Rice hirschmaniella molecular interaction

1,333 views

Published on

Published in: Technology, Business
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,333
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
6
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Rice hirschmaniella molecular interaction

  1. 1. CLONING AND EXPRESSION ANALYSIS OF RICE GENESINVOLVED IN INFECTION WITH HIRSCHMANNIELLA ORYZAE REGMI, HOMAN (S1, ENTOMOLOGY) Promoter Prof. Dr Godelieve Gheysen Faculty of Bio-Science Engineering Gent University, Belgium Supervisors Dr Tina Kyndt and Lander Bauters Faculty of Bio-Science Engineering Gent University, Belgium
  2. 2. INTRODUCTIONRice major staple food of nearly half of the world’s population model monocot plant  Genome size: 430 Mb  around 57 thousands sequenced rice genes available in rice genome database for free
  3. 3. Hirschmaniella oryzae migratory endo-parasite well adapted in deep water (anaerobic condition) irrigated rice covers about 72% of total rice production area the most prevailing nematode in rice world wide
  4. 4. Rice nematode molecular interaction defense response genes believed to be involved in the resistance mechanism very less work done to know about rice and H. oryzae molecular interaction
  5. 5. RICE GENES SELECTED FOR THE STUDYLocus Gene Expression under H. Other information oryzae infection (Kyndt, unpublished)LOC_Os08g09080 Cupin domain Up-regulated upregulated upon blast (Swarbrick et containing protein al.,2008) and Striga infection (Marcel et al., 2010)LOC_Os11g44910 DEAD-box ATP- Down-regulated down-regulated at early phase of rice dependent RNA germination (Huang et al., 2009) helicaseLOC_Os03g08880 purine permease Up-regulated upregulated upon M. oryze infection (Marcel et al., 2010)LOC_Os04g33830 membrane protein Down-regulated down-regualted in resistant Nipponbare under Striga hermonthica infection (Swarbrick et al.,2008)LOC_Os04g50100 RING-H2 finger Down-regulated ATL5G has been suggested to be protein involved in the early steps of the plant defense signaling pathwayLOC_Os02g39360 B-box zinc finger Down-regulated down-regulated under Xanthomonas family protein oryzae pv. oryzicola infection (Zhou et al., 2010)
  6. 6. OBJECTIVES cloning of the rice genes of interest for rice transformation expression analysis of the rice genes under Hirschmaniella oryzae infection by q-PCR
  7. 7. MATERIALS AND METHODCloning RNA extraction from 2 week old rice roots and cDNA synthesized amplification of concerned genes by PCR purified PCR products cloned and sequenced Sequences confirmed by  http://www.ncbi.nlm.nih.gov/VecScreen/VecScreen.h tml  http://rice.plantbiology.msu.edu/index.shtml
  8. 8. MATERIALS AND METHODS…Infection Experiment 80 well grown 16 days old rice seedlings  40 plants infected by nematode @ 205/plants  40 plants for control(not to be infected)
  9. 9. MATERIALS AND METHODS… 5 plants considered as 1 pool 32 total samples of root and shoot tissues collected from infected & uninfected plants at 1, 3, 5 and 7 dpi RNA extracted, cDNA synthesized Quality check of cDNA sample and qPCR primers q-PCR data obtained were analysed by REST-2009 software
  10. 10. RESULTS AND DISCUSSION
