet (!109/l) 249.28G53.76 207.79G58.98 0.001 Blood leukocyte (!109/l) 6.70G2.04 6.55G1.79 0.41 Neutrophil (%) 55.40G14.49 55.68G10.25 0.35 Erythrocyte (!1012/l) 4.46G0.55 4.41G0.55 0.64 Hemoglobin (g/l) 130.07G15.84 131.62G12.40 0.57 TSH (mu/l) 4.06G1.82 4.05G2.13 0.98 FT3 (pmol/l) 5.29G1.53 5.35G1.48 0.39 FT4 (pmol/l) 14.29G2.79 14.05G3.16 0.67 TPO-Ab (u/l; median (interquartile ranges)) 17.34 (11.23–23.45) 16.88 (9.63–24.12) 0.62 TG-Ab (u/l; median (interquartile ranges)) 13.09 (9.66–16.52) 12.95 (10.07–18.89) 0.22 186 www.endocrinology-journals.org
  5. 5. Endocrine-Related Cancer (2008) 15 183–190 Table 4 Relationship of extrathyroidal invasion of papillary thyroid cancer (PTC) with platelet counts and other laboratory parameters (meanGS.D.) Extrathyroidal invasion (C) Extrathyroidal invasion (K) (NZ48) (NZ60) P value Platelet (!109/l) 242.66G51.85 218.49G59.10 0.03 Blood leukocyte (!109/l) 6.53G2.18 6.65G1.81 0.76 Neutrophil (%) 56.11G9.87 56.66G14.15 0.82 Erythrocyte (!1012/l) 4.28G0.48 4.21G0.57 0.50 Hemoglobin (g/l) 129.26G16.07 131.25G12.17 0.46 TSH (mu/l) 4.13G1.88 4.03G2.66 0.82 TPO-Ab (u/l; median (interquartile ranges)) 15.60 (9.94–21.81) 18.27 (11.61–24.94) 0.29 TG-Ab (u/l; median (interquartile ranges)) 12.72 (9.73–15.72) 13.26 (10.02–16.50) 0.60 FT3 (pmol/l) 5.29G1.75 5.41G1.20 0.67 FT4 (pmol/l) 13.98G2.98 14.05G3.25 0.91 expression of both PDGF-A and PDGF-B. We found no Riesco-Eizaguirre et al. 2006, Xing 2007), consistent difference in the expression of PDGF-A in PTC between with an important oncogenic role of this mutation in the BRAF mutation-positive and BRAF mutation-negative tumorigenesis and progression of PTC. The present study groups (Table 5). In contrast, a significant association investigated this role of BRAF mutation in a Chinese of BRAF mutation with the expression of PDGF-B in cohort by examining its relationship with clinicopatho- PTC was observed (Table 5 and Fig. 1). Specifically, a logical characteristics of PTC. To this end, we also moderate to strong staining of IHC scores 2–3 for investigated the relationship of BRAF mutation with PDGF-B was seen in 27/30 (90.0%) PTC with BRAF peripheral blood platelet counts as thrombocytosis is mutation versus 16/30 (53.3%) PTC without the mutation associated with various human cancers and their poor (PZ0.03). This difference was apparently not due to prognosis (Hernandez et al. 2000, Ikeda et al. 2002, other biological factors, such as patient age or gender, Verheul & Pinedo 2003, Shimada et al. 2004, Brown which could potentially confound the comparison of the et al. 2005, Bensalah et al. 2006). We found a close two groups (Table 5). Linear regression analysis showed association of the T1799A BRAF mutation with that increased platelet count was also marginally extrathyroidal invasion and advanced tumor stages (III associated with increased PDGF-B expression and IV) in this Chinese cohort of PTC. These results are (rZ0.383, PZ0.048). However, this association similar to the findings on BRAF mutation in PTC in other disappeared when cases without BRAF mutation were ethnic populations (Nikiforova et al. 2003, Xing et al. excluded (rZ0.064, PZ0.737). This could be expected 2005, Adeniran et al. 2006, Frasca et al. 2006, Lee et al. given the result that BRAF mutation was associated with, 2006, Riesco-Eizaguirre et al. 2006, Xing 2007), and perhaps a major cause of, increased platelet count or suggesting that BRAF mutation plays a similar role in