Citizen Scientists

286 views

Published on

harnessing community intelligence to solve biological problems with computer games

Published in: Education, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
286
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
3
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Citizen Scientists

  1. 1. Citizen Scientists: harnessing community intelligence to solve biological problems with computer games Paul Gardner July 17, 2013 Paul Gardner Citizen Scientists: Biolive 2013
  2. 2. Today I will be presenting... How to waste a huge amount of time in (possibly) productive and potentially educational ways. Paul Gardner Citizen Scientists: Biolive 2013
  3. 3. The Intertubes in 2013... NZ’s top websites & ranks∗: 1. Facebook 3. YouTube 5. Trade Me 9. Wikipedia 13. LinkedIn 15. Blogspot 18. Twitter 19. Tumblr 22. WordPress 27. Pinterest 33. PirateBay User generated content is now the most popular sources of information and entertainment. *Alexa, July 11th , 2013 Paul Gardner Citizen Scientists: Biolive 2013
  4. 4. Crowdsourcing, citizen science & games with purpose Crowdsourcing E.g. SETI@home & Folding@home Citizen science E.g. NZ Garden Bird Survey, Katoa Metagenomics & Galaxy Zoo Games with purpose “We spend 3 billion hours a week as a planet playing videogames.” – Jane McGonigal E.g. Fold.it, Phylo & EteRNA Paul Gardner Citizen Scientists: Biolive 2013
  5. 5. Phylo: comparative genomics # STOCKHOLM 1.0 #33 unique RNA sequences, 1 peptide sequence #=GR PR1 G..A..D..V..T..H..P..P..A..G..D.. #=GR PR3 GlyAlaAspValThrHisProProAlaGlyAsp platypus GGAGCAGACGTCACTCACCCCCCAGCCGGAGAT opossum GGAGCAGATGTTACTCACCCTCCTGCTGGAGAT sloth GGAGCAGACGTCACACACCCTCCCGCGGGGGAT armadillo GGAGCAGACGTCACGCACCCTCCGGCAGGGGAT tenrec GGGGCCGACGTCACGCACCCCCCTGCGGGCGAT elephant GGAGCGGATGTCACACACCCGCCTGCGGGGGAT shrew GGCGCAGATGTCACGCATCCTCCAGCAGGGGAC hedgehog GGAGCAGATGTCACACACCCCCCAGCAGGAGAT megabat GGAGCAGATGTCACACACCCTCCTGCAGGAGAT microbat GGAGCAGATGTCACCCACCCCCCTGCAGGGGAC dog GGAGCGGATGTCACACACCCCCCAGCCGGGGAC cat GGAGCCGATGTCACGCACCCCCCAGCAGGGGAT horse GGAGCGGATGTCACACACCCTCCGGCAGGGGAT pika GGAGCAGATGTCACTCACCCTCCAGCTGGGGAT rabbit GGTGCAGATGTCACACACCCCCCAGCTGGAGAT squirrel GGAGCAGATGTCACTCACCCTCCAGCGGGAGAT guinea_pig GGAGCAGATGTCACACACCCACCAGCGGGAGAT mouse GGAGCAGATGTCACTCATCCGCCTGCTGGGGAC rat GGAGCAGATGTCACTCATCCACCTGCTGGGGAT kangaroo_rat GGAGCAGATGTTACACACCCTCCAGCAGGGGAT tree_shrew GGCGCAGACGTCACGCACCCCCCGGCCGGGGAT human GGAGCGGATGTCACACACCCCCCAGCAGGGGAT tarsier GGTGCTGATGTCACACACCCCCCTGCAGGGGAT marmoset GGAGCAGATGTCACACACCCACCAGCAGGGGAT zebrafinch GGAGCAGATGTCACTCACCCTCCCGCCGGGGAT green_anole GGGGCAGACGTCACTCACCCGCCAGCCGGGGAC xenopus GGAGCAGATGTTACACACCCACCTGCTGGTGAT pufferfish GGTGCGGATGTTACTCATCCTCCTGCTGGTGAT fugu GGGGCTGATGTTACTCACCCTCCAGCTGGTGAT stickleback GGTGCAGACGTCACACATCCTCCAGCGGGTGAT medaka GGTGCCGATGTCACTCATCCTCCTGCCGGGGAC zebrafish GGGGCAGATGTTACACACCCGCCGGCTGGTGAT lamprey GGTGCCGATGTGACACACCCTCCAGCGGGAGAC // Zhan et al. (2013) Peregrine and saker falcon genome sequences provide insights into evolution of a predatory lifestyle. Nature Genetics. Paul Gardner Citizen Scientists: Biolive 2013
  6. 6. Phylo: re-align human promoters associated with disease http://phylo.cs.mcgill.ca Nucleotides are coloured blocks Create same coloured columns, minimize gaps & mismatches Kawrykow et al. (2012) Phylo: A Citizen Science Approach for Improving Multiple Sequence Alignment. PLoS ONE Paul Gardner Citizen Scientists: Biolive 2013
  7. 7. Play! http://phylo.cs.mcgill.ca Paul Gardner Citizen Scientists: Biolive 2013
  8. 8. Phylo: teaching resource http://phylo.cs.mcgill.ca/teaching/ Paul Gardner Citizen Scientists: Biolive 2013
  9. 9. EteRNA: synthetic biology http://eterna.cmu.edu Energy model: stacked basepairs are favoured, loops are disfavoured Paul Gardner Citizen Scientists: Biolive 2013
  10. 10. Thanks! J´erˆome Waldisp¨uhl PPG is supported by a Rutherford Discovery Fellowship from Government funding, administered by the Royal Society of New Zealand. Paul Gardner Citizen Scientists: Biolive 2013

×