SlideShare a Scribd company logo

Bonus quiz 1 This bonus quiz is based on the material in Ch.pdf

Bonus quiz 1. This bonus quiz is based on the material in Chapter 2. Name: Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAAT CGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of an mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) 2. Write the N-terminal portion of polypeptide which is encoded by this DNA. Used genetic code table from Lecture 2g, slide H68. (10 points).Question 2.55. What are the properties of the genetic code? (20 points) How many codons are in the genetic code? (5 points) What are a sense, a start, a stop and a nonsense codons? ( 10 points) Codon bias: GC-rich microorganisms tend to utilize codons with G or C in the third position, whereas ATrich microorganisms end to utilize codons with A or T in the hird position. amber, and opal are termination codons..

1 of 1
Download to read offline
Bonus quiz 1. This bonus quiz is based on the material in Chapter 2. Name: Only one strand of a
double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide.
GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAAT
CGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be
transcribed from this DNA. Hint: it is impossible to identify the first base of an mRNA accurately
from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real
start. (10 points) 2. Write the N-terminal portion of polypeptide which is encoded by this DNA.
Used genetic code table from Lecture 2g, slide H68. (10 points).Question 2.55. What are the
properties of the genetic code? (20 points) How many codons are in the genetic code? (5 points)
What are a sense, a start, a stop and a nonsense codons? ( 10 points) Codon bias: GC-rich
microorganisms tend to utilize codons with G or C in the third position, whereas ATrich
microorganisms end to utilize codons with A or T in the hird position. amber, and opal are
termination codons.

Recommended

Here, our goal is to amplify the gene encoding Taq DNA polymerase. T.pdf
Here, our goal is to amplify the gene encoding Taq DNA polymerase. T.pdfHere, our goal is to amplify the gene encoding Taq DNA polymerase. T.pdf
Here, our goal is to amplify the gene encoding Taq DNA polymerase. T.pdfarihantgiftgallery
 
Part I Genes on DNA • DNA consists of two antiparallel strands, eac.pdf
Part I Genes on DNA • DNA consists of two antiparallel strands, eac.pdfPart I Genes on DNA • DNA consists of two antiparallel strands, eac.pdf
Part I Genes on DNA • DNA consists of two antiparallel strands, eac.pdfmohamednihalshahru
 
The answers inserted below are wrong- Question 1- Question 2- Hi- p.docx
The answers inserted below are wrong-  Question 1-  Question 2-  Hi- p.docxThe answers inserted below are wrong-  Question 1-  Question 2-  Hi- p.docx
The answers inserted below are wrong- Question 1- Question 2- Hi- p.docxLucascIqTurnere
 
Microarray biotechnologg ppy dna microarrays
Microarray biotechnologg ppy dna microarraysMicroarray biotechnologg ppy dna microarrays
Microarray biotechnologg ppy dna microarraysayeshasattarsandhu
 
Molecular biology final copy
Molecular biology final copyMolecular biology final copy
Molecular biology final copySalah Abass
 
Practice and understand transcription and translation at the Utah ge.docx
Practice and understand transcription and translation at the Utah ge.docxPractice and understand transcription and translation at the Utah ge.docx
Practice and understand transcription and translation at the Utah ge.docxsarantatersall
 
If you had short orthologous gene sequences from a few different spec.pdf
If you had short orthologous gene sequences from a few different spec.pdfIf you had short orthologous gene sequences from a few different spec.pdf
If you had short orthologous gene sequences from a few different spec.pdfatulkapoor33
 
2. The following double stranded segment of DNA is part of a protein .pdf
 2. The following double stranded segment of DNA is part of a protein .pdf 2. The following double stranded segment of DNA is part of a protein .pdf
2. The following double stranded segment of DNA is part of a protein .pdfallwayscollection
 

More Related Content

More from prabhudhanakodi6

Write out the correct DNA coding strand from the following D.pdf
Write out the correct DNA coding strand from the following D.pdfWrite out the correct DNA coding strand from the following D.pdf
Write out the correct DNA coding strand from the following D.pdfprabhudhanakodi6
 
Write a program in C++ that calculates and displays a foods.pdf
Write a program in C++ that calculates and displays a foods.pdfWrite a program in C++ that calculates and displays a foods.pdf
Write a program in C++ that calculates and displays a foods.pdfprabhudhanakodi6
 
What hexadecimal number will contain when the instruction is.pdf
What hexadecimal number will contain when the instruction is.pdfWhat hexadecimal number will contain when the instruction is.pdf
What hexadecimal number will contain when the instruction is.pdfprabhudhanakodi6
 
