Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Loss of photoreceptor potential from retinal progenitor cell cultures,
despite improvements in survival
Fiona C. Mansergh ...
Transplantation studies have shown that a sub-fraction of freshly
dissociated cells from PN2e6 mouse retinas can integrate...
carried out as previously described (Chadderton et al., 2009). Fixa-
tion, cryosectioning and staining were carried out as...
manufacturer’s protocol. Q-PCRs were carried out using either RNA
or DNA with the appropriate one step or two step QuantiT...
months later occurs as a result of the fact that rhodopsin is
increasingly expressed in rod photoreceptors as rod cells ma...
a strong preference for attachment to tissue culture flasks and even
tend to attach to bacterial Petri-dishes. Concern was ...
Effects of Substrate on RPC Proliferation
U
nc
tao
ed,
-72B
A
Rn
U
c
tao
e
2
N,d
NF
LLP
L
DP
P
N
R
O
G
EL
L
MA
VN
LL
O
C
M...
conditions. Growth of retinospheres was tested with a number of
different media and supplements. No combination gave rise ...
retinal cells, many of which have already adopted differing cell
fates, the uniform morphology would indicate that tissue ...
F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e1410
YEXER5575_proof ■ 21 July 2010 ■ 10/14
Please cite this...
Expansion of RPCs in culture eliminates photoreceptor
morphology after transplantation. This could occur for a number of
r...
the initial period of growth post-plating; this morphology does not
change with subsequent passages, suggesting expansion ...
Health Research Board Ireland (HRB), Science Foundation Ireland
(SFI) and the Deutsche Forschungsgemeinschaft (DFG). We wo...
Soederpalm, A.K., Fox, D.A., Karlsson, J.-O., van Veen, T., 2000. Retinoic acid
produces rod photoreceptor selective apopt...
Upcoming SlideShare
Loading in …5
×

Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival

306 views

Published on

  • Be the first to comment

  • Be the first to like this

Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival

  1. 1. Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival Fiona C. Mansergh a,*, Reaz Vawda a,b , Sophia Millington-Ward a , Paul F. Kenna a , Jochen Haas c , Clair Gallagher d , John H. Wilson e , Peter Humphries a , Marius Ader a,c , G. Jane Farrar a a Ocular Genetics Unit, Smurfit Institute of Genetics, Trinity College Dublin, Lincoln Place Gate, Dublin 2, Ireland b Fighting Blindness Vision Research Institute, 1 Christchurch Hall, Dublin 2, Ireland c DFG-Center for Regenerative Therapies Dresden, Cluster of Excellence/TU Dresden, c/o MTZ, Fiedlerstr. 42, 01307 Dresden, Germany d National Institute of Cellular Biotechnology (NICB), Dublin City University, Glasnevin, Dublin 9, Ireland e Department of Biochemistry and Molecular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA a r t i c l e i n f o Article history: Received 6 May 2010 Accepted in revised form 7 July 2010 Available online xxx Keywords: retinal progenitor cells cell culture FACS rhodopsin photoreceptor retina a b s t r a c t Retinal degeneration (RD) results from photoreceptor apoptosis. Cell transplantation, one potential therapeutic approach, requires expandable stem cells that can form mature photoreceptors when differentiated. Freshly dissociated primary retinal cells from postnatal day 2e6 (PN2e6) mouse retina can give rise, post-transplantation, to photoreceptors in adult recipients. Unfortunately, incorporation rates are low; moreover, photoreceptor potential is lost if the same PN2e6 cells are cultured prior to transplantation. We investigated the identity of the cells forming photoreceptors post-transplantation, using FACS sorted primary postnatal day (PN) 3e5 Rho-eGFP retinal cells. Higher integration rates were achieved for cells that were expressing Rho-eGFP at PN3e5, indicating that post-mitotic photoreceptor precursors already expressing rhodopsin form the majority of integrating rods. We then investigated improvement of cell culture protocols for retinal progenitor cells (RPCs) derived from PN3e5 retinal cells in vitro. We succeeded in improving RPC survival and growth rates 25-fold, by modifying retinal dissociation, replacing N2 supplement with B27 supplement minus retinoic acid (B27 À RA) and coating flasks with fibronectin. However, levels of rhodopsin and similar photoreceptor-specific markers still diminished rapidly during growth in vitro, and did not re-appear after in vitro differentiation. Similarly, transplanted RPCs, whether proliferating or differentiated, did not form photoreceptors in vivo. Cultured RPCs upregulate genes such as Sox2 and nestin, markers of more primitive neural stem cells. Use of these cells for RD treatment will require identification of triggers that favour terminal photoreceptor differ- entiation and survival in vitro prior to transplantation. Ó 2010 Elsevier Ltd. All rights reserved. 1. IntroductionQ1 Retinal degeneration (RD) involves the gradual loss of photo- receptors by apoptosis, causing visual impairment and eventual blindness. Inherited RD is genetically heterogeneous. To date, over 190 loci have been identified (RetNet; http://www.sph.uth.tmc. edu/Retnet/). The disability associated with various forms of RD carries a great social and economic cost. Retinitis pigmentosa (RP) affects 1 in 3000 people, while age related macular degeneration (AMD) affects as many as 1 in 10 over-65s. Gene therapy-based approaches have shown therapeutic promise in clinical trials (Maguire et al., 2008, 2009; Bainbridge et al., 2008; Cideciyan et al., 2008), but require some surviving cells in order to work. Cell therapy for advanced disease may provide a complimentary approach. A variety of stem cell sources have been identified, including ciliary epithelial cells (CE), retinal progenitor cells (RPCs, derived from embryonic or early postnatal neural retinas), embryonic stem (ES) cells, and induced pluripotent stem (iPS) cells. Ciliary epithelial cells (CE) are derived from the ciliary margin and can generate spheres in culture which upregulate neuro-retinal genes (Tropepe et al., 2000; Coles et al., 2004; Das et al., 2005), However, recent reports note that these cells fail to form bona fide retinal neurons and glia (Cicero et al., 2009; Gualdoni et al., 2010); this source of stem cells has therefore not been investigated further here. * Corresponding author. Tel.: þ353 1 8962484; fax: þ353 1 8963848. E-mail addresses: mansergf@tcd.ie (F.C. Mansergh), reaz.vawda@fightingblindness. ie (R. Vawda), sophia@maths.tcd.ie (S. Millington-Ward), pfkenna@tcd.ie (P.F. Kenna), jochen.haas@crt-dresden.de (J. Haas), clair.gallagher@dcu.ie (J.H. Gallagher), jwilson@ bcm.tmc.edu (J.H. Wilson), pete.humphries@tcd.ie (P. Humphries), marius.ader@crt- dresden.de (M. Ader), gjfarrar@tcd.ie (G.J. Farrar). Contents lists available at ScienceDirect Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer 0014-4835/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.exer.2010.07.003 Experimental Eye Research xxx (2010) 1e14 YEXER5575_proof ■ 21 July 2010 ■ 1/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110
  2. 2. Transplantation studies have shown that a sub-fraction of freshly dissociated cells from PN2e6 mouse retinas can integrate into adult host retina, show morphology characteristic of photoreceptors and can ameliorate symptoms of RD (MacLaren et al., 2006; Bartsch et al., 2008; West et al., 2008, 2009). Similar transplants using cultured cells derived from embryonic to postnatal day 6 retinas (RPCs) (or, indeed, freshly dissociated primary retinal cells from embryonic retinas or retinas older than the first postnatal week) do not result in photoreceptor morphology. Optimal integration coincides with the birth of rod photoreceptors. Integrated cells are thought to be post-mitotic (MacLaren et al., 2006; West et al., 2009). Moreover the frequency of integration is low even at PN4 (0.6%), and transplantation is less successful in diseased retinas, perhaps because of the gliosis that accompanies RD (West et al., 2009). Disruption of the outer limiting membrane (OLM; a barrier between the subretinal space and the outer nuclear layer) can increase the proportion of integrating cells; however, percentages are still small (West et al., 2008, 2009). Primary retinal cells dissociated from late embryonic (E14.5 and subsequent) and early postnatal mouse retinas can be expanded in tissue culture. Adherent cultures are established within a few days, can be passaged after 1 month, and can be grown indefinitely (Klassen et al., 2004; Angénieux et al., 2006; Merhi-Soussi et al., 2006). These cells are described here as retinal progenitor cells (RPCs). RPCs are typically expanded in serum-free media optimized for neural cultures with N2 supplement (or similar), epidermal growth factor (EGF) and fibroblast growth factor 2 (FGF2), which have both been shown to have a proliferative effect on these cells (Kelley et al., 1995; Chacko et al., 2000; Das et al., 2005). Moreover, there are indications that EGF, which biases towards glial cell fate in neural stem cell cultures, can act as a potent neuralizingQ2 factor in retinal cells (Angénieux et al., 2006). Plating on laminin, sometimes with poly-L-ornithine, and sequential withdrawal of EGF, then FGF2 five days later, is used to differentiate RPCs in vitro, followed by addition of B27 supplement. Adherent RPCs, classified variously as retinal stem cells, retinal progenitor cells, retinal precursor cells, radial glial cells and/or proliferating Mueller glia, show a capacity to generate retinal neurons, including those expressing photoreceptor markers (Klassen et al., 2004; Merhi-Soussi et al., 2006; Canola et al., 2007). Cultured