PDGF-B (Tables 3 and 5). promoting the progression and aggressiveness of PTC in the Chinese population. Interestingly, we for the first time observed also a Discussion significant association of BRAF mutation with higher Association of the T1799A BRAF mutation with poor peripheral blood platelet counts in PTC patients. The clinicopathological outcomes in PTC has been reported BRAF mutation and higher platelet counts were both in various ethnic populations (Namba et al. 2003, individually associated with extrathyroidal invasion of Nikiforova et al. 2003, Xing et al. 2005, Adeniran et al. PTC. When BRAF mutation and platelet count were 2006, Frasca et al. 2006, Kim et al. 2006, Lee et al. 2006, adjusted for each other, in addition to the adjustment for Table 5 Correlation between BRAF T1799A mutation and platelet-derived growth factor (PDGF) expression in papillary thyroid cancer (PTC) BRAF T1799A mutation (NZ30) Without BRAF mutation (NZ30) P value Age (years; meanGS.D.) 48.13G15.012 44.33G15.248 0.335 Gender (male/female) 7/23 4/26 0.506 PDGF-A (IHC scores 2–3; n (%)) 27 (90.0%) 26 (86.7%) 1.00 PDGF-B (IHC scores 2–3; n (%)) 27 (90.0%) 16 (53.3%) 0.03 www.endocrinology-journals.org 187
  6. 6. Y Wang, M Ji et al.: BRAF mutation in thyroid cancer Figure 1 Immunohistochemical staining for PDGF-B in papillary thyroid cancer. Representatives of a BRAF mutation-negative PTC tumor (A) and a BRAF mutation-positive PTC tumor (B), with the former showing weak and the latter strong staining for PDGFB (magnification: 400!). other multiple factors on the multivariate analysis, it was that both VEGF and PDGF play a role in BRAF mutation- mainly BRAF mutation that was still left to be promoted pathogenesis of PTC, such as extrathyroidal significantly associated with extrathyroidal invasion. invasion, which involves and requires vigorous vascular These data suggest that increased platelet count may be a formation. Elevated platelet count in cancer is associated mediating factor involved in BRAF mutation-promoted with increased circulating VEGF and PDGF which can extrathyroidal invasion and aggressiveness of PTC. all be released from platelets (Salven et al. 1999, Verheul Among various clinicopathological characteristics of & Pinedo 2003). The rise in platelet count in cancer is PTC, extrathyroidal invasion is a major risk factor that explained by a model in which intra-tumor activation of predicts tumor progression and aggressiveness (Mazza- platelets leads to release of thrombopoietin, which ferri & Jhiang 1994), and BRAF mutation is most specifically and potently stimulates megakaryocytes in commonly associated with, among various clinicopatho- the bone marrow to produce platelets (Verheul & Pinedo logical characteristics, extrathyroidal invasion (Xing 2003). Based on these previous and our present data, we 2007). Transgenic mouse study clearly demonstrated propose that BRAF mutation-promoted PTC invasion the driving force of the BRAF mutation in promoting involves the production of pro-tumor molecules VEGF extrathyroidal invasion of PTC (Knauf et al. 2005). and PDGF-B from elevated peripheral platelet counts. Therefore, it is convincing that BRAF mutation plays an Therefore, BRAF mutation and platelets seem to important role in driving extrathyroidal invasion. One complete a vicious cycle in which extrathyroidal important molecular mechanism involved in this process invasion of PTC promoted by BRAF mutation promotes is BRAF mutation-promoted