The table below contains the amount that a sample of nine cu.pdf
The table below contains the amount that a sample of nine cu.pdfThe table below contains the amount that a sample of nine cu.pdf
The table below contains the amount that a sample of nine cu.pdfprabhudhanakodi6
 
Un artculo de investigacin describi una muestra aleatoria.pdf
Un artculo de investigacin describi una muestra aleatoria.pdfUn artculo de investigacin describi una muestra aleatoria.pdf
Un artculo de investigacin describi una muestra aleatoria.pdfprabhudhanakodi6
 
The debits to Work in ProcessRoasting Department for Mornin.pdf
The debits to Work in ProcessRoasting Department for Mornin.pdfThe debits to Work in ProcessRoasting Department for Mornin.pdf
The debits to Work in ProcessRoasting Department for Mornin.pdfprabhudhanakodi6
 
The answer of y 12x did not work Let X be a random va.pdf
The answer of y  12x did not work Let X be a random va.pdfThe answer of y  12x did not work Let X be a random va.pdf
The answer of y 12x did not work Let X be a random va.pdfprabhudhanakodi6
 
The equation of exchango MVapy can be rewitben to highlight .pdf
The equation of exchango MVapy can be rewitben to highlight .pdfThe equation of exchango MVapy can be rewitben to highlight .pdf
The equation of exchango MVapy can be rewitben to highlight .pdfprabhudhanakodi6
 
Supposo the Hockey Hal of Fame in Toronlo has approached Sta.pdf
Supposo the Hockey Hal of Fame in Toronlo has approached Sta.pdfSupposo the Hockey Hal of Fame in Toronlo has approached Sta.pdf
Supposo the Hockey Hal of Fame in Toronlo has approached Sta.pdfprabhudhanakodi6
 
Tahviller iskontolu ihra ediliyorsa bu u anlama gelir ih.pdf
Tahviller iskontolu ihra ediliyorsa bu u anlama gelir  ih.pdfTahviller iskontolu ihra ediliyorsa bu u anlama gelir  ih.pdf
Tahviller iskontolu ihra ediliyorsa bu u anlama gelir ih.pdfprabhudhanakodi6
 
RevenueAdvertisingrevenueRampDrevenue830161.pdf
RevenueAdvertisingrevenueRampDrevenue830161.pdfRevenueAdvertisingrevenueRampDrevenue830161.pdf
RevenueAdvertisingrevenueRampDrevenue830161.pdfprabhudhanakodi6
 
source of fluid from joints.pdf
source of fluid from joints.pdfsource of fluid from joints.pdf
source of fluid from joints.pdfprabhudhanakodi6
 
Question 4 Imagine that you are an information security con.pdf
Question 4  Imagine that you are an information security con.pdfQuestion 4  Imagine that you are an information security con.pdf
Question 4 Imagine that you are an information security con.pdfprabhudhanakodi6
 
Q4 Suppose we are testing Ho u 38 vs H1 u gt 38 .pdf
Q4 Suppose we are testing Ho  u  38 vs H1 u gt 38 .pdfQ4 Suppose we are testing Ho  u  38 vs H1 u gt 38 .pdf
Q4 Suppose we are testing Ho u 38 vs H1 u gt 38 .pdfprabhudhanakodi6
 
Product A B C Total sales 1537280 933600 1397120 Tot.pdf
Product A B C Total sales 1537280 933600 1397120 Tot.pdfProduct A B C Total sales 1537280 933600 1397120 Tot.pdf
Product A B C Total sales 1537280 933600 1397120 Tot.pdfprabhudhanakodi6
 
El hospital de agudos tiene varios tipos organizativos La o.pdf
El hospital de agudos tiene varios tipos organizativos La o.pdfEl hospital de agudos tiene varios tipos organizativos La o.pdf
El hospital de agudos tiene varios tipos organizativos La o.pdfprabhudhanakodi6
 
Aadaki ifadeleri daha olumlu ve nazik hale getirmek iin gz.pdf
Aadaki ifadeleri daha olumlu ve nazik hale getirmek iin gz.pdfAadaki ifadeleri daha olumlu ve nazik hale getirmek iin gz.pdf
Aadaki ifadeleri daha olumlu ve nazik hale getirmek iin gz.pdfprabhudhanakodi6
 