RPCs transplanted either subretinally or intravitreally can integrate into the retina and have been shown to generate some level of therapeutic effect (Klassen et al., 2004). However, reports of photoreceptor morphology arising from transplantation of postnatal rodent RPC cultures are discordant (Klassen et al., 2004; Reh, 2006; Canola et al., 2007; Lamba et al., 2008; West et al., 2009Q3 ), with the majority now suggesting that such events are rare or non-existent (West et al., 2009). Retinal differentiation protocols have been developed for RPCs, embryonic neural stem cells, ES and iPS cells (Zhao et al., 2002; Merhi-Soussi et al., 2006; Aoki et al., 2008; Meyer et al., 2006, 2009; Lamba et al., 2006, 2010; Ikeda et al., 2005; Osakada et al., 2008; Jagatha et al., 2009; Hirami et al., 2009). ES or iPS-derived cells also give relatively low integration rates of 0.1e0.5% of cells initially transplanted, although some photoreceptor morphology is achieved (Osakada et al., 2008; Lamba et al., 2009, 2010). The ability to generate pure expandable cultures from which larger numbers of photoreceptors can be obtained is a pre-requisite for RD cellular therapies. Firstly, we have investigated the identity of the primary retinal cells that can integrate and give rise to photoreceptors. We have found that PN3e5 Rho-eGFP primary retinal cells already expressing rhodopsin at PN3e5 are more likely to integrate into the outer nuclear layer (ONL) and form morphologically mature photorecep- tors after transplantation than those Rho-eGFP cells not expressing rhodopsin at the point of transplantation. Cells expressing rhodopsin at PN3e5 are almost certainly post-mitotic, as rhodopsin is a product of terminal rod differentiation. Rhodopsin expression is therefore a good marker for photoreceptor potential post-transplantation; however, this is rapidly lost from RPC cultures. We hypothesized that sub-optimal initial culture conditions may result in poor survival of photoreceptor precursors. However, we have achieved a 25-fold improvement in growth rate via extensive protocol changes, but no increases were observed in rhodopsin expression levels or integra- tion rates post-transplantation, regardless of whether proliferating or differentiated RPCs were analysed. Expression patterns of marker genes in proliferating RPCs show that they are undifferentiated; hence, we are losing cells that have already chosen a photoreceptor cell fate. Rapid loss of rhodopsin expression after introduction of the cells to tissue culture indicates that the majority of post-mitotic cells are dying within 3 days. Identifying cues by which retinal progeni- tors are specified in vivo, and culture conditions that promote survival in vitro after specification, but prior to injection, will be necessary for therapeutic use of these cells in RD. However, the improvements in isolation and growth rates described here will be useful to anyone who might wish to investigate the therapeutic potential of these cells for disorders such as glaucoma, Leber’s hereditary optic neuropathy, or retinoschisis, where the defect does not lie within the photoreceptor layer. 2. Materials and methods 2.1. Retinal dissociation and FACS analysis For FACS experiments, we used postnatal PN3e5 rhodopsin-eGFP (Rho-eGFP; Chan et al., 2004) heterozygote mice as donors for FACS and subsequent transplantation. These mice express a human Rho- eGFP fusion protein that is visible in rod outer segments following transplantation. Heterozygotes were used in our experiments as homozygotes show symptoms of retinal degeneration (Chan et al., 2004). Retinas were dissected and placed in 1 ml HBSS (Lonza). The ciliary margin was removed from all retinas prior to dissociation. Retinal cells were analysed by FACS as previously described (Palfi et al., 2006). Following FACS analysis, cells were spun at 2000 rpm for 5 min and resuspended such that the approximate concentration of cells was 200,000 per 3 ml (cell count obtained from FACS). Following subretinal injection (see below), residual cell samples were counted using a haemocytometer in order to assess the actual number and viability of cells injected (given the time elapsed, this could vary substantially from FACS figures). For each time point, FACS sorting was carried out 3 times and for each repetition, at least 3 eyes were injected with positive and 3 eyes with negative cells. Unsorted cells were also transplanted as a control. Animals were sacrificed 3 months post-transplantation, eyes were sectioned as described below. Given the fact that eGFP, in Rho-eGFP cells, is expressed as a rhodopsin-eGFP fusion protein, positive cells were identified via eGFP positive, morphologically correct outer segments adjacent to the RPE. 2.2. Animals, transplantation, cryosectioning, eGFP transplantation cell counts For transplantation studies involving cultured RPCs, cells were isolated at PN3e5 from transgenic mice ubiquitously expressing eGFP (Okabe et al., 1997). Recipients for all transplantations were C57Bl6/J mice between 2 and 6 months of age. For tissue culture studies, PN3e5 Rho-eGFP, eGFP, C57Bl6/J and RhoÀ/À donor mice (Humphries et al., 1997) were used. Subretinal injections were carried out in strict compliance with EU and Irish law (Cruelty to Animals Act 2002) and with the ARVO statement for animal use in ophthalmic research. Anaesthesia and subretinal injections were F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e142 YEXER5575_proof ■ 21 July 2010 ■ 2/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240
  3. 3. carried out as previously described (Chadderton et al., 2009). Fixa- tion, cryosectioning and staining were carried out as previously described (Kiang et al., 2005). All sections were cut at 12.5 mm thickness and were DAPI stained. Cells were counted on a fluores- cent microscope (Zeiss, Axioplan 2); channels specific for RFP were checked for each positive cell to ensure omission of false positives due to autofluorescence. eGFP-positive cells were counted in different categories, depending on retinal location and morphology. Cells were counted as either unincorporated (balls of unintegrated cells adjacent to the injection site, for example), retinal (having migrated into the retina but with no evidence of integration), integrated (visible evidence of axons, dendrites etc), or possessing photoreceptor morphology (see above). Photoreceptor morphology was not seen following transplantation of cultured RPCs, only after transplantation of fresh retinal cells. In every instance, the entire eye was sectioned and all 12.5 mm sections obtained were mounted, DAPI stained and counted. Following sectioning and counting, numbers of correctly integrated cells were divided by the original number injected (haemocytometer figures used for FACS cells) and multiplied by 100 to give the percentage of integrated cells, photoreceptors etc. Results were graphed using GraphPad Prism 3.0. 2.3. Retinal dissociation for subsequent tissue culture Retinas were placed in 1 ml PBS or HBSS following dissection. The ciliary margin was removed from all retinas prior to dissociation, in order to avoid contamination by CE cells in subsequent cultures. Old dissociation method: Retinas were placed in 1 ml HBSS (Lonza) and 100 ml 10 mg/ml trypsin (Sigma) was added. Retinas were incubated for 10 min at 37 C, after 5 min, 10 ml 10 mg/ml DNase1 þ100 ml 20 mg/ml trypsin inhibitor were added and samples were triturated with a P1000 pipette (Gilson). Cells were spun for 5 min at 2000 rpm (Thermo Microlite microcentrifuge) and cells were resuspended in 1 ml growth medium. New methods: 100 ml 0.25% trypsin/EDTA (Lonza/Biowhittaker) or 100 ml Accutase (Sigma) were added, retinas were incubated for 5 min at 37 C, allowed to settle to the bottom of the tube and most of the supernatant was aspirated away. 1 ml growth medium was then added and retinas were dissociated by trituration with a fire polished Pasteur pipette. Retinas prepared via mechanical dissociation followed the same procedure, but omitting enzymatic digestion. Following dissociation, cells were counted four times using a haemocytometer. 2.4. Tissue culture 2.4.1. Media, supplements, growth factors Neurobasal medium, B27 and B27 without Vitamin A (B27 À RA) were obtained from Invitrogen; DMEM/F12, embryonic and post- natal stem cell media were from Sigma. Growth medium for RPCs was composed of DMEM/F12 supplemented with 1Â N2, 1Â B27, 1Â B27 À RA or a combination thereof. 1Â L-glutamine (Lonza), 1Â penicillin/streptomycin (Lonza), 5 mg/ml heparin (Sigma), 20 ng/ml fibroblast growth factor 2 (FGF2) and 20 ng/ml epidermal growth factor (EGF) were also added. RPCs were grown in Sarstedt T25 flasks; other plastics were less conducive to growth. Neurobasal and other media were supplemented as for DMEM/F12. 2.4.2. Differentiation Cells were differentiated in vitro by plating cells on laminin coated T25s or poly-L-lysine and laminin coated glass cover slips. After 2e4 days, EGF was withdrawn from the medium for 5 days, followed by use of final growth medium supplemented with B27 þ RA and no growth factors for 5e7 days. Glial differentiation can be enhanced by adding 1% fetal calf serum (FCS) to the final growth medium. 2.4.3. Substrates Collagen, fibronectin, laminin, poly-L-ornithine, poly-L-lysine, poly-D-lysine and vitronectin were obtained from Sigma, while gelatin was obtained from Millipore. All were applied at 0.1% for 2 h at room temperature or overnight at 4 C. Flasks were rinsed in 1Â PBS (Lonza) twice before addition of media and cells. 