  11. 11. CLONINGAmplification of DEAD, purine and CupinAmplification of rice genes with 52ºC Amplification of rice genes with 45ºCannealing temperature for 40 cycles annealing temperature for 5 cycles Cupin was successfully cloned followed by 52ºC for 35 cycles
  12. 12. Rice genes expression patternRelative expression level of three rice genes in root tissues at differenttime points after H. oryzae infection (infected vs non-infected plants)
  13. 13. Cupin Cupin highly up regulated at 3 dpi in root tissue under H. oryzae infection (Kyndt, 2011. unpublished data) Cupin up-regulated at 2 dpi in Nipponbare rice under Striga hermonthica infection (Swarbrick et al.,2008) and also under infection with Magnaporthe oryzae (Marcel et al., 2010).
  14. 14.  Cupin domain gene shows homology with a germin- like protein from Barley (http://rice.plantbiology.msu.edu/cgi- bin/ORF_infopage.cgi) GLPs in basal host resistance against powdery mildew (Blumeria graminis spp.) in barley and wheat (Christensen et al., 2004; Zimmermann et al, 2006). GLP governing gene chr8 OsGLP contributes broad resistance against two rice fungal pathogens which are causal agent of rice blast and sheath blight diseases (Manosalva et al., 2009).
  15. 15. Membrane down-regulation of Membrane at different time points supports the unpublished finding of Kyndt (2011) Membrane down-regulated in Nipponbare under Striga hermonthica infection (Swarbrick et al., 2008)
  16. 16. B-box B-box was down-regulated under H. oryzae infection in the research done by Kyndt (2011). Mukhopadhyay et al. (2003) have reported that transgenic tobacco over-expressing a zinc-finger protein gene from rice conferred tolerance to cold, dehydration, and salt stress.
  17. 17. CONCLUSION AND SUGGESTIONSCupin domain gene may have role in basal defenseagainst H. oryzaeMembrane protein and B-box zinc finger family proteinalso may have significant role during rice and thenematode interaction.all three genes have systemic activation in whole plantunder H. oryzae infection these genes can be over-expressed or silenced in riceand their impact on the nematode population and itsinfectivity can be observed.
  18. 18. THANK YOU FOR YOURKIND ATTENTION
  19. 19. REFERENCES Abad, P., Favery, B., Rosso, M., Castagnone-Sereno, P. 2003. Root-knot nematode parasitism and host response: molecular basis of a sophisticated interaction. Molecular Plant Pathology, 4(4): 217–224. Burrows, P.R. 1992. Molecular Analysis of the Interactions between Cyst nematodes and Their Host. Journal of Nematology, 24(3): 338-342. Christensen, A.B., Christensen, H.T., Zimmermann, G., Gjetting, T., Lyngkjaer, M.F., Dudler, R., Schweizer, P. 2004. The Germinlike Protein GLP4 Exhibits Superoxide Dismutase Activity and Is an Important Component of Quantitative Resistance in Wheat and Barley. MPMI, 17(1): 109–117. Dixon, R., Harrison, M. 1990. Activation, structure, and organization of genes involved in microbial defense in plants. Adv Genet., 28: 165–234. Gheysen, G., Fenoll, C. 2002. Gene expression in nematode feeding site. Annu. Rev. Phytopathol. 40:191–219 Gheysen, G., VanderEycken, W., Barthels, N., Karimi, M., VanMontagu, M. 1996. The exploitation of nematode-responsive plant genes in novel nematode control methods. Pesticide Science, 47(1): 95-101(abstract). Green, J., Vain, P., Fearnehough, M.T., Worland, B., Snape, J.W., Atkinson, H.J. 2002. Analysis of expression pattern of Arabidopsis thaliana tubulin-1 and Zea mays ubiqutin-1 promoters in rice plants in association with nematode infection. Physiological and Molecular Plant Pathology, 60:197-205. Huang, S., Taylor, N.L., Narsai, R., Eubel, H., Whelan, J., Millar, A.H. 2009. Experimental analysis of the rice mitochondrial proteome, its biogenesis, and heterogeneity. Plant Physiol., 149(2):719- 34. Jones J.D., Dangl J.L. 2006. The plant immune system. Nature, 444:323-329.