Assume a Poisson distribution a If 25 find PX10 b .pdf
Assume a Poisson distribution a If 25 find PX10 b .pdfAssume a Poisson distribution a If 25 find PX10 b .pdf
Assume a Poisson distribution a If 25 find PX10 b .pdfprabhudhanakodi6
 
article suggests the lognormal distribution as a model for 5.pdf
article suggests the lognormal distribution as a model for 5.pdfarticle suggests the lognormal distribution as a model for 5.pdf
article suggests the lognormal distribution as a model for 5.pdfprabhudhanakodi6
 

More from prabhudhanakodi6 (20)

Write out the correct DNA coding strand from the following D.pdf
Write out the correct DNA coding strand from the following D.pdfWrite out the correct DNA coding strand from the following D.pdf
Write out the correct DNA coding strand from the following D.pdf
 
Write a program in C++ that calculates and displays a foods.pdf
Write a program in C++ that calculates and displays a foods.pdfWrite a program in C++ that calculates and displays a foods.pdf
Write a program in C++ that calculates and displays a foods.pdf
 
What hexadecimal number will contain when the instruction is.pdf
What hexadecimal number will contain when the instruction is.pdfWhat hexadecimal number will contain when the instruction is.pdf
What hexadecimal number will contain when the instruction is.pdf
 
The table below contains the amount that a sample of nine cu.pdf
The table below contains the amount that a sample of nine cu.pdfThe table below contains the amount that a sample of nine cu.pdf
The table below contains the amount that a sample of nine cu.pdf
 
Un artculo de investigacin describi una muestra aleatoria.pdf
Un artculo de investigacin describi una muestra aleatoria.pdfUn artculo de investigacin describi una muestra aleatoria.pdf
Un artculo de investigacin describi una muestra aleatoria.pdf
 
TT1.pdf
TT1.pdfTT1.pdf
TT1.pdf
 
The debits to Work in ProcessRoasting Department for Mornin.pdf
The debits to Work in ProcessRoasting Department for Mornin.pdfThe debits to Work in ProcessRoasting Department for Mornin.pdf
The debits to Work in ProcessRoasting Department for Mornin.pdf
 
The answer of y 12x did not work Let X be a random va.pdf
The answer of y  12x did not work Let X be a random va.pdfThe answer of y  12x did not work Let X be a random va.pdf
The answer of y 12x did not work Let X be a random va.pdf
 
The equation of exchango MVapy can be rewitben to highlight .pdf
The equation of exchango MVapy can be rewitben to highlight .pdfThe equation of exchango MVapy can be rewitben to highlight .pdf
The equation of exchango MVapy can be rewitben to highlight .pdf
 
Supposo the Hockey Hal of Fame in Toronlo has approached Sta.pdf
Supposo the Hockey Hal of Fame in Toronlo has approached Sta.pdfSupposo the Hockey Hal of Fame in Toronlo has approached Sta.pdf
Supposo the Hockey Hal of Fame in Toronlo has approached Sta.pdf
 
Tahviller iskontolu ihra ediliyorsa bu u anlama gelir ih.pdf
Tahviller iskontolu ihra ediliyorsa bu u anlama gelir  ih.pdfTahviller iskontolu ihra ediliyorsa bu u anlama gelir  ih.pdf
Tahviller iskontolu ihra ediliyorsa bu u anlama gelir ih.pdf
 
RevenueAdvertisingrevenueRampDrevenue830161.pdf
RevenueAdvertisingrevenueRampDrevenue830161.pdfRevenueAdvertisingrevenueRampDrevenue830161.pdf
RevenueAdvertisingrevenueRampDrevenue830161.pdf
 
source of fluid from joints.pdf
source of fluid from joints.pdfsource of fluid from joints.pdf
source of fluid from joints.pdf
 
Question 4 Imagine that you are an information security con.pdf
Question 4  Imagine that you are an information security con.pdfQuestion 4  Imagine that you are an information security con.pdf
Question 4 Imagine that you are an information security con.pdf
 
Q4 Suppose we are testing Ho u 38 vs H1 u gt 38 .pdf
Q4 Suppose we are testing Ho  u  38 vs H1 u gt 38 .pdfQ4 Suppose we are testing Ho  u  38 vs H1 u gt 38 .pdf
Q4 Suppose we are testing Ho u 38 vs H1 u gt 38 .pdf
 
Product A B C Total sales 1537280 933600 1397120 Tot.pdf
Product A B C Total sales 1537280 933600 1397120 Tot.pdfProduct A B C Total sales 1537280 933600 1397120 Tot.pdf
Product A B C Total sales 1537280 933600 1397120 Tot.pdf
 
