Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Visualising RNA             Paul Gardner paul.gardner@canterbury.ac.nzUniversity of Canterbury, Christchurch,             ...
Feel free to share       Feel free to tweet (@ppgardne), Google+, tumblr, ...       Slides are available from       http:/...
What is an RNA?    A                                                      Primary Structure         5        10        15 ...
What is Rfam?      Sister database to Pfam      Aims to annotate all ncRNA families      Consortium headed by Alex Bateman...
Rfam: families of ncRNAs   http://rfam.sanger.ac.uk   http://rfam.janelia.org                              Paul Gardner   ...
Building an Rfam family          A structure from literature   Pollard KS, et al. (2006). An RNA gene expressed during cor...
Building an Rfam family        An Rfam family: produced manually from publication figures    # STOCKHOLM 1.0    G.gallus.1 ...
Building an Rfam family      And the Wikipedia entry                       Paul Gardner   Visualising RNA
Conflicting priorities          A Curator’s priorities                           A User’s priorities             1.   New f...
2007: challenges      Quality Control      Re-write the website and add some bling      Update codebase      Export annota...
Visualisation priorities   SCALE       Two to two million sequences, 30 to 3,000 nucleotides long, 0       to 1,000 basepa...
Examples      Caveat: none of these images I am showing are final solutions,      everything can be improved upon.         ...
RNA Secondary Structure                                        5’   3’                                   UM               ...
Old Taxonomic distributions: RybB      Contamination displayed first.                        Paul Gardner   Visualising RNA
Old Taxonomic distributions: RybB      After some scrolling                         Paul Gardner   Visualising RNA
New Taxonomic distributions: RybB      Sunbursts: concentric “pie charts”, each external ring      contains the “children”...
Alignments      When we have sequenced everything, how is this view going      to look?                        Paul Gardne...
Genomic contexts & Gene Order           How can we display comparative gene-order information in a           scalable fash...
Open problems      Evolution and RNA structure      Scalable, alignment visualisation (and editing)          As alignments...
Thanks!         The Rfam Consortium:                 Alex Bateman, Sean                 Eddy, Sam                 Griffiths-...
Upcoming SlideShare
Loading in …5
×