2.4.4. Dissociation Cells were placed in T25 flasks at a noted cell density in 5 ml growth medium and incubated at 37 C and 5% CO2. After initial plating, the medium was replaced completely after 5e7 days initially, then every 2e7 days depending on density. 2.4.5. Passaging Cells were passaged when 80e90% confluent. 0.5 ml 0.25% trypsin/EDTA (Lonza) or Accutase (Sigma) were added to each T25 flask, following removal of medium and rinsing with 1Â PBS. Flasks were incubated for 5e10 min until cell monolayers lifted off. Cells were resuspended in 3 ml DMEM/F12, counted four times and spun at 1000 rpm. The supernatant was removed, pellets were resus- pended in growth medium and replated, frozen, or treated with TRI reagent (Sigma). 2.4.6. Calculations Initial cell density and date of plating were noted for each flask. The number of days to reach 80e90% confluence was also noted. Cells were counted at each passage (p) and the rate of cell growth was calculated as follows: Increase in cell no: per day ¼ ððCell no: at pN þ 1Þ À ðCell no: at pNÞÞ No: of days between pN þ 1 and pN 2.4.7. Freezing Cells were resuspended in 1 ml freeze medium (7.5% glucose, 10%BSA or 1% B27 À RA,10% DMSO, made up in DMEM/F12 medium (Sigma)), placed in a Mr Frosty and frozen at À70 C. Thawed cells were placed in 5 ml DMEM/F12 and spun before replating. 2.5. RNA extraction Cell pellets were resuspended in 1 ml TRI reagent (Sigma) and triturated using a P1000, while retinas were homogenized in 1 ml TRI reagent using a Dounce homogenizer (Fisher). RNA was prepared according to the manufacturer’s protocol. RNA samples were assayed for concentration and quality using a Nanodrop ND1000 (NanoDrop Technologies) spectrophotometer. 2.6. RT-PCR Reverse transcription was carried out as previously described (Mansergh et al., 2009). Primers were obtained from Sigma-Genosys (see Table 1). PCRs were carried out using Crimson Taq and buffer (NEB) according to the manufacturer’s instructions. A “no RT” control corresponding to each sample was included. Housekeeping genes (beta-actin, Gapdh, 18S rRNA) were also tested by DNA based Q-PCR to ensure that CT values for each gene were within a similar range (1.5CT difference from an average obtained for all samples). 2.7. Q-PCR HPLC purified primers were obtained for one step real-time Q-PCR (Sigma-Genosys). 5 Q4ml of each RNA sample was treated with DNAfree (Ambion) in a volume of 30 ml according to the F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e14 3 YEXER5575_proof ■ 21 July 2010 ■ 3/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370
  4. 4. manufacturer’s protocol. Q-PCRs were carried out using either RNA or DNA with the appropriate one step or two step QuantiTect kits (Qiagen) as described previously (O’Reilly et al., 2007). Slopes were obtained for all Q-PCR primers used with respect to beta-actin. All were 0.1; allowing use of the DDCt method to calculate fold changes. 2.8. Immunocytochemistry Cells were allowed to attach to poly-L-lysine and laminin coated 10e13 mm diameter cover slips placed in 12 or 24 well tissue culture plates, in growth medium. For differentiated cells, differ- entiation medium was applied after 24 h, followed after 5 days by final differentiation medium, for a further 5 days. Cells were treated with 4% PFA for 10 min, rinsed with 1Â PBS 4 times, then treated with blocking solution (0.1% Triton, 10% donkey serum, 1% BSA) for 15 min. Primary antibodies GFAP (1/1000 dilution, Sigma), nestin, (1/100 dilution, DSHB), b-III-tubulin (1/4000 dilution, Convance Q5), Pax6 (1/500 dilution, Convance), glutamine synthetase (1/250, BD Biosciences), rhodopsin (1/100, Chemicon) and synaptophysin (1/300, Sigma) were added at the stated dilutions for 30e60 min at room temperature. 3 washes of 1Â PBS were carried out, followed by one of 3% BSA. Secondary antibody (1/100e1/1000 Cy3 anti- mouse, Cy3 anti-rabbit, Cy2 anti-mouse as appropriate, Jackson Immuno-Research) was then applied for 1 h. 2Â washes of 1Â PBS, 1 wash of 1Â PBS þ DAPI and a final 1Â PBS wash were then carried out. Slides were inverted on poly-L-lysine coated slides using AquaPolyMount (PolySciences), dried at 4 C overnight and pho- tographed on a fluorescent microscope (Zeiss, Axioplan 2). 3. Results 3.1. FACS analysis and transplantation In order to investigate the identity of cells that can integrate and give rise to photoreceptors, we used FACS sorting with primary retinal cells from Rho-eGFP mice. Rhodopsin expressing, eGFP- positive cells from PN3e5 Rho-eGFP donor mice were separated from non-rhodopsin expressing, eGFP-negative PN3e5 Rho-eGFP cells from the same retinas, using FACS. PN3e5 cells expressing rhodopsin were then transplanted into 2e6 month old C57Bl/6J recipients separately from FACS sorted Rho-eGFP cells not expressing rhodopsin. Animals were sacrificed after 3 months, longer than the 2e4 week intervals used in previous studies, in order to assess long-term graft survival. NOTE: It is possible to count eGFP-positive photoreceptors following transplantation from the Rho-eGFP-negative pool, despite the fact that re-analysis of the FACS pool immediately post-sorting indicates that it is indeed 99% negative. The presence of positive cells in the recipient retina 3 Table 1 Primer sequences for PCRQ8 . 18Smm F: GTAACCCGTTGAACCCCATT 18Smm R: CCATCCAATCGGTAGTAGCG Gapdh F: ACCACAGTCCATGCCATCAC Gapdh R: TCCACCACCCTGTTGCTGTA B-actin F: CGTGGGCCGCCCTAGGCACCA B-actin R: TTGGCCTTAGGGTTCAGGGGG Brn3b F: TGGTGCTTACTCTGCTGGATTCT Brn 3b R: CCTATTTGTGTGTGTGCTCCAA Rpf1 F: CCTACCACAGGAAGCCCAAG Rpf1 R: TGGATGGCTCACTCCCAATAA Thy1 F: CCTGTAGTGAGGGTGGCAGA Thy1 R: GGATCAGGGACAGCAAGAGG Isl1 F: CACAGAGCGGAAGAAACCAG Isl1 R: GGGAGGAGAGGCAAACGTAA Atoh7 F: CCAGGACAAGAAGCTGTCCAA Atoh7 R: CCCATAGGGCTCAGGGTCTA Bsn F: ATCCCTGGCCCTTATGTTGA Bsn R: GTTCACCCTGCCCAAAGAAC Nr2e3 F: TTGGGAAATTGCTCCTCCTG Nr2e3 R: CCTGTGGACACTTGGCACTC Arr3 F: CTGGATGGCAAACTCAAGCA Arr3 R: AGGAGATGGCTTTGGATGGA CcnD1 F: TCTGCTTGACTTTCCCAACC CcnD1 R: TGGTCCCACCTTCACCTCTT mKi67 F: CAACCATCCAGGGAAACCAG mKi67 R: GGCATCTGTGTGGGTCCTTT Th F: TTCGAGGAGAGGGATGGAAA Th R: CGACGCACAGAACTGAGGAG ChAT F: TCTGCTGTTATGGCCCTGTG ChAT R: AGATTGCTTGGCTTGGTTGG Gad1 F: AAGCAACTACAGGGCGGATG Gad1 R: GGGTACTAACAGGGAGGGTGTG Gabbr1 F: TGTGTGTGTGTTGCCCTGAC Gabbr1 R: CAAAGTGGGACGCATGAGAA Syp F: ATGGTTGGGAGCTGTGAGGT Syp R: AGGGAGAGGGCAGAGAAAGG Oct4 F: GAGCACGAGTGGAAAGCAAC Oct4 R: CGCCGGTTACAGAACCATAC Brachyury F: CATGTACTCTTTCTTGCTGG Brachyury R: GGTCTCGGGAAAGCAGTGGC KDR F: TTTGGCAAATACAACCCTTCAGA KDR R: GCAGAAGATACTGTCACCACC Fgf5 F: TGTGTCTCAGGGGATTGTAGG Fgf5 R: AGCTGTTTTCTTGGAATCTCTCC GscF: CAGATGCTGCCCTACATGAAC GscR: TCTGGGTACTTCGTCTCCTGG Gapdh F F: ACCACAGTCCATGCCATCAC Gapdh R: TCCACCACCCTGTTGCTGTA B-actin F: CGTGGGCCGCCCTAGGCACCA B-actin R: TTGGCCTTAGGGTTCAGGGGG Nodal F: TTCAAGCCTGTTGGGCTCTAC Nodal R: TCCGGTCACGTCCACATCTT Mash1 F: CCACGGTCTTTGCTTCTGTTT Mash1 R: TGGGGATGGCAGTTGTAAGA Gfap F: AAAACCGCATCACCATTCCT Gfap R: ACGTCCTTGTGCTCCTGCTT Dcx F: GGCCAAGAGTTTCTGCCAAG Dcx R: TAATGCAGGGATCAGGGACA Nest F: ATGGGAGGATGGAGAATGGA Nest R: GTGCCAGAGGGGCAGTTTCT Chx10 F: AAGGAGCCATGTTGGACTGAA Chx10 R: GCCTGGGAATACAGGAGCAG Sox2 F: CTAGACTCCGGGCGATGAAA Sox2 R: TGCCTTAAACAAGACCACGAAA Otx2 F: GGTCCATCAACCAGCAACCT Otx2 R: ACACCGGATCACCTCTGCTT Pax 6 F: GAGAAATGGCGGTTAGAAGCA Pax 6 R: CAACCACATGAGCAACACAGA Mitf F: GATGGACGATGCCCTCTCAC Mitf R: CTGGGCTACTGATAAAGCACGAA mGluR6 F: CCGTGAATTGTCTTGTTGCTG mGluR6 R: CCACCTTTCATGTTGGTGCT Cnga1 F: TTGGGAGAAAGAGTCGTCTGG Cnga1 R: GAACATCGGTGGGGAAGAAA Crx F: CTCCAGACACACCAGGAAAGG Crx R: GTGGGAGTGCAACAGGGTTT Nrl F: CAGCAGTTGATTGTTTGCCTAATC Nrl R: TGAGACCTGGAGGACAGCTACA Recov F: CAGAAAAGCGGGCTGAGAAG Recov R: TTACCCAGCAATCCCCAAAG Rho F: TGTGGGGACAAACAGTCCAG Rho R: GGCTCCATCCCATTCTTTTG Q-PCR HPLC purified primers Qactin F: CCACCATGTACCCAGGCATT Qactin R: ACAGTGAGGCCAGGATGGAG QNrl F: ATGCAAGTGGATTGGAGGAG QNrl R: CATGGCAACTGTGAGACCTG QCrx F: TCTTCCGTAAAGGTGCTGAGA QCrx R: TGCTGGGATTATGACCATTGA QRho F: CTGAGGGCATGCAATGTTCA QRho R: CATAGCAGAAGAAGATGACG F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e144 YEXER5575_proof ■ 21 July 2010 ■ 4/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500
  5. 5. months later occurs as a result of the fact that rhodopsin is increasingly expressed in rod photoreceptors as rod cells mature. We have found that some cells that were Rho-eGFP negative at the point of FACS analysis at PN3e5 go on to express rhodopsin later (and therefore also the Rho-eGFP fusion protein). These can then be visualized when counting. Indeed, the purpose of this experiment was to determine whether the Rho-eGFP-positive cells that end up with photoreceptor morphology post-transplantation were pre- specified as rods (and therefore Rho-eGFPþve) at PN3e5 or whether the rod specification came later, after transplantation of cells that were Rho-eGFP negative at the point of FACS sorting, but became Rho-eGFP positive after transplantation. Our findings indicate the former to be the case, but not exclusively so; some Rho- eGFP-positive photoreceptor morphology is obtained after trans- plantation of cells that are Rho-eGFP negative at PN3e5. At both PN3 and PN5, Rho-eGFP positive, sorted cells integrated at a higher frequency than Rho-eGFP-negative sorted cells and this difference was more significant in PN5 cells than PN3. t-Tests gave values of p ¼ 0.165 for PN3, p ¼ 0.050 for PN5, and p ¼ 0.014 for both data sets combined (Fig. 1). Integration rates are lower than the 0.6% value reported previously (MacLaren et al., 2006; Bartsch et al., 2008), probably as a result of negative impacts on cell survival of harsh enzymatic digestion followed by FACS analysis, or the longer period of time elapsed between injection and sacrifice. We conclude that rhodopsin expression is a marker of the ability of primary retinal cells to form photoreceptors post-transplantation. 