El hospital de agudos tiene varios tipos organizativos La o.pdf
El hospital de agudos tiene varios tipos organizativos La o.pdfEl hospital de agudos tiene varios tipos organizativos La o.pdf
El hospital de agudos tiene varios tipos organizativos La o.pdf
 
Aadaki ifadeleri daha olumlu ve nazik hale getirmek iin gz.pdf
Aadaki ifadeleri daha olumlu ve nazik hale getirmek iin gz.pdfAadaki ifadeleri daha olumlu ve nazik hale getirmek iin gz.pdf
Aadaki ifadeleri daha olumlu ve nazik hale getirmek iin gz.pdf
 
Assume a Poisson distribution a If 25 find PX10 b .pdf
Assume a Poisson distribution a If 25 find PX10 b .pdfAssume a Poisson distribution a If 25 find PX10 b .pdf
Assume a Poisson distribution a If 25 find PX10 b .pdf
 
article suggests the lognormal distribution as a model for 5.pdf
article suggests the lognormal distribution as a model for 5.pdfarticle suggests the lognormal distribution as a model for 5.pdf
article suggests the lognormal distribution as a model for 5.pdf
 

Recently uploaded

Practical Research 1, Lesson 5: DESIGNING A RESEARCH PROJECT RELATED TO DAILY...
Practical Research 1, Lesson 5: DESIGNING A RESEARCH PROJECT RELATED TO DAILY...Practical Research 1, Lesson 5: DESIGNING A RESEARCH PROJECT RELATED TO DAILY...
Practical Research 1, Lesson 5: DESIGNING A RESEARCH PROJECT RELATED TO DAILY...Katherine Villaluna
 
Grades 7 to 8 Anti- OSAEC and CSAEM session.pptx
Grades 7 to 8 Anti- OSAEC and CSAEM session.pptxGrades 7 to 8 Anti- OSAEC and CSAEM session.pptx
Grades 7 to 8 Anti- OSAEC and CSAEM session.pptxGladysValencia13
 
2.20.24 The March on Washington for Jobs and Freedom.pptx
2.20.24 The March on Washington for Jobs and Freedom.pptx2.20.24 The March on Washington for Jobs and Freedom.pptx
2.20.24 The March on Washington for Jobs and Freedom.pptxMaryPotorti1
 
11 CI SINIF SINAQLARI - 5-2023-Aynura-Hamidova.pdf
11 CI SINIF SINAQLARI - 5-2023-Aynura-Hamidova.pdf11 CI SINIF SINAQLARI - 5-2023-Aynura-Hamidova.pdf
11 CI SINIF SINAQLARI - 5-2023-Aynura-Hamidova.pdfAynouraHamidova
 
Chromatography-Gas chromatography-Principle
Chromatography-Gas chromatography-PrincipleChromatography-Gas chromatography-Principle
Chromatography-Gas chromatography-Principleblessipriyanka
 
ICSE English Literature Class X Handwritten Notes
ICSE English Literature Class X Handwritten NotesICSE English Literature Class X Handwritten Notes
ICSE English Literature Class X Handwritten NotesGauri S
 
Diploma 2nd yr PHARMACOLOGY chapter 5 part 1.pdf
Diploma 2nd yr PHARMACOLOGY chapter 5 part 1.pdfDiploma 2nd yr PHARMACOLOGY chapter 5 part 1.pdf
Diploma 2nd yr PHARMACOLOGY chapter 5 part 1.pdfSUMIT TIWARI
 
Creative, Technical, and Academic Writing
Creative, Technical, and Academic WritingCreative, Technical, and Academic Writing
Creative, Technical, and Academic WritingMYDA ANGELICA SUAN
 
SOCIAL JUSTICE LESSON ON CATCH UP FRIDAY
SOCIAL JUSTICE LESSON ON CATCH UP FRIDAYSOCIAL JUSTICE LESSON ON CATCH UP FRIDAY
SOCIAL JUSTICE LESSON ON CATCH UP FRIDAYGloriaRamos83
 
11 CI SINIF SINAQLARI - 10-2023-Aynura-Hamidova.pdf
11 CI SINIF SINAQLARI - 10-2023-Aynura-Hamidova.pdf11 CI SINIF SINAQLARI - 10-2023-Aynura-Hamidova.pdf
11 CI SINIF SINAQLARI - 10-2023-Aynura-Hamidova.pdfAynouraHamidova
 