Vizbi2013: Visualising RNA

502 views

Published on

Published in: Technology
  • Be the first to comment

  • Be the first to like this

Vizbi2013: Visualising RNA

  1. 1. Visualising RNA Paul Gardner paul.gardner@canterbury.ac.nzUniversity of Canterbury, Christchurch, New Zealand. March 20, 2013 Paul Gardner Visualising RNA
  2. 2. Feel free to share Feel free to tweet (@ppgardne), Google+, tumblr, ... Slides are available from http://www.slideshare.net/ppgardne/. Paul Gardner Visualising RNA
  3. 3. What is an RNA? A Primary Structure 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 Ψ Ψ 5’ GCGGAUUUAGCUCAGDDGGGAGAGCGCCAGACUGAAYA.CUGGAGGUCCUGUGT.CGAUCCACAGAAUUCGCACCA 3’ B Secondary Structure C Tertiary Structure 75 3’A C 5’ C T ΨC 3’ 5’ G C A Loop Acceptor C G Stem G C 70 GU T ΨC D Loop 5A U Acceptor 15 UA Loop D Loop DGA U U A 65 60 Stem D A C UA C U C G 10 GACAC G G CUGUG G G G A A G C 25 C 50 G U T ΨC . 20 C GAG G 55 C G 45 AU G C 40 A 30 C Ψ . Variable Anticodon U A Anticodon Loop Loop G A A . Y Loop 35 Paul Gardner Visualising RNA
  4. 4. What is Rfam? Sister database to Pfam Aims to annotate all ncRNA families Consortium headed by Alex Bateman (Wellcome Trust Sanger Institute), Sean Eddy (Janelia, Howard Hughes), Sam Griffiths-Jones (Manchester, BBSRC), Paul Gardner (University of Canterbury, RSNZ) Paul Gardner Visualising RNA
  5. 5. Rfam: families of ncRNAs http://rfam.sanger.ac.uk http://rfam.janelia.org Paul Gardner Visualising RNA
  6. 6. Building an Rfam family A structure from literature Pollard KS, et al. (2006). An RNA gene expressed during cortical development evolved rapidly in humans. Nature. Paul Gardner Visualising RNA
  7. 7. Building an Rfam family An Rfam family: produced manually from publication figures # STOCKHOLM 1.0 G.gallus.1 UGAAAUGGAGGAGAAAUUACAGCAAUUUAUCAACUGAAAUUAUAGGUGUAGACACAUGUCAGCAGUAG M.musculus.1 UAAAAUGGAGGAGAAAUUACAGCAAUUUAUCAGCUGAAAUUAUAGGUGUAGACACAUGUCAGCCGUGG M.mulatta.1 UGAAAUGGAGGAGAAAUUACAGCAAUUUAUCAGCUGAAAUUAUAGGUGUAGACACAUGUCAGCAGUGG G.gorilla.1 UGAAAUGGAGGAGAAAUUACAGCAAUUUAUCAACUGAAAUUAUAGGUGUAGACACAUGUCAGCAGUGG H.sapiens.1 UGAAACGGAGGAGACGUUACAGCAACGUGUCAGCUGAAAUGAUGGGCGUAGACGCACGUCAGCGGCGG P.troglodytes.1 UGAAAUGGAGGAGAAAUUACAGCAAUUUAUCAACUGAAAUUAUAGGUGUAGACACAUGUCAGCAGUGG P.abelii.1 UGAAAUGGAGGAGAAAUUACAGCAAUUUAUCAACUGAAAUUAUAGGUGUAGACACAUGUCAGCAGUGG C.lupus.1 UGAAAUGGAGGAGAAAUUACAGCAAUUUAUCAACUGAAAUUAUAGGUGUAGACACAUGUCAGCGGUGC T.truncatus.1 CGAAAAGGAGGGGAAAUUACAGCAAUUCAUCAACUGAAAUUAUAGGUGUAGACACAUGUCAGCAGUGG B.taurus.1 CGAAAUGGAGGAGAAAUUACAGCAAUUCAUCAGCUGAAAUUAUAGGUGUAGACACAUGUCAGCAGUGG V.pacos.1 UGAAACAGAGGAGAAAUUACAGCAAUUCAUCAACCGAAAUGAUAGGGAUAGACAUGUGUCGGCAGUGG M.lucifugus.1 CGAAAUGGAGGAGAAAUUACAGCAAUUUAUCAACUGAAAUUAUAGGUGUAGACACAUGUCAUCCGUGG O.anatinus.1 UGAAAUGGAGGAUAAAUUACAGCAAUUUAUCAAAUGAAAUUAUAGGUGUAGACACAUGUCAGCAAUGG #=GC SS_cons <<<<<<.<<<<<<<<<<<.....>>>>>.....>><<<<<.<<<.<<<....>>>.>>>......... #=GC RF uGaaacGGaGGagaaguuAcAGcaacuuAUcAgcuGaaacuaugGGcGUAGACgCAcgucAGcaguGg G.gallus.1 AAACAGUUUCUAUCAAAAUUAAAGUAUUUAGAGAUUUUCCUCAAAUUUCA M.musculus.1 AAAUGGUUUCUAUCAAAAUUAAAGUAUUUAGAGAUUUUCCUCAAAUUUCA M.mulatta.1 AAAUAGUUUCUAUCAAAAUUAAAGUAUUUAGAGAUUUUCCUCAAAUUUCA G.gorilla.1 AAAUAGUUUCUAUCAAAAUUAAAGUAUUUAGAGAUUUUCCUCAAAUUUCA H.sapiens.1 AAAUGGUUUCUAUCAAAAUGAAAGUGUUUAGAGAUUUUCCUCAAGUUUCA P.troglodytes.1 AAAUAGUUUCUAUCAAAAUUAAAGUAUUUAGAGAUUUUCCUCAAAUUUCA P.abelii.1 AAAUAGUUUCUAUCAAAAUUAAAGUAUUUAGAGAUUUUCCUCAAAUUUCA C.lupus.1 AAACAGUUUCUAUCAAAAUUAAAGUAUUUAGAGAUUUUCCUCAAAUUUCA T.truncatus.1 GAACACUUUCUAUCAAAAUUAAAGUACUUAGCGAUUUUCCUUAAAUUUCA B.taurus.1 AAACCGUUUCUAUCAAAAUUAAAGUAUUUAGAGAUUUUCCUUAAAUUUCA V.pacos.1 AAACAGUUUCUAUCAAAAUUAAAGUAUUUAGAGACUUUCCUCAAAUUUCA M.lucifugus.1 AAACAGUUACGAUCAAAAUUAAAGUGUUUAGAGAUUUUCCUC.AAUUUUA O.anatinus.1 AAACAAUUUCUAUCAAAAUUAAAGUAUUUAGAGAUUUUCCUCAAAUUUCA #=GC SS_cons .....>>>>>....<<<<<..............>>>>>>>>>..>>>>>> #=GC RF AAAuaguuuCUAUcaaaauuAAAGUAUUUAGAGauuuuCCuCAAguuuCa // Paul Gardner Visualising RNA