3.2. Transplantation of cultured RPCs In contrast, transplantation of cultured RPCs resulted in lower percentages of integrated cells and no photoreceptor morphology. Multiple injections of proliferating and differentiated RPCs, passages 1e3, derived from PN2e5 eGFP transgenic mice, were transplanted into 2e6 month old C57Bl/6J recipients. We used lower passage cells as there is evidence that karyotypic instability can occur in neonatal RPCs after passage 9 (Djojosubroto et al., 2009). Transplanted RPCs survived in the retina at a rate of 0.022%, while integrated cells were only 0.005% of cells transplanted initially. None gave photoreceptor morphology (Fig. 1). This contrasts with approximately 0.2% cells with photoreceptor morphology for freshly dissociated retinal cells (see Fig. 1A, B). No consistent differences in survival or integration rates between proliferating and differentiated RPCs were noted; both were uniformly low. Integration occurs primarily in the inner plexi- form and ganglion cell layers; a majority of integrated cells are GFAP positive (Fig. 1CeE). 3.3. Optimisation of cell culture conditions Previous protocols resulted in high cell death rates in the first few days following initial plating of dissociated cells. In order to obtain confluent cells from RPCs within 3e4 weeks, plating densities of 1e2 Â 105 cells/cm2 had been used (2.5e5 million cells per T25). Existing protocols recommend the digestion of retinas for 10e20 min in trypsin, collagenase, hyaluronidase, kynerunic acid or combinations thereof (Klassen et al., 2004; Canola et al., 2007). This results in a single cell suspension, however, the effect on the cells may be excessively harsh, given the levels of cell death. Previously we had incubated retinas with trypsin for 20 min at 37 C, with addition of DNase1 after 5 min and trypsin inhibitor after 20 min. Samples were triturated using a p1000 pipette, spun and resuspended in growth medium. This protocol yields a single cell suspension and requires plating of a minimum 1 Â105 cells/cm2 . Growth to 80e90% confluence takes a month, and at minimum cell density, a majority of cultures do not survive. We then tried 10Â dilutions of Accutase and tissue culture formulated trypsin/EDTA to digest the retinas for 5e10 min, followed by dissociation with a fire polished and narrowed borosilicate glass pipette. Some samples were dissociated mechanically without any enzymatic digestion. Comparison of the numbers of resulting cells gained by these methods gave a p value of 0.027, which underesti- mates the significance of this result; of 12 cultures plated using the old method, only 4 survived to be included in data processing. All cultures plated using minimal digestion or mechanical dissociation alone survived (Fig. 2A). Furthermore, with optimized tissue culture conditions (see below), plating densities of 100,000 cells per T25 (4 Â103 cells/cm2 ) will reliably give rise to cultures within 10e20 days (Fig. 2B). Growth times from initial plating to 80e90% conflu- ence varied between 19.3 days for 100,000 cells to 10.75 days for 1.5 million cells per T25. Differences in the rate of cell division caused by initial cell density are not statistically significant. We also tested the growth rates of RPCs derived from different mouse strains (Fig. 2C), in order to verify that the cells being trans- planted (eGFP, Rho-eGFP) did not behave differently from wild-type cells. We tested rhodopsin knockout derived PN3e4 cells (RhoÀ/À, Humphries et al., 1997), to determine whether lower percentages of photoreceptor precursors would influence growth rates; photore- ceptors in these mice start to degenerate from birth. Differences in the rate of cell division (increase in cell #/day) caused by strain difference, genetic modification or the presence of eGFP are not statistically significant. Notably, RPC growth is not influenced by the absence of functional rhodopsin expression, since rhodopsin knockout cells grew at indistinguishable rates from wild type. 3.4. Cell culture media and supplements Initial protocols used DMEM/F12 medium with 1% pen- icillinestreptomycin and L-glutamine, supplemented with N2, FGF2, EGF and heparin. We decided to test the effect of replacing N2 supplement with B27 supplement, or B27 minus Vitamin A (also known as retinoic acid, RA). RA is a potent morphogen and is used to effect neural differentiation in ES cells (Bain et al., 1995). Derivatives of RA (all-trans-retinol and 11-cis-retinal) are vital components in the visual transduction cycle. We reasoned that B27 À RA might better support proliferation of stem cells and prevent differentiation, allowing better growth in culture. We also tested the addition of fetal calf serum (FCS), which is known to bias neural stem cells towards a glial cell fate, but which often promotes cell survival. Finally, DMEM/F12 was replaced variously with neurobasal medium, post- natal neural stem cell medium or embryonic neural stem cell medium (Sigma). In each case, media were supplemented with N2 or B27, with EGF, FGF2 and heparin as usual (Fig. 2D). Postnatal and embryonic stem cell media did not support the growth of RPCs. Neurobasal medium permitted growth, but at a slower rate thanwith DMEM/F12. In terms of increased survival and growth, DMEM/F12 with B27 À RA were by far the best combination (N2 vs B27 À RA; p ¼ 0.0062). Predictably, B27 þ RA slowed growth in comparison to N2 supplemented media and increased the likeli- hood of spontaneous differentiation. Addition of FCS caused a rapid morphological transition such that flat fibroblast type cells were observed after a number of days; subsequent passages resulted in a decrease in cell number. We also tested various combinations of N2B27, N2B27 À RA, and N2B27 where BSA had been omitted from the N2 supplement. None were superior to B27 À RA alone. 3.5. Cell attachment We tested the influence of cell attachment on growth. Neural stem cells can be grown as neurospheres, which contain mixtures of differentiated and undifferentiated cells. However, RPCs show F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e14 5 YEXER5575_proof ■ 21 July 2010 ■ 5/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630
  6. 6. a strong preference for attachment to tissue culture flasks and even tend to attach to bacterial Petri-dishes. Concern was expressed that attached cells may be biased towards a glial lineage and growth as a monolayer may preclude the culture of photoreceptor precursors. We therefore tried to establish “retinospheres” in culture in ultra-low attachment plates (Corning). To encourage initial sphere formation, we used mechanical dissociation alone to disrupt the cells and left them in larger clumps than is typical. While the cells could be grown as spheres using these methods, cell numbers declined over time, indicating that cell renewal is not adequately supported under these Fig. 1. Transplantation. (A) Cell integration and survival rates, 3 months post-transplantation (FACS sorted Rho-eGFP derived photoreceptors, columns 1e6 and cultured eGFP RPCs, column 7). Cells counted 3 months post-transplantation. Rho-eGFP cells that were eGFP positive at the point of FACS analysis (PN3e5, columns 4e6), show a higher integration rate than Rho-eGFP cells that were eGFP negative at the point of FACS analysis (columns 1e3). Counts were obtained from transplantation of Rho-eGFP cells that were eGFP negative at the point of FACS sorting, but began to express rhodopsin, and therefore the eGFP fusion protein, subsequently. The number of integrated cells is expressed as a percentage of those injected. For comparison, an integration rate is also given for transplanted cultured RPCs, but in the case of RPCs, none integrated as photoreceptors (Column 7, grey). (B) Primary eGFP mouse retinal cells transplanted into adult C57Bl6/J wild-type mouse retina. (CeE) Integrated cells derived from RPCs. C and D were photographed at the same magnification as B. E (higher magnification) shows integrated cells counterstained with GFAP after counting. (FeI) FACS sorting of C57Bl6/J and Rho-eGFP cells, days 1 and 4. Note shift in Rho- eGFP expression at day 4 in comparison to day 1, denoting upregulation of rhodopsin (and therefore eGFP) expression. F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e146 YEXER5575_proof ■ 21 July 2010 ■ 6/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760
