Sequenciamento

4,527 views

Published on

Published in: Technology
0 Comments
2 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
4,527
On SlideShare
0
From Embeds
0
Number of Embeds
16
Actions
Shares
0
Downloads
95
Comments
0
Likes
2
Embeds 0
No embeds

No notes for slide

Sequenciamento

  1. 1. Seqüenciamento Prof. Rodrigo Niskier biomedrodrigo.page.tl [email_address]
  2. 2. Seqüenciamento <ul><ul><li>Técnica pela qual a ordem exata dos nucleotídeos em um segmento de DNA pode ser determinada. </li></ul></ul>
  3. 3. Método de Sanger-Coulson: nucleotídeos terminadores de cadeia <ul><li>Necessita de DNA fita simples </li></ul><ul><li>Utiliza apenas um dos primers </li></ul><ul><li>Utiliza dNTPs marcados radioativamente ( 32 P ou 35 S-dNTP) </li></ul><ul><li>Utiliza didesoxinucleotídeos (ddNTPs) </li></ul>
  4. 6. Seqüenciamento automático de DNA <ul><li>Utilização de marcadores fluorescentes ligados a cada um dos ddNTPs </li></ul><ul><li>Ocorre apenas uma reação de seqüenciamento como os 4 ddNTPs </li></ul><ul><li>Moléculas terminadas com ddNTPs diferentes podem ser identificadas por meio de seus sinais fluorescentes distintos </li></ul>
  5. 8. Seqüenciamento automático de DNA <ul><li>A amostra pós-PCR é aplicada num gel ou em um capilar de poliacrilamida e então passado por um detector de fluorescência </li></ul><ul><li>O detector identifica o sinal fluorescente emitido pelas bandas e transmite os dados para o computador </li></ul><ul><li>O computador converte a informação na seqüência de DNA apropriada. </li></ul><ul><li>A seqüência pode ser impressa para análise ou enviada para um arquivo para ser analisada por softwares específicos </li></ul>
  6. 9. Seqüenciamento automático de DNA
  7. 11. Análise do seqüenciamento <ul><li>TAAAGTCCAGAGCCACCATCCTGGCCGCAGGTAGCCGCTGGTCTCCGGGGTCATCTAGCGTCCGACCTCGGAGCGTGCATCCCAGGACGGTGACACCCTCCCCTGAGCTTCGGCGGCCACACAACCTTCCAGGGAGCTACAATGGAAGAATCACAGGCAGAACTCAATGTGGAGCCCCCTCTGAGTCAGGAGACATTTTCCGACTTGTGGAACCTACTTCCTGAAAATAACCTTCTGTCCTCCGAGCTCTCCGCACCCGTGGATGACCTGCTCCCGTACACAGATGTTGCCACCTGGCTGGATGAATGTCCGAATGAAGCGCCCCAAATGCCAGAGCCTTCTGCCCCAGCTGCCCCGCCACCAGCCACCCCAGCACCAGCCACCTCCTGGCCCCTGTCGTCCTTTGTCCCCTCCCAGAAGACCTACCCTGGCAATTACGGTTTCCGTCTAGGGTTCCTGCAATCCGGAACAGCCAAGTCCGTGACCTGCACGTATTCCCCTTCCCTTAACAAGCTGTTCTGCCAGCTGGCCAAGACCTGCCCAGTGCAGCTGTGGGTCGACTCGCCACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGAAGTTGGAGCACATGACGGAGGTTGTGAGGCGTTGTCCCCACCATGAGCGCTCCTCTGACTATAGCGATGGTCTGGCCCCTCCTCAGCACCTTATCCGGGTGGAAGGGAATTTACGCGCGGAGTATTTGGACGACCGGAACACCTTTAGACACAGTGTGGTGGTGCCCTATGAGTCCCCCGAGATCGACTCTGAGTGCACCACCATCCACTACAATTTCATGTGTAACAGCTCCTGCATGGGGGGCATGAACCGGCGGCCCATCCTCACCATCATCACACTGGAAGACTCTTGTGGTAACCTGCTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGCCGCACTGAGGAAGAAAATCTTCGCAAGAAGGGGCAGTCTTGCCCCGAGCCACCCCCTAGGAGCACTAAGCGAGCACTGCCTACCAACACCAGCTCCTCTCCACAGCCAAAGAAGAAACCACTGGATGGAGAGTACTTCACTCTTCAGATCCGTGGGTTTAAACGCTATGAGATGTTCCGAGAGCTGAATGATGCCTTGGAGCTGAAGGATGCTCTGGATGGAAGGGAACCAGGGGAAAGCAGGGCTCACTCTAGCCACCTGAAGTCTAAGAAGAGGCCTTCTCCCTCCTGCCATAAAAAACCAATGCTCAAGAGAGAGGGACCTGACTCAGACTGATGTCTTCTGCTTCCTGTCACCTGTTGACATCCCCACCCATATCCCCTGCTCCTTCCCTGGCATTTTTTAAGACTCAGGTGCTTAGACCTCTGCTTGGTGCAGGTGCGCCTTAGAAACCCCCTGGGAGTCTTCATCTGCTCAGCCTGTGGCTGTGCTAAAGAGGCAGACCTGCGCTCGTGGTTTCTGGGGATTTGGGGGGTGCTGGCGCTTTCCAGCTTAGCTTTCAAGGTTTTTACTGTGAGCCGTGTTCGGGAGAGGTCAGAATGTGTTCCTGCATGTGAGGAACATCTTATAACCAGCCATACACTGGGTTGGAAAACTCAGTCCTCTGCCATACTAGCCAGGGAAGCTATCTTAAGTTGTTCGATTTTCTCCTGACTTCATTGTTCACATCTATAAAAAACTGATAATCATACCTACCTCACGGGGGGTTTGTTGTGAGGGTTAATGAAATAATGTATGTCTGGCCCCAAAACCATTATTTGATTACATAATGTCTGGGACTTAGTGCCTTTTGTGGGTGCTGGTTCTTTGTCCCCCTGGGTGGATGATTTGACAGTTTCTGACTGAATGGCTGGTTAAAGGGAAGAAGTCTCCAAGTCCCTTCTCTCCTGGCCCTGCCAGATCATAACCCCTTGGTGAACCTCAGTGCCAAAGGGGAAAGCTCACCTTATCCTGGATCCCAGTGGCTTCCACCCCTGCTGTATCTGCCAGTACCTGTCTTATTTCCCCCAAATGCTTCCGCAGATTTCTTCTGTACTTTGCAAGGCACACCATGTCACCCACACCCCTCCTCTTCCCTTTTTATATCCCATTTTTTATATCAATTTCTTATTTTACAATAAAACTTTGCTACCAAAAAAAAAAAAAAAA </li></ul>
  8. 12. Análise do seqüenciamento <ul><li>Pesquisar cadeias abertas de leitura (ORF – open reading frames) = ATG </li></ul><ul><li>Existem 6 possíveis ORFs </li></ul><ul><li>ATTHECATATETHERAT </li></ul><ul><li>5´ ATATGATATGATCGACTAGCATC 3´ </li></ul><ul><li>3´ TATACTATACTAGCTGATCGTAG 5´ </li></ul>

×