methylation and hence platelet production which in turn enhances the pathologic silencing of the tissue inhibitor of metalloproteinase-3 progression of the tumor through accelerated production (TIMP-3; Hu et al. 2006) and over-expression of of angiogenic and pro-tumor molecules by platelets. The metalloproteinases (Melillo et al. 2005, Mesa et al. invasive regions of PTC contain gene expression changes 2006, Palona et al. 2006). TIMP-3 is not only an inhibitor that are consistent with epithelial-to-mesenchymal of metalloproteinases, which promote interstitial matrix transition (EMT; Vasko et al. 2007) and a PDGF destruction and hence cancer invasion, but also an autocrine loop is required for EMT in hepatocellular antagonist of the potent angiogenic molecule vascular carcinomas initiated by activation of the MAP kinase endothelial growth factor (VEGF; Qi et al. 2003). BRAF pathway (Fischer et al. 2007). It would therefore be mutation was shown to be associated with over- interesting to investigate whether the BRAF mutation, expression of VEGF in PTC (Jo et al. 2006). We now platelet, PDGF model proposed here may play a role in also demonstrated the association of BRAF mutation with the development of EMT in PTC. over-expression of PDGF-B in PTC in the present study. In summary, we investigated the relationship of the One mechanism for the increased PDGF-B expression in T1799A BRAF mutation with clinicopathological out- PTC could be through elevation in platelets counts but comes and peripheral blood platelet counts in PTC in a alternative mechanisms such as autocrine production by Chinese cohort. We observed an association of BRAF PTC tumor itself may also exist. It is therefore possible mutation with extrathyroidal invasion, advanced tumor 188 www.endocrinology-journals.org
  7. 7. Endocrine-Related Cancer (2008) 15 183–190 stages, higher peripheral platelet counts, and increased Hu S, Liu D, Tufano RP, Carson KA, Rosenbaum E, Cohen Y, expression of PDGF-B in PTC. These results, together Holt EH, Kiseljak-Vassiliades K, Rhoden KJ, Tolaney S with previous data, support a model in which BRAF et al. 2006 Association of aberrant methylation of tumor mutation and cancer-associated thrombocytosis coordi- suppressor genes with tumor aggressiveness and BRAF nately promotes pathologic progression and aggressive- mutation in papillary thyroid cancer. International ness of PTC. Therefore, adjunctive interference in the Journal of Cancer 119 2322–2329. Hundahl SA, Fleming ID, Fremgen AM & Menck HR 1998 A platelet system may be a helpful therapeutic strategy in the National Cancer Data Base report on 53 856 cases of treatment of aggressive BRAF mutation-harboring PTC. thyroid carcinoma treated in the US, 1985–1995. Cancer 83 2638–2648. Acknowledgements Ikeda M, Furukawa H, Imamura H, Shimizu J, Ishida H, Masutani S, Tatsuta M & Satomi T 2002 Poor prognosis This work was supported partly by an American Cancer associated with thrombocytosis in patients with gastric Society Research Scholar Grant (RSG 05-199-01-CCE) cancer. Annals of Surgical Oncology 9 287–291. to M Xing. Y Wang was a PhD candidate from Qingdao Jo YS, Li S, Song JH, Kwon KH, Lee JC, Rha SY, Lee HJ, University, Qingdao, People’s Republic of China. The Sul JY, Kweon GR, Ro HK et al. 2006 Influence of the authors declare that there is no conflict of interest that BRAF V600E mutation on expression of VEGF in would prejudice the impartiality of this scientific