  7. 7. Effects of Substrate on RPC Proliferation U nc tao ed, -72B A Rn U c tao e 2 N,d NF LLP L DP P N R O G EL L MA VN LL O C MAL+ NF F L DP+ N NF+LL O C AL M LLP+ L LE G+ MA 0.0×10-00 2.5×1005 5.0×1005 7.5×1005 1.0×1006 1.3×1006 1.5×1006 mean p0 mean p1 mean p2 lleCniesaercnI yaDreprebmuN Effects of Mouse Strain on RPC Proliferation c57 eGFP rho-eGFP Rho -/- 0.0×10-00 2.0×1005 4.0×1005 6.0×1005 8.0×1005 1.0×1006 1.2×1006 Passage 0 Passage 1 Passage 2 Mouse Strain of Origin lleCniesaercnI yaDreprebmuN Effect of Initial Cell Seeding Density on RPC Proliferation 0 1 2 0.0×10 2.0×10 4.0×10 6.0×10 8.0×10 1.0×10 1.2×10 1.4×10 1.6×10 1 x 105 2.5 x 105 0.5 x 106 1 x 106 1.5 x 106 Passage Number yaDreprebmuNlleCniesaercnI Effects of Dissociation Method on RPC Proliferation O ld ohte M d yrT sp in/E T D A Ac esatuc M e cinahc al taicossi D ion -50000 0 50000 100000 150000 lleCniesaercnI yaDreprebmuN A CB Effects of Medium Composition on RPC Proliferation R+72B A A R-72B 2 N A R+72B2 N N 2 2B 7 A R-N 2B2 7 R- ASB-A 2B,B N 7 A R-B 72 R- A + %1 FC S B A R-72 + S CF %5 N 2 + %1 S CF N 5 +2 % FC S 0.0×10-00 1.0×1005 2.0×1005 3.0×1005 4.0×1005 5.0×1005 6.0×1005 7.0×1005 mean p0 mean p1 mean p2 IesaercninCell yaDreprebmuN D E Fig. 2. Effects of protocol improvements and mouse strain of origin on survival and growth rates of proliferating RPCs. (A) Effects of dissociation method on RPC growth rate. 4 Â 104 cells/cm2 were plated per T25 flask, cells were grown to 80e90% confluence. The increase in cell number per day was calculated as follows: (final cell # À initial cell #)/# days between plating and passaging. (B) Influence of initial cell plating density on RPC growth. Cells were grown using optimized culture conditions and plated on FN-coated flasks. Growth times from initial plating to 80e90% confluence were calculated as in A above. (C) Influence of mouse strain on RPC growth. RPCs were derived from wild type (C57Bl6/J), eGFP transgenic mice (for routine transplantation of RPCs), Rho-eGFP knock-in mice (FACS and transplantation) and rhodopsin knockout mice (rhoÀ/À) There are no statistically significant differences between wild-type derived RPCs and those from any of the other strains. This means that they can legitimately be used interchangeably (t-tests; C57 vs eGFP,p0, p ¼ 0.39, C57 vs Rho-eGFP, p0, p ¼ 0.20, C57 vs RhoÀ/À, p0, p ¼ 0.11). (D) Effects of different combinations of media and growth supplements on increase in cell number per day. p ¼ passage number; effects for p0, p1 and p2 cells are given. Cells were harvested and counted once 80e90% confluence was achieved; in the case of p0, this typically took 10e20 days from initial plating. Intervals from plating to confluence were typically 3e7 days in subsequent passages. Growth medium ¼ DMEM/F12 (Sigma), unless otherwise stated. NB ¼ neurobasal medium. FCS ¼ fetal calf serum, N2, B27 and B27 À RA are media supplements. N2B27 ¼ N2 þ B27 supplement. N2B27 À RA ¼ N2 þ B27 À RA. N2B27 À RA À BSA ¼ N2 without BSA and B27 À RA. All samples were grown in the presence of FGF2, EGF and heparin. Note maintenance of higher growth rate with B27 À RA beyond p0. (E) Influence of cell substrate on RPC growth. Untreated ¼ Sarstedt T25 flasks with no further coatings applied. N2 ¼ untreated flasks where RPCs were grown with N2 (all other samples in this graph were grown supplemented with B27 À RA). Fn ¼ fibronectin, pll ¼ poly-L-lysine, pdl ¼ poly-D-lysine, porn ¼ poly-L-ornithine, gel ¼ gelatin, lam ¼ laminin, Vn ¼ vitronectin, coll ¼ collagen. F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e14 7 YEXER5575_proof ■ 21 July 2010 ■ 7/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890
  8. 8. conditions. Growth of retinospheres was tested with a number of different media and supplements. No combination gave rise to robust proliferation; plating of single cell suspensions resulted in cell death. We tested the influence of substrate on monolayer growth. Cells were grown in optimized RPC growth medium, in uncoated T25 flasks and in those coated with one of the following; poly-L-lysine (PLL), poly-D-lysine (PDL), poly-L-ornithine (PORN), gelatin (GEL), laminin (LAM), fibronectin (FN), vitronectin (VN) and collagen (COLL) (Fig. 2E). Fibronectin provided the best growth advantage at p0 (B27 À RA vs fn þ B27 À RA; p ¼ 0.001; N2 vs fn þ B27 À RA; p ¼ 0.0009), but this was only significant between initial plating and passage 0 (p0). Fibronectin solutions could only be reused a maximum of 3 times, before efficacy diminished. 3.6. Real-time Q-PCR, immunohistochemistry, and use of Rho-eGFP transgenic cells to track rhodopsin expression Using improved growth conditions, we used real-time Q-PCR to compare rhodopsin levels in cells grown under conditions outlined above, with those grown using older methods. All conditions were tested; a selection of results is shown in Fig. 3. Rhodopsin levels dropped dramatically when comparing fresh retinal tissue with passage 0 confluent plates (which had undergone 10e20 days growth post-isolation to reach confluence); furthermore, rhodopsin levels dropped again in subsequent passages, often to undetectable levels. This drop was so dramatic that we had to analyse results using the DDCt method; standard curves did not encompass the wide range of rhodopsin levels detected. This drop was noted in “retinosphere” cultures (results not shown), prolif- erating adherent RPCs, and cells differentiated in vitro. Notably, the presence of retinoic acid in B27 supplement (B27 þ RA, Fig. 3A) did not stimulate rhodopsin expression, despite prior evidence that RA can do this in both dissociated retinal cells, retinal explants cultured without the RPE, and differentiating mouse ES cell cultures (Soederpalm et al., 2000; Osakada et al., 2008). We then studied rhodopsin levels in the days immediately after placing the cells in culture. Dramatic reductions in rhodopsin expression levels were detected shortly after initial plating. We plated cells at a density of 2e6 Â 104 cells/cm2 on fibronectin-coated T25 flasks. We harvested the cells on days 1e3, 4e6, 6e9, 9e12, and 12-confluence. Cells were counted, their RNA extracted and rhodopsin levels determined by real-time Q-PCR. We also plated transgenic Rho-eGFP cells on poly-L-lysine and fibronectin-coated glass slips and tracked the reduction in rhodopsin levels via Rho-eGFP fluorescence (Fig. 4) and separately, via immunohistochemistry, at the intervals stated above. Cell counts indicated an initial dramatic drop in the number of eGFP-positive cells, followed by the slow growth of eGFP-negative cells to confluence from day 3 to day 10e20. Q-PCR, counting of Rho-eGFP-positive transgenic cells and immu- nohistochemistry all separately indicate that rhodopsin-positive cells are largely lost from the cultures over the first 3 days (Fig. 4). More- over, rhodopsin-positive rod precursors were not necessary for establishment of healthy RPC cultures; RPCs from RhoÀ/À mice had growth rates indistinguishable from wild-type cells (Fig. 2C). 3.7. Gene expression profiles We used RT-PCR and immunocytochemistry to further charac- terize RPCs. Previous studies have suggested some ganglion cell potential post-transplantation (Canola et al., 2007) or suggested that RPCs are radial/Mueller glia. We amplified RNA from PN3e5 retinas and passage 0e2 RPCs derived from C57Bl6/J, Rho-eGFP, EGFP and RhoÀ/À mice (Fig. 5). While differences between whole retinas and RPCs were dramatic, within the RPC samples, passage number, mouse strain of origin, presence/absence of eGFP and the developmental stage of isolation (PN3e5) had no consistent effect (Fig. 5). Genes associated with photoreceptor differentiation (rhodopsin, recoverin, Cnga1, Nrl, Crx, N2re3) were downregulated in RPCs. Similarly, genes associated with ganglion cells (Chd5, Islet1, Atoh7) were also downregulated, with the exception of Thy1. Some genes associated with eye specification (Pax6, Otx, Chx10) and neurotransmission (Th, ChAT) were also downregulated. Notably, Mitf, Gad1 and Gabbr1 remained at similar levels to those seen in retinal samples. Genes associated with neural stem cells (nestin, sox2, mash1) and cell cycle associated genes such as Ki67 and Ccd1 were upregulated in RPCs, particularly in later passages. Gfap, the signature marker of glial cells, was expressed at similar levels in retina and in RPCs. 3.8. Cell morphology and immunocytochemistry RPCs form a characteristic fusiform morphology, indicative of neural progenitors, after approximately 1 week in culture; this is maintained in subsequent passages (Fig. 6A). Despite plating of Effects of Medium Composition on Rhodopsin Expression Levels 72B 0p A R+ 0p A R-72B 0p 2 N FN p0 0p MAL 0p LE G N R OP 0p N B, 72B - p A R 0 72B - 0p S CF %1+ A R 0p S CF %5+ A R-72B 0.000 0.005 0.010 0.015 trwegnahCdloF aniteR4NP Effects of Differentiation on Rho mRNA Levels gnitarefilorP D nereffi t ya D 5( gnitai s )F GE- noitaitnereffi DlaniF 0.00 0.05 0.10 0.15 egnahCdloF aniteR4NPtrw B A Fig. 3. Real-time Q-PCR of rhodopsin levels in selected RPC cultures. (A) Rho mRNA levels in selected proliferating RPC cultures once confluent (p0; 10e20 days post-plating). Fold change is expressed with respect to (wrt) Rho expression levels obtained from PN4 retina (PN4 retina ¼ 1). Selected samples are shown above; Q-PCR readings for all varying growth conditions tested were obtained (see Figs. 2e4), for passage (p) 0e2 in each case. Only p0 is shown here; levels of Rho decline further thereafter in subsequent passages. p0 ¼ initial growth period from plating to conflu- ence, mRNA samples taken at confluence, typically 10e20 days post-plating. B27 and N2 are media supplements, ÀRA or þ RA denotes the presence or absence of retinoic acid in the B27 supplement, FCS ¼ fetal calf serum, NB ¼ neurobasal medium, used instead of the default DMEM/F12 in one case above. Fn ¼ fibronectin, lam ¼ laminin, gel ¼ gelatine, porn ¼ poly-L-ornithine. (B) Comparison of Rho mRNA levels in prolif- erating, differentiating and finally differentiated RPCs, passage 1. No significant differences in Rho levels were noted between proliferating and differentiated cells. Some differences in Rho expression levels were noted between sets of experimental repeats carried out at different times (note difference between B27 À RA and prolif- erating in graphs A and B). Values graphed here are skewed upwards as PCRs showing no rhodopsin expression at all could not be included in calculations. F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e148 YEXER5575_proof ■ 21 July 2010 ■ 8/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020
