What can your Dog teach you about Molecular Genetics?
This is what I want you to know <ul><li>Why are geneticists interested in dogs? </li></ul><ul><li>What is a QTL? </li></ul...
Why have dogs become very interesting to molecular geneticists?
Dogs on the cutting edge of genetic research <ul><li>Dog breeds represent a genetic bottleneck that decrease recombinant v...
Canine Genetic Screening <ul><li>Progressive Retinal Atrophy ( PRA ) </li></ul><ul><li>Hypothyroidism with Goiter  ( HTG )...
High quality map of Dog Genome <ul><li>Tasha the boxer </li></ul><ul><li>2005 map of her genome at the Broad Institute. </...
Quick Review of Genetic Terms and Principles Review of Genetics Terms and Principles
Review - Big Ideas in Genetics One gene – One phenotypic trait Recessive genes can  hide  under Dominant Dominant phenotyp...
Review - Big Ideas in Genetics * http://en.wikipedia.org/wiki/Qtl QTL – Quantitative Trait Loci 1908  Nilson-Ehle Many gen...
Review - Big Ideas in Genetics Single Nucleotide Polymorphism *  http://en.wikipedia.org/wiki/Qtl Animation  http://www.dn...
only P1 and P4 have the DNA from grandparents G1 and G4 and thus, it is possible that the disease gene might be somewhere ...
Let’s go to the Movies <ul><li>Look for the following </li></ul><ul><ul><li>Perfect Population </li></ul></ul><ul><ul><li>...
Founders Effect Original Population Survivors are selected for breeding New Population
Population BottleNeck
Bottlenecked Gene Pool Wolf Dog AKC Breeds Wade “The Dog Genome:Sequence, Evolution, and Haplotype Structure” Broad Instit...
The Georgie Project <ul><li>Karl G Lark University of Utah Biology Depart </li></ul>Georgie 1986-1996
Why is PWD population perfect for a genetics study? <ul><li>Inbreeding results in less recombination </li></ul><ul><li>Les...
Documented PWD breeding lines Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs   http://64.226.94.9...
Who’s your Daddy’s Daddy’s Daddy?
With high level of inbreeding all dog would look the same? Polymorphic
Genetic Resource Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs   http://64.226.94.9/npwd.htm
Zero Correlation  Pedigree Markers
Is there a correlation between genetic markers in PWD and breeding lineage? Lark Web Site: Genetics of quantitative traits...
Results - QTL linking the skull, legs ,hip Courtesy Sanger Inst http://www.georgieproject.com/x-ray/x-ray.htm
Results - QTL Size IGF1 Chrom 15 http:// www.ncbi.nlm.nih.gov/mapview/map_search.cgi?taxid =9615&build= current&advsrch = ...
Elegance of the Georgie experiment Free living  population of animals versus a colony of laboratory dogs that are inbred.
Georgie and my dog Are there similar DNA sequences in my dog that will make him susceptible to autoimmune disease? Georgie...
If you can find a population
If you can build a database of BioMarkers
Biomarker Research Protein  Identification Protein Digest  Sample Handling Data Analysis Peptide Separation Data Storage C...
You can crack the code of life’s form and function <ul><li>Genetic regulation of osteoarthritis: A QTL regulating cranial ...
Wealth of research <ul><li>Genetic analysis of the canid skeleton: Analysis of morphological loci (QTLs) in the Portuguese...
Wealth of research <ul><li>Chase K, Lawler DF, Adler FR, Ostrander EA, Lark KG. Bilaterally asymmetric effects of quantita...
April 16 2009 <ul><li>Intended to supplement Genetics Class lectures </li></ul><ul><li>Posted on website: </li></ul><ul><u...
Upcoming SlideShare
Loading in …5
×

What can your dog teach you about Genetics?

2,490 views

Published on

The following is a presentation to supplement a genetics class. The intention is to help build interest by showing dog breeding and how the scientific method has uncovered remarkable information about the morphological changes in dog breeds.

Published in: Technology, Lifestyle
0 Comments
5 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
2,490
On SlideShare
0
From Embeds
0
Number of Embeds
9
Actions
Shares
0
Downloads
4
Comments
0
Likes
5
Embeds 0
No embeds

No notes for slide
  • The following slide presentation is target for 60 minutes. I will relate my story of acquiring a pet dog who with a little research and help from my college class opened up a fascinating world of history, AKC registration, breeding, genetics and developmental biology. I hope you find some things interesting enough to read and research your information on your own dog.
  • What can your dog teach you about Genetics?