work. papillary thyroid cancer. Journal of Clinical Endocrinology and Metabolism 91 3667–3670. Kim TY, Kim WB, Rhee YS, Song JY, Kim JM, Gong G, References Lee S, Kim SC & Shong YK 2006 The BRAF Adeniran AJ, Zhu Z, Gandhi MC, Steward DL, Fidler JP, mutation is useful for prediction of clinical recurrence Giordano TJ, Biddinger PW & Nikiforov YE 2006 in low-risk patients with conventional papillary thyroid Correlation between genetic alterations and microscopic carcinoma. Clinical Endocrinology 65 364–368. features, clinical manifestations, and prognostic charac- Knauf JA, Ma X, Smith EP, Zhang L, Mitsutake N, Liao XH, teristics of thyroid papillary carcinomas. American Refetoff S, Nikiforov YE & Fagin JA 2005 Targeted Journal of Surgical Pathology 30 216–222. expression of BRAFV600E in thyroid cells of transgenic Bensalah K, Leray E, Fergelot P, Rioux-Leclercq N, Tostain J, mice results in papillary thyroid cancers that undergo ´ Guille F & Patard JJ 2006 Prognostic value of thrombocytosis dedifferentiation. Cancer Research 65 4238–4245. in renal cell carcinoma. Journal of Urology 175 859–863. Lee JH, Lee ES, Kim YS, Won NH & Chae YS 2006 BRAF Brown KM, Domin C, Aranha GV, Yong S & Shoup M 2005 mutation and AKAP9 expression in sporadic papillary Increased preoperative platelet count is associated with thyroid carcinomas. Pathology 38 201–204. decreased survival after resection for adenocarcinoma of Liu S, Semenciw R, Ugnat AM & Mao Y 2001 Increasing the pancreas. American Journal of Surgery 189 278–282. thyroid cancer incidence in Canada 1970–1996: time Davies L & Welch HG 2006 Increasing incidence of thyroid trends and age-period-cohort effects. British Journal of cancer in the United States, 1973–2002. Journal of the Cancer 85 1335–1339. American Medical Association 295 2164–2167. Mazzaferri EL 2006 An overview of the management of Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, thyroid cancer. In Practical Management of Thyroid Teague J, Woffendin H, Garnett MJ, Bottomley W et al. Cancer: A Multidisciplinary Approach, pp 1–28. Eds EL 2002 Mutations of the BRAF gene in human cancer. Mazzaferri, C Harmer, UK Mallick & P Kendall-Taylor. Nature 417 949–954. London, England: Springer-Verlag. Fischer ANM, Fuchs E, Mikula M, Huber H, Beug H & Mazzaferri EL & Jhiang SM 1994 Long-term impact of initial Mikulits W 2007 PDGF essentially links TGF-b signaling to nuclear b-catenin accumulation in hepatocellular surgical and medical therapy on papillary and follicular carcinoma progression. Oncogene 26 3395–3405. thyroid cancer. American Journal of Medicine 97 418–428. Frasca F, Nucera C, Belfiore A, Piero G, Attard M, Stella M, Melillo RM, Castellone MD, Guarino V, De Falco V, Cirafici Pellegriti G, Giordano C, Trimarchi F & Vigneri R 2006 June AM, Salvatore G, Caiazzo F, Basolo F, Giannini R, 24–27 BRAF T1799A mutation in thyroid cancer predicts Kruhoffer M et al. 2005 The RET/PTC-RAS-BRAF linear progressive disease. Abstract #OR 20-2, the 88th Endocrine signaling cascade mediates the motile and mitogenic Society Annual Meeting, Boston, Massachusetts, USA. phenotype of thyroid cancer cells. Journal of Clinical Garnett MJ & Marais R 2004 Guilty as charged: B-RAF is a Investigation 115 1068–1081. human oncogene. Cancer Cell 6 313–319. Mesa C, Mirza M, Mitsutake N, Sartor M, Medvedovic M, Hernandez E, Donohue KA, Anderson LL, Heller PB & Tomlinson C, Knauf JA, Weber GF & Fagin JA 2006 Stehman FB 2000 The significance of thrombocytosis in Conditional activation of RET/PTC3 and BRAFV600E in patients with locally advanced cervical carcinoma: a thyroid cells is associated with gene expression profiles Gynecologic Oncology Group study. Gynecological that predict a preferential role of BRAF in extracellular Oncology 78 137–142. matrix remodelling. Cancer Research 66 6521–6529. www.endocrinology-journals.org 189