  20. 20.  Manosalva, P.M., Davidson, R.M., Liu, B., Zhu, X., Hulbert, S.H., Leung, H., Leach, J.E. 2009. A Germin-Like Protein Gene Family Functions as a Complex Quantitative Trait Locus Conferring Broad-Spectrum Disease Resistance in Rice. Plant Physiology, 149:286–296. Ryals, J., Uknes, S., Ward, E. 1994. Systemic acquired resistance. Plant Physiol., 104: 1109- 1112. Swarbrick, P.J., Huang, K., Liu, G., Slate, J., Press, M.C., Scholes, J.D. 2008. Global patterns of gene expression in rice cultivars undergoing a susceptible or resistant interaction with the parasitic plant Striga hermonthica. New Phytol., 179(2):515-29. Williamson, V.M., Hussey, R.S. 1996. Nematode pathogenesis and resistance in plants. Plant Cell 8:1735–45. Williamson, V.M., Lambert, K.N., Kaloshian, I. 1994. Molecular biology of nematode resistance in tomato. In: Lamberti, F., De Giorgi, C., Mc Bird, D.K. (Eds.) Advances in Molecular Plant Nematology, pp. 211–19. Zhou, Y.L., Xu, M.R., Zhao, M.F., Xie, X.W., Zhu, L.H., Fu, B.Y., Li, Z.K. 2010. Genome-wide responses in a transgenic rice line carrying the maize resistance gene Rxo1 to the rice bacterial streak pathogen, Xanthomonas oryzae pv. oryzicola. BMC Genomis, 1:11-78. Zimmermann, G., Baumlein, H., Mock, H.P., Himmelbach, A., Schweizer, P. 2006. The Multigene Family Encoding Germin-Like Proteins of Barley. Regulation and Function in Basal Host Resistance. Plant Physiology, 142: 181–192. http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi
  21. 21. LIST OF PRIMERS USED TO AMPLIFY GENES AND IN COLONY PCRName Locus F-primer R-primerDEAD LOC_Os11g44910 atggcggggtacgagagg tcaagagggaatctttatgcagttgPurine LOC_Os03g08880 atggccaccattactgctgc ctaaggcgccgctgactcCupin LOC_Os08g09080 atggcttcgtcttccttcc tcagtaatggttgttctcccagMembrane LOC_Os04g33830.1 atggccgcctccaccgtctc tcacttgtcgaagtagccctcRing LOC_Os04g50100 atggcatcctctgctcctgc tcacattggatgatctgaatcB-box LOC_Os02g39360.1 atgaagatccagtgcgacgcgt tcaaccaagatcagggacgaSP6 taatacgactcactatagggcgaattggT7 atttaggtgacactatagaatactcaagcOligodT tttttttttttttttttttttttttvn
  22. 22. LIST OF Q-PCR PRIMERSGene name Locus F-primer R-primerCupin LOC_Os08g09080 tgtgttcgtattccctgtgg agggttctggctgctaagtgMember LOC_Os04g33830.1 gctcttcttctccagcatcg caggaacagcccaaggtgRing LOC_Os04g50100 gacgttctgcaggaatccat cccttcccttgctgttctcB-box LOC_Os02g39360.1 cctccagttctccgactacg ttgtggaacaggtcgatgtcEXP LOC_Os03g27010 tgtgagcagcttctcgtttg tgttgttgcctgtgagatcgEXPnarsai LOC_Os11g21990.1 aggaacatggagaagaacaagg cagaggtggtgcagatgaaaEIF5C LOC_Os07g02340.1 cacgttacggtgacacctttt gacgctctccttcttcctcag
  23. 23. LIST OF RANDOMLY SELECTED CDNA SAMPLES TO CHECK Q-PCR PRIMERSGenes 1 dpi samples 3 dpi samples 5 dpi samples 7 dpi samplesCupin Bl S1 Ho S2 Bl R1 Ho S2Membrane Bl R2 Ho R1 Bl S2 Ho R2Ring Ho R1 Bl S1 Ho S1 Bl R1B-box Ho S2 Bl R2 Ho R2 Bl S2Bl: uninfected; Ho: infected; S: shoot; R: root; dpi: day/s post infection

×