  9. 9. retinal cells, many of which have already adopted differing cell fates, the uniform morphology would indicate that tissue culture conditions select for a single cell type. Notably, we have been successful in isolating RPCs from ages E14.5 to postnatal day 46 inclusive (results not shown). The morphology of cultured cells does not vary according to the developmental age from which the cells were derived, although RPCs proliferate a lot more slowly initially when isolated after PN6. Cells grow faster between initial plating and first passage if plated on fibronectin, where a slightly flatter morphology is noted (Fig. 6B). Cells can survive as “retino- spheres”, however, cell numbers decline with time, indicative of a failure to proliferate and/or higher rates of cell death (Fig. 6C). Staining of proliferating cells (Fig. 6DeL) showed low staining for b-III-tubulin (6D) and Gfap (6E) and stronger staining with Pax6, nestin and glutamine synthetase (6FeH). RDS/peripherin and rhodopsin antibodies (6I, J) are negative, similarly, Rho-eGFP derived RPCs (6K) are usually eGFP negative, but staining of the occasional cell is sometimes seen in some cultures, correlating with PCR results (Fig. 5). Differentiated RPCs show strong glutamine synthetase staining (6Q) and strong staining of some, but not all, cells for B-TubIII (6M), and Gfap (6N). Addition of 1% serum during final differentiation results in 80e90% Gfap staining (6T). Differentiated RPCs show negligible staining for Rds/peripherin, Rho (6R,S) and synaptophysin (not shown); current differentiation methods do not favour photoreceptor or photoreceptor precursor formation. 4. Discussion FACS analysis and subsequent transplantation indicate that rhodopsin is a good marker for integration potential and generation of morphologically mature photoreceptors post-transplantation. These data also support the conclusion that integrating cells with photoreceptor morphology, derived from fresh retinal material, are post-mitotic; rhodopsin is a tightly regulated gene that is only expressed in maturing rod photoreceptors and has been used as a marker of terminal rod differentiation (Humphries et al., 1997). Some rhodopsin-negative cells do integrate; the likelihood is that these are photoreceptor precursors that have just been specified, are not yet expressing enough rhodopsin to be sorted as positives, but increase expression of the Rho-eGFP reporter transgene after transplantation. FACS also does not give 100% pure separation; negatives are typically 99% pure while positives are only 80e90% positive. Fig. 4. Decreasing Rho mRNA and protein levels in proliferating RPCs after initial dissociation and plating. A) Cell counts taken at daily intervals following initial plating of 1 Â106 cells per T25. There is a dramatic decrease in cell number in the initial 3 days, followed by a gradual increase in cell number as surviving cells attach and divide. B) Real-time rhodopsin Q-PCR of samples taken at daily intervals post-plating of 1 Â106 cells per T25. Rho mRNA levels drop dramatically in the first 2 days. C) Levels of Rho protein levels assessed from counting of DAPI-stained transgenic Rho-eGFP cells that were still expressing eGFP, expressed as a % of the total Dapi-stained cells present at daily intervals post-plating (unbroken line). Cells were also counterstained using antibodies against rhodopsin (Chemicon MAB5356), labelled with Cy3 (short dashed line). Combined results from Rho-eGFP, eGFPþve and rho-immunocytochemistry are also presented (long dashed line). D). Photomicrograph of DAPI-stained Rho-eGFP cells, 1 day post-plating, E ¼ DAPI-stained Rho-eGFP cells, 7 days post-plating. F ¼ DAPI-stained Rho-eGFP cells, 10 days post-plating, G ¼ DAPI-stained Rho-eGFP cells, 15 days post-plating (80e90% confluent). Note green eGFP-positive cells in the middle of the Rho-eGFP cell clumps 24 h after plating (D), which disappear by 7 days and do not re-appear subsequently (EeG). F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e14 9 YEXER5575_proof ■ 21 July 2010 ■ 9/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150
  10. 10. F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e1410 YEXER5575_proof ■ 21 July 2010 ■ 10/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280
  11. 11. Expansion of RPCs in culture eliminates photoreceptor morphology after transplantation. This could occur for a number of reasons hypothetically: the photoreceptor precursors might undergo cell death, the post-mitotic nature of the cells might mean that they are “diluted out” of the cultures as other cells divide, or their cell fate might be altered by the tissue culture environment. We succeeded in improving survival and/or growth rate of RPCs in culture 25-fold, however, photoreceptor precursors are still lost shortly after plating. Using cell counts, real-time Q-PCR, semi-quantitative PCR, immu- nohistochemistry and tracking of reporter expressing Rho-eGFP transgenic cells in the days after plating, we note that sharp reduc- tions in cell numbers within the first 3 days post-plating coincide with loss of rhodopsin expression, while culture conditions that promote slower RPC growth do not contain higher proportions of rhodopsin-positive cells. We conclude therefore that the mechanism for the loss of photoreceptor precursors from cell culture is cell death in the first 3 days after introduction of the cells to tissue culture, not transdifferentiation or dilution. As previously hypothesized (MacLaren et al., 2006; West et al., 2009), photoreceptor precursors are post-mitotic, cannot adapt to tissue culture conditions and are dying shortly after plating. This conclusion is supported by separate culturing of FACS sorted Rho- eGFP positive and negative cells (results not shown). Negative cells (99% pure) establish more easily in culture than positives (80e90% pure). However, once cultures are established, morphology of positive and negative cultures is identical, and rhodopsin levels are low to non-existent, as is typical for RPCs derived from unsorted cells. Notably, less severe dissociation conditions do not improve rhodopsin levels at p0, suggesting that the problem is not merely one of fragility. There is an interesting shift in cell behaviour between initial plating and establishment of the cells as prolifer- ating RPCs. Plating the cells as small clumps initially (small enough to be counted, but not a single cell suspension), is the biggest contributor to the increased survival rates noted in this study. These cells grow rapidly if plated at a reasonably low density (4 Â103 cells/cm2 ). We have also found that, where cells were plated at too high a density initially, passage before day 10 results in an increased risk of cell death. However, after confluence is ach- ieved (10e20 days), use of 0.25% trypsin or 1Â Accutase for 5 min and trituration with a 5 or 10 ml pipette will reliably generate a single cell suspension that can be replated at 4 Â103 cells/cm2 or more without significant trauma to the cells. A process of adapta- tion to tissue culture conditions is obviously causing large changes in cellecell and cellesubstrate attachment behaviour. Previous analyses considered the possibility that RPCs could have ganglion cell potential and/or represent immature radial/ Mueller glia (Angénieux et al., 2006; Canola et al., 2007). RPCs migrated to the ganglion cell layer and expressed ganglion cell markers when transplanted into models of RD (Canola et al., 2007). However, ganglion cells are amongst the first to have their cell fate determined, they are “born” during embryogenesis, while rods and Mueller glia are locked into their respective cell fates during the first few days after birth (Andreazzoli, 2009; MacLaren et al., 2006). Mueller glia can regenerate the injured retina in fish, amphibians and even to some extent in chick. They have a limited potential, even in mammals, to give rise to cells with some of the character- istics of retinal neurons (Andreazzoli, 2009; Karl et al., 2008). Furthermore, glial cells have the capacity in RD to proliferate, possibly in an attempt to ameliorate some of the pathogenic effects, resulting in gliosis (West et al., 2009). Our transplantation results also show RPC integration primarily in the inner plexiform and ganglion cell layers (Fig. 1CeE), correlating with previous results. A majority of cells are GFAP positive. Results of RT-PCR and immunohistochemistry on a panel of genes indicate that products of terminally differentiated retinal cells, whether they are ganglion cells, other retinal neurons or photoreceptors, are largely downregulated, as would be expected in progenitor cells. GFAP, a glial marker, maintains expression levels in culture similar to those seen in PN3e5 retina, but is not upre- gulated. Interestingly, markers of neural stem cells/progenitors such as nestin, Sox2 and Mash1 are upregulated slightly, along with cell cycle markers such as Ccd1 and Ki67. While we cannot rule out glial identity, it is also possible that RPCs represent a pool of retinal progenitors, which are capable of establishing themselves in culture. It may be the case that building a retina occurs from a pool of unspecified stem cells, according to positioning within the retina and mechanical cues provided by the intercellular matrix and cellecell junctions (Andreazzoli, 2009). Removing cells from this structure may allow the division and establishment in culture of only those that are not yet specified. Without the correct mechanical stimuli or positional cues, it may be difficult to specify the desired cell fate in these cells. However, they may yet be shown to be capable of generating the desired retinal cell types, given correct mechanical cues or as yet unidentified signals. Interestingly, the more robust cell growth achieved by protocol changes described in this paper may assist in resolving some of the differing results obtained with RPCs to date. We have noted that sub-optimally isolated RPCs go through a slow growing initial stage in which it is obvious