  8. 8. Y Wang, M Ji et al.: BRAF mutation in thyroid cancer Namba H, Nakashima M, Hayashi T, Hayashida N, Maeda S, Sandeep TC, Strachan MW, Reynolds RM, Brewster DH, Rogounovitch TI, Ohtsuru A, Saenko VA, Kanematsu T ´ Scelo G, Pukkala E, Hemminki K, Anderson A, Tracey E, & Yamashita S 2003 Clinical implication of hot spot Friis S et al. 2006 Second primary cancers in thyroid BRAF V599E, in papillary thyroid cancers. Journal of cancer patients: a multinational record linkage study. Clinical Endocrinology and Metabolism 88 4393–4397. Journal of Clinical Endocrinology and Metabolism 91 Nikiforova MN, Kimura ET, Gandhi M, Biddinger PW, 1819–1825. Knauf JA, Basolo F, Zhu Z, Giannini R, Salvatore G, Shimada H, Oohira G, Okazumi S, Matsubara H, Nabeya Y, Fusco A et al. 2003 BRAF mutations in thyroid tumors are Hayashi H, Takeda A, Gunji Y & Ochiai T 2004 restricted to papillary carcinomas and anaplastic or poorly Thrombocytosis associated with poor prognosis in differentiated carcinomas arising from papillary patients with esophageal carcinoma. Journal of the carcinomas. Journal of Clinical Endocrinology and American College of Surgeons 198 737–741. Metabolism 88 5399–5404. Vasko V, Espinosa AV, Scouten W, He H, Auer H, Palona I, Namba H, Mitsutake N, Starenki D, Podtcheko A, Liyanarachchi S, Larin A, Savchenko V, Francis GL, de la Sedliarou I, Ohtsuru A, Saenko V, Nagayama Y, Chapelle A et al. 2007 Gene expression and functional Umezawa K et al. 2006 BRAFV600E promotes evidence of epithelial-to-mesenchymal transition in invasiveness of thyroid cancer cells through NF-k B papillary thyroid carcinoma invasion. PNAS 104 activation. Endocrinology 147 5699–5707. 2803–2808. Qi JH, Ebrahem Q, Moore N, Murphy G, Claesson-Welsh L, Verheul HM & Pinedo HM 2003 The importance of platelet Bond M, Baker A & Anand-Apte B 2003 A novel function counts and their contents in cancer. Clinical Cancer for tissue inhibitor of metalloproteinases-3 (TIMP3): Research 9 3219–3221. inhibition of angiogenesis by blockage of VEGF binding Xing M 2005 BRAF mutation in thyroid cancer. Endocrine- to VEGF receptor-2. Nature Medicine 9 407–415. Related Cancer 12 245–262. Riesco-Eizaguirre G, Gutierrez-Martinez P, Garcia-Cabezas MA, Xing M 2007 BRAF mutation in papillary thyroid Nistal M & Santisteban P 2006 The oncogene BRAF V600E cancer: pathogenic role, molecular bases, and is associated with a high risk of recurrence and less clinical implications. Endocrine Reviews 28 differentiated papillary thyroid carcinoma due to the 742–762. impairment of NaC/IK targeting to the membrane. Xing M, Westra WH, Tufano RP, Cohen Y, Rosenbaum Endocrine-Related Cancer 13 257–269. E, Rhoden KJ, Carson KA, Vasko V, Larin A, Tallini Salven P, Orpana A & Joensuu H 1999 Leukocytes and G et al. 2005 BRAF mutation predicts a poorer platelets of patients with cancer contain high levels of clinical prognosis for papillary thyroid cancer. vascular endothelial growth factor. Clinical Cancer Journal of Clinical Endocrinology and Metabolism 90 Research 5 487–491. 6373–6379. 190 www.endocrinology-journals.org

×