Data Modeling - Entity Relationship Diagrams-1.pdf
Data Modeling - Entity Relationship Diagrams-1.pdfData Modeling - Entity Relationship Diagrams-1.pdf
Data Modeling - Entity Relationship Diagrams-1.pdfChristalin Nelson
 
Practical Research 1: Qualitative Research and Its Importance in Daily Life.pptx
Practical Research 1: Qualitative Research and Its Importance in Daily Life.pptxPractical Research 1: Qualitative Research and Its Importance in Daily Life.pptx
Practical Research 1: Qualitative Research and Its Importance in Daily Life.pptxKatherine Villaluna
 
A LABORATORY MANUAL FOR ORGANIC CHEMISTRY.pdf
A LABORATORY MANUAL FOR ORGANIC CHEMISTRY.pdfA LABORATORY MANUAL FOR ORGANIC CHEMISTRY.pdf
A LABORATORY MANUAL FOR ORGANIC CHEMISTRY.pdfDr.M.Geethavani
 
New Features in the Odoo 17 Sales Module
New Features in  the Odoo 17 Sales ModuleNew Features in  the Odoo 17 Sales Module
New Features in the Odoo 17 Sales ModuleCeline George
 
skeletal system complete details with joints and its types
skeletal system complete details with joints and its typesskeletal system complete details with joints and its types
skeletal system complete details with joints and its typesMinaxi patil. CATALLYST
 
11 CI SINIF SINAQLARI - 2-2023-Aynura-Hamidova.pdf
11 CI SINIF SINAQLARI - 2-2023-Aynura-Hamidova.pdf11 CI SINIF SINAQLARI - 2-2023-Aynura-Hamidova.pdf
11 CI SINIF SINAQLARI - 2-2023-Aynura-Hamidova.pdfAynouraHamidova
 
Food Web SlideShare for Ecology Notes Quiz in Canvas
Food Web SlideShare for Ecology Notes Quiz in CanvasFood Web SlideShare for Ecology Notes Quiz in Canvas
Food Web SlideShare for Ecology Notes Quiz in CanvasAlexandraSwartzwelde
 
Andreas Schleicher - 20 Feb 2024 - How pop music, podcasts, and Tik Tok are i...
Andreas Schleicher - 20 Feb 2024 - How pop music, podcasts, and Tik Tok are i...Andreas Schleicher - 20 Feb 2024 - How pop music, podcasts, and Tik Tok are i...
Andreas Schleicher - 20 Feb 2024 - How pop music, podcasts, and Tik Tok are i...EduSkills OECD
 

Recently uploaded (20)

Practical Research 1, Lesson 5: DESIGNING A RESEARCH PROJECT RELATED TO DAILY...
Practical Research 1, Lesson 5: DESIGNING A RESEARCH PROJECT RELATED TO DAILY...Practical Research 1, Lesson 5: DESIGNING A RESEARCH PROJECT RELATED TO DAILY...
Practical Research 1, Lesson 5: DESIGNING A RESEARCH PROJECT RELATED TO DAILY...
 
Grades 7 to 8 Anti- OSAEC and CSAEM session.pptx
Grades 7 to 8 Anti- OSAEC and CSAEM session.pptxGrades 7 to 8 Anti- OSAEC and CSAEM session.pptx
Grades 7 to 8 Anti- OSAEC and CSAEM session.pptx
 
2.20.24 The March on Washington for Jobs and Freedom.pptx
2.20.24 The March on Washington for Jobs and Freedom.pptx2.20.24 The March on Washington for Jobs and Freedom.pptx
2.20.24 The March on Washington for Jobs and Freedom.pptx
 
DNA damage and repair mechanism
DNA damage and repair mechanism DNA damage and repair mechanism
DNA damage and repair mechanism
 
11 CI SINIF SINAQLARI - 5-2023-Aynura-Hamidova.pdf
11 CI SINIF SINAQLARI - 5-2023-Aynura-Hamidova.pdf11 CI SINIF SINAQLARI - 5-2023-Aynura-Hamidova.pdf
11 CI SINIF SINAQLARI - 5-2023-Aynura-Hamidova.pdf
 
Chromatography-Gas chromatography-Principle
Chromatography-Gas chromatography-PrincipleChromatography-Gas chromatography-Principle
Chromatography-Gas chromatography-Principle
 
ICSE English Literature Class X Handwritten Notes
ICSE English Literature Class X Handwritten NotesICSE English Literature Class X Handwritten Notes
ICSE English Literature Class X Handwritten Notes
 