morphologically that some differentiation has occurred. Optimization of the culture conditions ensures that this no longer occurs, allowing, possibly, more consistent gene expression results to be obtained from different isolates of RPCs. This may in turn resolve the question of whether differences in potential between embryonic and postnatally iso- lated RPCs actually exist (Yang, 2004). RPCs are certainly capable of generating abundant glial cells if allowed to differentiate via sequential withdrawal of growth factors and application of 1% FCS in B27 þ RA containing media. This does not by itself indicate that these cells are solely glial precursors though, just that we can positively influence glial differentiation. Even after treatment with FCS, some beta-III-tubulin positive, GFAP negative cells remain (Fig. 6T). Some migration of RPCs to the ganglion cell layer after transplantation may perhaps indicate a degree of neuronal multipotentiality (Canola et al., 2007, Fig.1D, E). Investigation of these cells in treatment of retinal disorders such as LHON or glaucoma, where the defect does not reside within the photoreceptor cell layer, might be warranted. Better differentiation protocols with improved cell survival and further characterization of resulting cell populations, in vitro and post-transplantation, would be helpful in investigating the true potential of RPCs. RPCs can be cultured from late embryonic stages until approxi- mately PN6, before they become more difficult (but not impossible) to grow. These cells probably represent an undifferentiated cell pool from which, in vivo, unknown mechanical, hormonal or positional cues are used to sequentially differentiate the diverse cell types found in adult retina. Notably, cells acquire a uniform morphology during Fig. 5. Semi-quantitative PCR analysis of gene expression profiles from freshly dissociated PN3e5 retina (left hand column) and cultured proliferating RPCs originally derived from PN3 C57Bl6/J mouse retinas at passages 0, 1 and 2 (p0, p1 and p2, middle right hand column). p0 ¼ approx 10e20 days post-isolation, p1 ¼3e7 days after p0, p2 ¼ 3e7 days after p1 respectively. Three housekeeping genes are shown, giving equal levels of expression in all samples. However, in order to check that levels of these housekeeping genes were indeed roughly equal, they were also amplified by Q-PCR from the same samples; variation was indeed minimal (see Materials and methods). All amplifications were carried out using an annealing temperature of 62 C, cycle numbers are indicated beside the gene name. F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e14 11 YEXER5575_proof ■ 21 July 2010 ■ 11/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410
  12. 12. the initial period of growth post-plating; this morphology does not change with subsequent passages, suggesting expansion of a uniform stem cell type. Photoreceptor precursor cells are a post-mitotic cell populationwithin the neonatal retina which are capable of becoming mature photoreceptors post-transplantation. These cells die off rapidly when placed in a tissue culture environment. This is prob- lematic, as therapeutic strategies for RD may need to focus on expansion of undifferentiated progenitors (currently possible) and then application of unidentified triggers in order to obtain photore- ceptor precursors. Differentiation of RPCs in vitro does not currently result in significant increases in rhodopsin levels, but does give rise to high levels of cell death (which may indicate death of cells choosing a photoreceptor fate at the point of differentiation). In support of this point, attempts by this group to transfect various cell lines with rhodopsin in the past has not met with success; cells expressing the transgene tend to die (S. M-W, unpublished results). Unless occurring in a very structured environment, rhodopsin expression may well be very toxic to the cell. We therefore need to identify the triggers that promote terminal differentiation of rod and cone photoreceptor cells in vivo. We may then be able to adapt tissue culture protocols such that these new triggers can be applied in vitro and the resulting cells can be persuaded to survive for as long as it takes to inject them into a recipient. Identification of the key points in retinal development will require detailed analysis of the transcriptome and epigenetic structure of differentiating retinal cells in vivo, in conjunction with further use of transgenics such as Crx-, Nrl- or Rho-eGFP mice, where cells can be sorted prior to transplantation, microarray analysis or proteomics. Development of robust methods for photoreceptor specification in vitro are likely to be useful in improving methods for ES and iPS cell differentiation as well as RPCs. Uncited references Meshorer et al., 2006; Qiu et al., 2004. Acknowledgements This work was funded by Fighting Blindness Ireland (in collab- oration with the Fighting Blindness Vision Research Institute), Fig. 6. Live RPCs (AeC), antibody stained proliferating RPCs (DeL) and stained differentiated RPCs (MeU). Live cells: RPCs grown on tissue culture coated T25s alone (A), T25s coated with fibronectin (B), and spheres grown on low adherence plates are shown (C). Cells acquire char- acteristic (and uniform) morphology after 10e14 days in culture. This does not change during subsequent passaging. Immunocytochemistry: proliferating cells (red font: DeL) shown were plated after 2e3 passages and stained after 3e4 days of growth on glass slips. Differentiated cells were plated in growth medium for 2 days, then differentiated for 10 days via sequential withdrawal of growth factors, before staining (see Materials and methods) (blue font, MeU). DeL: proliferating RPCs; beta-III-tubulin (D), GFAP (E), nestin (F), Pax6 (G), glutamine synthetase (H), rhodopsin (I), RDS/peripherin (J), Rho-eGFP cells showing rare eGFPþve cells (K), PBS control (L). MeU: beta-III-tubulin (M), GFAP (N), nestin (O), Pax6 (P), glutamine synthetase (Q), rhodopsin (R), RDS/peripherin (S), cells differentiated in the presence of 1% FCS, showing GFAP (red) and beta-III-tubulin (green) staining (T), PBS control (U). Rho-eGFP cells usually show no eGFP-positive cells, but very occasionally 1e2% are seen, correlating with real-time Q-PCR results, which show low to non-existent Rho levels (K). The majority of proliferating RPCs are nestin/Pax6 positive and following differentiation with 1% FCS are Gfap or b-III-tubulin positive. Differentiation without serum gives rise to lower percentages of glia (N). Nuclei are counterstained with DAPI. F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e1412 YEXER5575_proof ■ 21 July 2010 ■ 12/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540
  13. 13. Health Research Board Ireland (HRB), Science Foundation Ireland (SFI) and the Deutsche Forschungsgemeinschaft (DFG). We would like to thank Dr. Alfonso Blanco of the Conway Institute, UCD, for assistance with FACS sorting, Chris Egan for use of CHD5 primers and Drs Matt Campbell and Michael Wride for constructive comments with regard to this manuscript. Appendix A. Supplementary data Supplementary data associated with this article can be found in the online version, at doi:10.1016/j.exer.2010.07.003. References Andreazzoli, M., 2009. Molecular regulation of vertebrate retina cell fate. Birth Defects Res. 87, 284e295. Angénieux, B., Schorderet, D.F., Arsenijevic, Y., 2006. Epidermal growth factor is a neuronal differentiation factor for retinal stem cells in vitro. Stem Cells 24 (3), 696e706. Aoki, H., Hara, A., Niwa, M., Motohashi, T., Suzuki, T., Kunisada, T., 2008. Trans- plantation of cells from eye-like structures differentiated from ES cells in vitro and in vivo regeneration of retinal ganglion-like cells. Graefes Arch. Clin. Exp. Ophthalmol. 246 (2), 255e265. Bain, G., Kitchens, D., Yao, M., Huettner, J.E., Gottlieb, D.I., 1995. Embryonic stem cells express neuronal properties in vitro. Dev. Biol. 168 (2), 342e357. Bainbridge, J.W., Smith, A.J., Barker, S.S., Robbie, S., Henderson, R., Balaggan, K., Viswanathan, A., Holder, G.E., Stockman, A., Tyler, N., Petersen-Jones, S., Bhattacharya, S.S., Thrasher, A.J., Fitzke, F.W., Carter, B.J., Rubin, G.S., Morre, A.T., Ali, R.R., 2008. Effect of gene therapy on visual function in Leber’s congenital amaurosis. N. Engl. J. Med. 358 (21), 2231e2239. Bartsch, U., Oriyakhel, W., Kenna, P.F., Linke, S., Richard, G., Petrowitz, B., Humphries, P., Farrar, G.J., Ader, M., 2008. Retinal cells integrate into the outer nuclear layer and differentiate into mature photoreceptors after subretinal transplantation into adult mice. Exp. Eye Res. 86 (4), 691e700. Canola, K., Angénieux, B., Tekaya, M., Quiambao, A., Naash, M.I., Munier, F.L., Schorderet, D.F., Arsenijevic, Y., 2007. Retinal stem cells transplanted into models of late stages of retinitis pigmentosa preferentially adopt a glial or a retinal ganglion cell fate. Invest. Ophthalmol. Vis. Sci. 48 (1), 446e454. Chacko, D.M., Rogers, J.A., Turner, J.E., Ahmad, I., 2000. Survival and differentiation of cultured retinal progenitors transplanted in the subretinal space of the rat. Biochem. Biophys. Res. Commun. 