    1. 1. What can your Dog teach you about Molecular Genetics?
    2. 2. This is what I want you to know <ul><li>Why are geneticists interested in dogs? </li></ul><ul><li>What is a QTL? </li></ul><ul><li>What is the relationship between QTL’s and phenotypic change? </li></ul><ul><li>Why is a SNP an effective Genetic Marker? </li></ul><ul><li>Explain how a gene pool becomes bottlenecked. </li></ul><ul><li>What is the effect of inbreeding on SNP differences between individual breeds? </li></ul><ul><li>Why does both a pedigree family chart and genetic markers combine for a powerful tool for gene investigation? </li></ul>
    3. 3. Why have dogs become very interesting to molecular geneticists?
    4. 4. Dogs on the cutting edge of genetic research <ul><li>Dog breeds represent a genetic bottleneck that decrease recombinant variability </li></ul><ul><li>Genetic diseases are problematic with inbred dogs. ( At least 350 that are found in humans have been identified in different breeds) </li></ul><ul><li>Many breeds have many generations of breeding documentation </li></ul>
    5. 5. Canine Genetic Screening <ul><li>Progressive Retinal Atrophy ( PRA ) </li></ul><ul><li>Hypothyroidism with Goiter  ( HTG ) (Congenital Hypothyroidism) </li></ul><ul><li>Cystinuria ( CYST ) </li></ul><ul><li>Globoid Cell Leucodystrophy ( GCL ) </li></ul><ul><li>Neuronal Ceroid Lipofuscinosis ( NCL ) </li></ul><ul><li>Phosphofructosokinase Deficiency ( PFK ) </li></ul><ul><li>Von Willebrand Disease ( vWD ) </li></ul><ul><li>Narcolepsy ( NARC ) </li></ul><ul><li>Cone degeneration ( CD ) </li></ul><ul><li>Canine Leucocyte Adhesion Deficiency ( CLAD ) </li></ul><ul><li>Hemophilia B ( HmB ) </li></ul><ul><li>Muscular Dystrophy ( MD ) </li></ul><ul><li>Myotonia Congenita ( MC ) </li></ul><ul><li>GMI Gangliosidosis ( GMIG ) </li></ul><ul><li>Retinal Dystrophy ( prad ) </li></ul><ul><li>SCID ( DNA- PKc & DNA PKc2 ) </li></ul><ul><li>Mucopolysaccharidosis Type VII ( GUSB_NOSVVIII ) </li></ul><ul><li>Thrombasthenic Thrombopathia (  THROM) </li></ul><ul><li>Congenital Cardiac Defects </li></ul><ul><li>OFA Elbow & Hip Dysplasia </li></ul>
    6. 6. High quality map of Dog Genome <ul><li>Tasha the boxer </li></ul><ul><li>2005 map of her genome at the Broad Institute. </li></ul><ul><li>Map of 2,400 million bases </li></ul><ul><li>ATTTACGGATTACACGGAGG </li></ul><ul><li>representing 18,846 genes </li></ul>http://www.biologycorner.com/bio1/DNA.html http://www.broad.mit.edu/media/2004/doggenome_0714.html
    7. 7. Quick Review of Genetic Terms and Principles Review of Genetics Terms and Principles
    8. 8. Review - Big Ideas in Genetics One gene – One phenotypic trait Recessive genes can hide under Dominant Dominant phenotype One phenotype – different genotypes! or BB Bb
    9. 9. Review - Big Ideas in Genetics * http://en.wikipedia.org/wiki/Qtl QTL – Quantitative Trait Loci 1908 Nilson-Ehle Many genes + environment One quantitative trait =
    10. 10. Review - Big Ideas in Genetics Single Nucleotide Polymorphism * http://en.wikipedia.org/wiki/Qtl Animation http://www.dnai.org/text/mediashowcase/index2.html?id=1083
    11. 11. only P1 and P4 have the DNA from grandparents G1 and G4 and thus, it is possible that the disease gene might be somewhere near ? . ~85% probability of finding a simple recessive trait. Review - Gene Markers for Beginners Now imagine that grandparents G1 and G4 and puppies P1 and P4 have the disease and we're looking at a recessive mode of inheritance. We would then look at the DNA markers we have and see that at position ?
    12. 12. Let’s go to the Movies <ul><li>Look for the following </li></ul><ul><ul><li>Perfect Population </li></ul></ul><ul><ul><li>Bottleneck </li></ul></ul><ul><ul><li>Regulatory Gene </li></ul></ul><ul><li>Describe the 3 sets of data necessary for this experimental design? </li></ul>http://watch.discoverychannel.ca/daily-planet/february-2009/daily-planet-february-26-2009/#clip144136
    13. 13. Founders Effect Original Population Survivors are selected for breeding New Population
    14. 14. Population BottleNeck
    15. 15. Bottlenecked Gene Pool Wolf Dog AKC Breeds Wade “The Dog Genome:Sequence, Evolution, and Haplotype Structure” Broad Institute MIT
    16. 16. The Georgie Project <ul><li>Karl G Lark University of Utah Biology Depart </li></ul>Georgie 1986-1996
    17. 17. Why is PWD population perfect for a genetics study? <ul><li>Inbreeding results in less recombination </li></ul><ul><li>Less recombination results in fewer SNPs </li></ul><ul><li>Fewer SNPS make it easier to identify genetic locations </li></ul><ul><li>Documented phenotype of size, disease, hair, color in pedigree charts from breeders </li></ul><ul><li>Easier to uncover loci for base sequences responsible for phenotype </li></ul>
