Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Cisco Digital Catapult

2,699 views

Published on

Slides from my talk at the NHM London as part of the Cisco Digital Catapult, 25-26 February 2016

Published in: Science
  • Be the first to comment

Cisco Digital Catapult

  1. 1. @rdmpage http://iphylo.blogspot.com
  2. 2. What is digitisation? specimen metadata metadata
  3. 3. DNA barcodes (digital code of life) >COI Memphis moruus 1069855 AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTC ATTAAGTCTTATTATCCGAACTGAACTTGGTAATCCAGGATTTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTA TAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTCGGTAACTG ATTAATTCCATTAATACTTGGAGCCCCCGATATAGCTTTCCCCCGCATA AATAATATAAGATTTTGACTTCTCCCCCCCTCTTTAATTCTCTTAATTTC AAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTAC CCCCCCCTATCATCAAATATTGCTCATGGAGGATCATCAGTTGATTTAG CTATTTTTTCTTTACATTTAGCAGGAATTTCATCAATCTTAGGAGCTAT TAATTTTATCACAACAATTATTAATATACGAGTAAATAATATATCTTATG ATCAAATACCTTTATTTGTTTGATCTGTAGGTATTACTGCCTTACTTCTA TTACTTTCTCTACCAGTTTTAGCTGGAGCTATTACTATATTATTAACTGA CCGAAATTTAAATACTTCATTTTTTGACCCTGCTGGAGGAGGTGATCC TATTCTTTATCAACATTTATTT http://www.dnabarcode.net/20141105/qrpub/inspector/home
  4. 4. BHL page image (more detial in litertaure)
  5. 5. ALL THE THINGS DIGITISE
  6. 6. “Joined-up” digitisation literature, specimens, sequences
  7. 7. Why digitise?
  8. 8. https://www.flickr.com/photos/nhm_beetle_id/15930177695
  9. 9. GBIF.org 500+ million records
  10. 10. http://devpost.com/software/gbif-soundscape @peterneish Ben Raymond
  11. 11. http://devpost.com/software/gbif-data-and-3d-printing Ben Raymond
  12. 12. Intellectual Property: Ownership to ensure it is open Collections CC 0 and CC-BY Literature CC-BY-SA- NC or paywall JSTOR Global plants paywall
  13. 13. Linking
  14. 14. strings things
  15. 15. PMID:948206
  16. 16. http://biostor.org/reference/102054
  17. 17. http://data.gbif.org/occurrences/215921922/
  18. 18. BHL and GBIF as biomedical databases http://iphylo.blogspot.co.uk/2012/03/bhl-and-gbif-as-biomedical-databases.html PubMed (disease) BioStor (publication) GBIF (specimen)
  19. 19. ORCID (person) DOI (publication) LSID (plant name) Find my papers that published new species @SandyKnapp
  20. 20. ORCID (person) DOI (publication) LSID (plant name) #Iamataxonomist
  21. 21. http://events.labs.crossref.org/events/types/WikipediaCitation
  22. 22. Reality check… This exists (sort of) This, not so much
  23. 23. • Digitise all the things • Link all the things • Build knowledge graph

×