268, 842e846. Chadderton, N., Millington-Ward, S., Palfi, A., O’Reilly, M., Tuohy, G., Humphries, M.M., Li, T., Humphries, P., Kenna, P.F., Farrar, G.J., 2009. Improved retinal function in a mouse model of dominant retinitis pigmentosa following AAV-delivered gene therapy. Mol. Ther. 17 (4), 593e599. Chan, F., Bradley, A., Wensel, T.G., Wilson, J.H., 2004. Knock-in human rhodopsin- EGFP fusions as mouse models for human disease and targets for gene therapy. Proc. Natl. Acad. Sci. U.S.A. 101 (24), 9109e9114. Cicero, S.A., Johnson, D., Reyntjens, S., Frase, S., Connell, S., Chow, L.M., Baker, S.J., Sorrentino, B.P., Dyer, M.A., et al., 2009. Cells previously identified as retinal stem cells are pigmented ciliary epithelial cells. Proc. Natl. Acad. Sci. U.S.A. 106 (16), 6685e6690. Cideciyan, A.V., Aleman, T.S., Boye, S.L., Schwatrz, S.B., Kaushal, S., Roman, A.J., Pang, J.J., Sumaroka, A., Windsor, E.A., Wilson, J.M., Flotte, T.R., Fishman, G.A., Heon, E., Stone, E.M., Byrne, B.J., Jacobson, S.G., Hauswirth, W.W., 2008. Human gene therapy for RPE65 isomerase deficiency activates the retinoid cycle of vision but with slow rod kinetics. Proc. Natl. Acad. Sci. U.S.A. 105 (39), 15112e15117. Coles, B.L., Angénieux, B., Inoue, T., Del Rio-Tsonis, K., Spence, J.R., McInnes, R.R., Arsenijevic, Y., van der Kooy, D., 2004. Facile isolation and the characterization of human retinal stem cells. Proc. Natl. Acad. Sci. U.S.A. 101 (44), 15772e15777. Das, A.V., James, J., Rahnenführer, J., Thoreson, W.B., Bhattacharya, S., Zhao, X., Ahmad, I., 2005. Retinal properties and potential of the adult mammalian ciliary epithelium stem cells. Vision Res. 45 (13), 1653e1666. Djojosubroto, M., Bollotte, F., Wirapati, P., Radtke, F., Stamencovic, I., Arsenijevic, Y., 2009. Chromosomal number aberrations and transformation in adult mouse retinal stem cells in vitro. Invest. Ophthalmol. Vis. Sci. 50 (12), 5975e5987. Gualdoni, S., Baron, M., Lakowski, J., Decembrini, S., Smith, A.J., Pearson, R.A., Ali, R.R., Sowden, J.C., 2010. Adult ciliary epithelial cells, previously identified as retinal stem cells with potential for retinal repair, fail to differentiate into new rod photoreceptors. Stem Cells 28 (6), 1048e1059. Hirami, Y., Osakada, F., Takahashi, K., Okita, K., Yamanaka, S., Ikeda, H., Yoshimura, N., Takahashi, M., 2009. Generation of retinal cells from mouse and human induced pluripotent stem cells. Neurosci. Lett. 458 (3), 126e131. Humphries, M.M., Rancourt, D., Farrar, G.J., Kenna, P., Hazel, M., Bush, R.A., Sieving, P.A., Sheils, D.M., McNally, N., Creighton, P., Erven, A., Boros, A., Gulya, K., Capecchi, M.R., Humphries, P., 1997. Retinopathy induced in mice by targeted disruption of the rhodopsin gene. Nat. Genet. 15 (2), 216e219. Ikeda, H., Osakada, F., Watanabe, K., Mizuseki, K., Haraguchi, T., Miyoshi, H., Kamiya, D., Honda, Y., Sasai, N., Yoshimura, N., Takahashi, M., Sasai, Y., 2005. Generation of Rxþ/Pax6þ neural retinal precursors from embryonic stem cells. Proc. Natl. Acad. Sci. U.S.A. 102 (32), 11331e11336. Jagatha, B., Divya, M.S., Sanalkumar, R., Indulekha, C.L., Vidyanand, S., Divya, T.S., Das, A.V., James, J., 2009. In vitro differentiation of retinal ganglion-like cells from embryonic stem cell derived neural progenitors. Biochem. Biophys. Res. Commun. 380 (2), 230e235. Kelley, M.W., Turner, J.K., Reh, T.A., 1995. Regulation of proliferation and photore- ceptor differentiation in fetal human retinal cell cultures. Invest. Ophthalmol. Vis. Sci. 36 (7), 1280e1289. Kiang, S., Palfi, A., Ader, M., Kenna, P.F., Millington-Ward, S., Clark, G., Kennan, A., O’Reilly, M., Tam, L.C., Aherne, A., McNally, N., Humphries, P., Farrar, G.J., 2005. Toward a gene therapy for dominant disease: validation of an RNA interference based mutation independent approach. Mol. Ther. 12, 555e561. Karl, M.O., Hayes, S., Nelson, B.R., Tan, K., Buckingham, B., Reh, T.A., 2008. Stimu- lation of neural regeneration in the mouse retina. Proc. Natl. Acad. Sci. U.S.A. 105 (49), 19508e19513. Klassen, H.J., Ng, T.F., Kurimoto, Y., Kirov, I., Shatos, M., Coffey, P., Young, M.J., 2004. Multipotent retinal progenitors express developmental markers, differentiate into retinal neurons, and preserve light-mediated behavior. Invest. Ophthalmol. Vis. Sci. 45 (11), 4167e4173. Lamba, D.A., Karl, M.O., Ware, C.B., Reh, T.A., 2006. Efficient generation of retinal progenitor cells from human embryonic stem cells. Proc. Natl. Acad. Sci. U.S.A. 103 (34), 12769e12774. Lamba, D.A., Karl, M.O., Reh, T.A., 2009. Strategies for retinal repair: cell replace- ment and regeneration. Prog. Brain Res. 175, 23e31. Lamba, D.A., McUsic, A., Hirata, R.K., Wang, P.R., Russell, D., Reh, T.A., 2010. Gener- ation, purification and transplantation of photoreceptors derived from human induced pluripotent stem cells. PLoS One 5 (1), e8763. 1e9. Maguire, A.M., Simonelli, F., Pierce, E.A., Pugh Jr., E.N., Mingozzi, F., Bennicelli, J., Banfi, S., Marshall, K.A., Testa, F., Surace, E.M., Rossi, S., Lyubarsky, A., Arruda, V.R., Konkle, B., Stone, E., Sun, J., Jacobs, J., Dell’Osso, L., Hertle, R., Ma, J.X., Redmond, T.M., Zhu, X., Hauck, B., Zelenaya, O., Shindler, K.S., Maguire, M.G., Wright, J.F., Volpe, N.J., McDonnell, J.W., Auricchio, A., High, K.A., Bennett, J., 2008. Safety and efficacy of gene transfer for Leber’s congenital amaurosis. N. Engl. J. Med. 358 (21), 2240e2248. Maguire, A.M., High, K.A., Auricchio, A., Wright, J.F., Pierce, E.A., Testa, F., Mingozzi, F., Bennicelli, J.L., Ying, G.S., Rossi, S., Fulton, A., Marshall, K.A., Banfi, S., Chung, D.C., Morgan, J.I., Hauck, B., Zelenaia, O., Zhu, X., Raffini, L., Coppieters, F., DeBaere, E., Shindler, K.S., Volpe, N.J., Surace, E.M., Acerra, C., Lyubarsky, A., Redmond, T.M., Stone, E., Sun, J., McDonnell, J.W., Leroy, B.P., Simonelli, F., Bennett, J., Lamba, D.A., Retina, L., 2009. Age-dependent effects of RPE65 gene therapy for Leber’s congenital amaurosis: a phase 1 dose-escalation trial. Lancet 374 (9701), 1597e1605 Q6. Mansergh, F.C., Daly, C.S., Hurley, A.L., Wride, M.A., Hunter, S.M., Evans, M.J., 2009. Gene expression profiles during early differentiation of mouse embryonic stem cells. BMC Dev. Biol. 9 (1), 5. MacLaren, R.E., Pearson, R.A., MacNeil, A., Douglas, R.H., Salt, T.E., Akimoto, M., Swaroop, A., Sowden, J.C., Ali, R.R., 2006. Retinal repair by transplantation of photoreceptor precursors. Nature 444 (7116), 203e207. Merhi-Soussi, F., Angénieux, B., Canola, K., Kostic, C., Tekaya, M., Hornfeld, D., Arsenijevic, Y., 2006. High yield of cells committed to the photoreceptor fate from expanded mouse retinal stem cells. Stem Cells 24 (9), 2060e2070. Meshorer, E., Yellajoshula, D., George, E., Scambler, P.J., Brown, D.T., Misteli, T., 2006. Hyperdynamic plasticity of chromatin proteins in pluripotent embryonic stem cells. Dev. Cell 10 (1), 105e116 Q7. Meyer, J.S., Katz, M.L., Maruniak, J.A., Kirk, M.D., 2006. Embryonic stem cell-derived neural progenitors incorporate into degenerating retina and enhance survival of host photoreceptors. Stem Cells 24 (2), 274e283. Meyer, J.S., Shearer, R.L., Capowski, E.E., Wright, L.S., Wallace, K.A., McMillan, E.L., Zhang, S.C., Gamm, D.M., 2009. Modeling early retinal development with human embryonic and induced pluripotent stem cells. Proc. Natl. Acad. Sci. U.S. A. 106 (39), 16698e16703. Okabe, M., Ikawa, M., Kominami, K., Nakanishi, T., Nishimune, Y., 1997. ‘Green mice’ as a source of ubiquitous green cells. FEBS Lett. 407 (3), 313e319. O’Reilly, M., Palfi, A., Chadderton, N., Millington-Ward, S., Ader, M., Cronin, T., Tuohy, T., Auricchio, A., Hildinger, M., Tivnan, A., McNally, N., Humphries, M.M., Kiang, A.S., Humphries, P., Kenna, P.F., Farrar, G.J., 2007. RNA interference- mediated suppression and replacement of human rhodopsin in vivo. Am. J. Hum. Genet. 81, 127e135. Osakada, F., Ikeda, H., Mandai, M., Wataya, T., Watanabe, K., Yoshimura, N., Akaike, A., Sasai, Y., Takahashi, M., 2008. Toward the generation of rod and cone photoreceptors from mouse, monkey and human embryonic stem cells. Nat. Biotechnol. 26 (2), 215e224. Palfi, A., Ader, M., Kiang, A.S., Millington-Ward, S., Clark, G., O’Reilly, M., McMahon, H.P., Kenna, P.F., Humphries, P., Farrar, G.J., 2006. RNAi-based suppression and replacement of RDS-peripherin in retinal organotypic culture. Hum. Mutat. 27, 260e268. Qiu, G., Seiler, M.J., Arai, S., Aramant, R.B., Sadda, S.R., 2004. Alternative culture conditions for isolation and expansion of retinal progenitor cells. Curr. Eye Res. 28 (5), 327e336. Reh, T., 2006. Right timing for retinal repair. Nature 444, 156e157. RetNet. http://www.sph.uth.tmc.edu/Retnet/. F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e14 13 YEXER5575_proof ■ 21 July 2010 ■ 13/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670
  14. 14. Soederpalm, A.K., Fox, D.A., Karlsson, J.-O., van Veen, T., 2000. Retinoic acid produces rod photoreceptor selective apoptosis in developing mammalian retina. Invest. Ophthalmol. Vis. Sci. 41 (3), 937e947. Tropepe, V., Coles, B.L., Chiasson, B.J., Horsford, D.J., Elia, A.J., McInnes, R.R., van der Kooy, D., 2000. Retinal stem cells in the adult mammalian eye. Science 287 (5460), 2032e2036. West, E.L., Pearson, R.A., Tschernutter, M., Sowden, J.C., MacLaren, R.E., Ali, R.R., 2008. Pharmacological disruption of the outer limiting membrane leads to increased retinal integration of transplanted photoreceptor precursors. Exp. Eye Res. 86 (4), 601e611. West, E.L., Pearson, R.A., MacLaren, R.E., Sowden, J.C., Ali, R.R., 2009. Cell trans- plantation strategies for retinal repair. Prog. Brain Res. 175, 3e21. Yang, X.-J., 2004. Roles of cell-extrinsic growth factors in vertebrate eye pattern formation and retinogenesis. Semin. Cell Dev. Biol. 15, 91e103. Zhao, X., Liu, J., Ahmad, I., 2002. Differentiation of embryonic stem cells into retinal neurons. Biochem. Biophys. Res. Commun. 297 (2), 177e184. F.C. Mansergh et al. / Experimental Eye Research xxx (2010) 1e1414 YEXER5575_proof ■ 21 July 2010 ■ 14/14 Please cite this article in press as: Mansergh, F.C., et al., Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival, Exp. Eye. Res. (2010), doi:10.1016/j.exer.2010.07.003 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684

×