    18. 18. Documented PWD breeding lines Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm
    19. 19. Who’s your Daddy’s Daddy’s Daddy?
    20. 20. With high level of inbreeding all dog would look the same? Polymorphic
    21. 21. Genetic Resource Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm
    22. 22. Zero Correlation Pedigree Markers
    23. 23. Is there a correlation between genetic markers in PWD and breeding lineage? Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm
    24. 24. Results - QTL linking the skull, legs ,hip Courtesy Sanger Inst http://www.georgieproject.com/x-ray/x-ray.htm
    25. 25. Results - QTL Size IGF1 Chrom 15 http:// www.ncbi.nlm.nih.gov/mapview/map_search.cgi?taxid =9615&build= current&advsrch = off&query =igf1
    26. 26. Elegance of the Georgie experiment Free living population of animals versus a colony of laboratory dogs that are inbred.
    27. 27. Georgie and my dog Are there similar DNA sequences in my dog that will make him susceptible to autoimmune disease? Georgie McGyver
    28. 28. If you can find a population
    29. 29. If you can build a database of BioMarkers
    30. 30. Biomarker Research Protein Identification Protein Digest Sample Handling Data Analysis Peptide Separation Data Storage Cells or Tissue Thermo Scientific Laboratory Workflow Sample Preparation Data Interpretation & Storage Sample Analysis Robotics Centrifuges Concentrators Liquid Chromatography/Mass Spectrometry Lab Information Management System Microplate Readers Software Xcalibur Protein Fractionation Freezers Biomarker Identified
    31. 31. You can crack the code of life’s form and function <ul><li>Genetic regulation of osteoarthritis: A QTL regulating cranial and caudal acetabular osteophyte formation in the hip joint of the dog (Canis familiaris). Amer. J. Med. Genet. 135A(3):334-335. http://www3.interscience.wiley.com/cgi-bin/jtoc/33129/ Carrier DR, Chase K, Lark KG. </li></ul><ul><li>Genetics of canid skeletal variation: size and shape of the pelvis. Genome Res. 2005 Dec;15(12):1825-30. PMID: 16339381 [PubMed - indexed for MEDLINE] Chase K, Carrier DR, Adler FR, Ostrander EA, Lark KG . </li></ul><ul><li>Interaction between the X chromosome and an autosome regulates size sexual dimorphism in Portuguese Water Dogs. Genome Res. 2005 Dec;15(12):1820-4. PMID: 16339380 [PubMed - indexed for MEDLINE] Lark, K.G., Chase, K., Carrier, D.R. and F.R. Adler (2005) </li></ul>
    32. 32. Wealth of research <ul><li>Genetic analysis of the canid skeleton: Analysis of morphological loci (QTLs) in the Portuguese Water Dog population. In: &quot;The Genome of the Domestic Dog&quot; (Cold Spring Harbor Monograph Series 44). pp. 67-80. Editors: E.A. Ostrander, U. Giger, and K. Lindblad-Toh. Cold Spring Harbor Press, Cold Spring Harbor, NY. Trut, L.N., Kharlamova, A.V., Carrier, D.R., Chase, K., Kukekova, A.V., Acland, G.M. and K.G. Lark (2005) </li></ul><ul><li>Morphology and behavior: Are they coupled at the genome level? In: &quot;The Genome of the Domestic Dog² (Cold Spring Harbor Monograph Series 44). pp. 81-93. Editors: E.A. Ostrander, U. Giger, and K. Lindblad-Toh. Cold Spring Harbor Press, Cold Spring Harbor, NY. Lark KG, Chase K, Sutter NB . </li></ul><ul><li>Genetic architecture of the dog: sexual size dimorphism and functional morphology. Trends Genet. 2006 Oct;22(10):537-44. Epub 2006 Aug 24 PMID: 16934357 [PubMed - in process </li></ul>
    33. 33. Wealth of research <ul><li>Chase K, Lawler DF, Adler FR, Ostrander EA, Lark KG. Bilaterally asymmetric effects of quantitative trait loci (QTLs): QTLs that affect laxity in the right versus left coxofemoral (hip) joints of the dog (Canis familiaris). Am J Med Genet A. 2004 Jan 30;124(3):239-47. PMID: 14708095 [PubMed - indexed for MEDLINE] Chase K, Carrier DR, Adler FR, Jarvik T, Ostrander EA, Lorentzen TD, Lark KG. </li></ul><ul><li>Inherited infantile dilated cardiomyopathy in dogs: genetic, clinical, biochemical, and morphologic findings. Am J Med Genet. 2000 Nov 6;95(1):57-66. PMID: 11074496 [PubMed - indexed for MEDLINE] Chase K, Adler FR, Miller-Stebbings K, Lark KG. </li></ul><ul><li>Teaching a new dog old tricks: identifying quantitative trait loci using lessons from plants. J Hered. 1999 Jan-Feb;90(1):43-51. PMID: 9987902 [PubMed - indexed for MEDLINE] </li></ul>
    34. 34. April 16 2009 <ul><li>Intended to supplement Genetics Class lectures </li></ul><ul><li>Posted on website: </li></ul><ul><ul><li>http:// sites.google.com/site/eleaningmodulesinbiology / </li></ul></ul><ul><li>Material was assembled for a project for Harvard Extension “The Cognitive Dog” Class </li></ul>

    ×