Diploma 2nd yr PHARMACOLOGY chapter 5 part 1.pdf
Diploma 2nd yr PHARMACOLOGY chapter 5 part 1.pdfDiploma 2nd yr PHARMACOLOGY chapter 5 part 1.pdf
Diploma 2nd yr PHARMACOLOGY chapter 5 part 1.pdf
 
Creative, Technical, and Academic Writing
Creative, Technical, and Academic WritingCreative, Technical, and Academic Writing
Creative, Technical, and Academic Writing
 
Capter 5 Climate of Ethiopia and the Horn GeES 1011.pdf
Capter 5 Climate of Ethiopia and the Horn GeES 1011.pdfCapter 5 Climate of Ethiopia and the Horn GeES 1011.pdf
Capter 5 Climate of Ethiopia and the Horn GeES 1011.pdf
 
SOCIAL JUSTICE LESSON ON CATCH UP FRIDAY
SOCIAL JUSTICE LESSON ON CATCH UP FRIDAYSOCIAL JUSTICE LESSON ON CATCH UP FRIDAY
SOCIAL JUSTICE LESSON ON CATCH UP FRIDAY
 
11 CI SINIF SINAQLARI - 10-2023-Aynura-Hamidova.pdf
11 CI SINIF SINAQLARI - 10-2023-Aynura-Hamidova.pdf11 CI SINIF SINAQLARI - 10-2023-Aynura-Hamidova.pdf
11 CI SINIF SINAQLARI - 10-2023-Aynura-Hamidova.pdf
 
Data Modeling - Entity Relationship Diagrams-1.pdf
Data Modeling - Entity Relationship Diagrams-1.pdfData Modeling - Entity Relationship Diagrams-1.pdf
Data Modeling - Entity Relationship Diagrams-1.pdf
 
Practical Research 1: Qualitative Research and Its Importance in Daily Life.pptx
Practical Research 1: Qualitative Research and Its Importance in Daily Life.pptxPractical Research 1: Qualitative Research and Its Importance in Daily Life.pptx
Practical Research 1: Qualitative Research and Its Importance in Daily Life.pptx
 
A LABORATORY MANUAL FOR ORGANIC CHEMISTRY.pdf
A LABORATORY MANUAL FOR ORGANIC CHEMISTRY.pdfA LABORATORY MANUAL FOR ORGANIC CHEMISTRY.pdf
A LABORATORY MANUAL FOR ORGANIC CHEMISTRY.pdf
 
New Features in the Odoo 17 Sales Module
New Features in  the Odoo 17 Sales ModuleNew Features in  the Odoo 17 Sales Module
New Features in the Odoo 17 Sales Module
 
skeletal system complete details with joints and its types
skeletal system complete details with joints and its typesskeletal system complete details with joints and its types
skeletal system complete details with joints and its types
 
11 CI SINIF SINAQLARI - 2-2023-Aynura-Hamidova.pdf
11 CI SINIF SINAQLARI - 2-2023-Aynura-Hamidova.pdf11 CI SINIF SINAQLARI - 2-2023-Aynura-Hamidova.pdf
11 CI SINIF SINAQLARI - 2-2023-Aynura-Hamidova.pdf
 
Food Web SlideShare for Ecology Notes Quiz in Canvas
Food Web SlideShare for Ecology Notes Quiz in CanvasFood Web SlideShare for Ecology Notes Quiz in Canvas
Food Web SlideShare for Ecology Notes Quiz in Canvas
 
Andreas Schleicher - 20 Feb 2024 - How pop music, podcasts, and Tik Tok are i...
Andreas Schleicher - 20 Feb 2024 - How pop music, podcasts, and Tik Tok are i...Andreas Schleicher - 20 Feb 2024 - How pop music, podcasts, and Tik Tok are i...
Andreas Schleicher - 20 Feb 2024 - How pop music, podcasts, and Tik Tok are i...
 

Bonus quiz 1 This bonus quiz is based on the material in Ch.pdf

  • 1. Bonus quiz 1. This bonus quiz is based on the material in Chapter 2. Name: Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAAT CGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of an mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) 2. Write the N-terminal portion of polypeptide which is encoded by this DNA. Used genetic code table from Lecture 2g, slide H68. (10 points).Question 2.55. What are the properties of the genetic code? (20 points) How many codons are in the genetic code? (5 points) What are a sense, a start, a stop and a nonsense codons? ( 10 points) Codon bias: GC-rich microorganisms tend to utilize codons with G or C in the third position, whereas ATrich microorganisms end to utilize codons with A or T in the hird position. amber, and opal are termination codons.