  8. 8. Building an Rfam family And the Wikipedia entry Paul Gardner Visualising RNA
  9. 9. Conflicting priorities A Curator’s priorities A User’s priorities 1. New families 1. FTP (Bioinformaticians) 2. Accuracy of models 2. Website 3. Annotation 3. Visualization 4. Functional codebase 4. Number of families 5. Website 5. Accuracy of models 6. Visualization 6. Annotation Image credits: www.conflictdynamics.org Paul Gardner Visualising RNA
  10. 10. 2007: challenges Quality Control Re-write the website and add some bling Update codebase Export annotation to Wikipedia User community input via RNA Biology Paul Gardner Visualising RNA
  11. 11. Visualisation priorities SCALE Two to two million sequences, 30 to 3,000 nucleotides long, 0 to 1,000 basepairs. AUTOMATED: thousands of families. INFORMATIVE Generates biologically relevant hypotheses INCLUSIVE Make the most of our fantastic Bioinformatic & Visualisation community. Paul Gardner Visualising RNA
  12. 12. Examples Caveat: none of these images I am showing are final solutions, everything can be improved upon. Secondary Structure Alignment Taxonomic Distribution Genomic contexts & Gene Order Paul Gardner Visualising RNA
  13. 13. RNA Secondary Structure 5’ 3’ UM VH DU UA HWY A GU AG CU U U G G A a G A Y A U S C a M G A U C R U W U B C U W M U U u A G G G U U R C M C Y G C U M GU R UUCUGA g a 0 1 Sequence conservation Gardner, Bateman & Poole (2010) SnoPatrol: how many snoRNA genes are there?. Journal of Biology. Paul Gardner Visualising RNA
  14. 14. Old Taxonomic distributions: RybB Contamination displayed first. Paul Gardner Visualising RNA
  15. 15. Old Taxonomic distributions: RybB After some scrolling Paul Gardner Visualising RNA
  16. 16. New Taxonomic distributions: RybB Sunbursts: concentric “pie charts”, each external ring contains the “children” nodes of the internal ring. Paul Gardner Visualising RNA
  17. 17. Alignments When we have sequenced everything, how is this view going to look? Paul Gardner Visualising RNA
  18. 18. Genomic contexts & Gene Order How can we display comparative gene-order information in a scalable fashion? Think of hundreds to thousands of genomes, tens to hundreds of features. Barquist L, et al. (2013). A comparison of dense transposon insertion libraries in the Salmonella serovars Typhi and Typhimurium. Nucleic Acids Research. Paul Gardner Visualising RNA
  19. 19. Open problems Evolution and RNA structure Scalable, alignment visualisation (and editing) As alignments grow, we need to be able to be able to partition, compress and summarize groupings of sequences. 1,000s of sequences from the same species is not interesting to view, nor is a screen full of gaps. Expression and conservation levels Genomic context & gene-order Paul Gardner Visualising RNA
  20. 20. Thanks! The Rfam Consortium: Alex Bateman, Sean Eddy, Sam Griffiths-Jones, Sarah Burge, Eric Nawrocki, John Tate, Rob Finn, Jennifer Daub, Ruth Visualisation Tools: Eberhardt Ivo Hofacker, Yann Ponti, Jim Proctor, Ian Holmes, Irmtraud Meyer, Zasha Weinberg and many others. PPG is supported by a Rutherford Discovery Fellowship from Government funding, administered by the Royal Society of New Zealand. Paul Gardner Visualising RNA

×