Phylogenomics and the diversification of microbes.

734 views

Published on

Talk by Jonathan Eisen for For U. C. Davis MCB Department Seminar Series. October 2006.

Published in: Science
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
734
On SlideShare
0
From Embeds
0
Number of Embeds
9
Actions
Shares
0
Downloads
7
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide
  • Research in my lab focuses on the mechanisms through which novelty (e.g., new functions and new processes) originates in microorganisms. In particular we make use of phylogenomic analysis (combining evolutionary reconstructions with genome sequence analyses) to study these mechanisms. The mechanisms in which I am include those that allow an existing gene to change its function (e.g., gene duplication and divergence; domain swapping) and that allow organisms to acquire functions from other species (e.g., lateral transfer and symbioses). In addition, my work examines how differences in DNA repair, replication, and recombination processes influence the ability of organisms to generate novelty. In my talk I will discuss our recent work in this area, first focusing on model cultured organisms whose genomes we are sequencing or have recently sequenced (e.g., Tetrahymena thermophila, Haloferax volcanii). Then I will discuss how phylogenomic approaches can be used to study the origin of novelty in uncultured species (e.g., symbionts and microbial communities). Finally, I will discuss our plans for future research on the origin of novelty.
  • <number>
    I am also planning to do experimental work on Tetrahymena thermophila. This species is one of the best single-celled model organisms in all eukaryotes. Studies in this species led to or helped contribute to the discovery of telomerase, the cytoskeleton, histone acetylation, catalytic RNA and many other key aspects of eukaryotic biology.
    I am interested in it for two main reasons. First, it has a very unusual genome structure with two nuclei. The micronucleus functions like human’s germ cell line and the macronucleus functions like human’s somatic cells. The macronucleus is a reduced and edited form of the micronucleus with 250 chromosomes versus the micronucleus’ five chromosomes. The mechanism underlying this editing is very poorly understood. In addition, this species is very radiation resistant.
    With the JTC we have completed shotgun sequencing of the macronuclear genome. The assemblies are excellent due to the low amount of repetitive DNA. We are working on a paper now on the genome structure and preliminary analysis and then will be working on closure and annotation.
    We have found many interesting things in the genome, including for example, hundreds of human genes that have close homologs in Tetrahymena but no homologs in yeast. We have even found some human genes with close homologs in Tetrahymena but none in Drosophila (sorry Gerry).
  • Genome sizes estimated from careful cytospectrophotometry in the 1970’s. 180 Mb = Drosophila size.
    MAC chromosome copy # exception: rDNA @ ~9,000 copies per MAC (by quantitative DNA hybridization)
    Chromosome #s:
    MIC: Direct microscopic observations (1950s)
    Quantitative measurements in stained pulsed-field gels (1980s)
  • Extension of rRNA analysis to uncultured organisms using PCR
  • <number>
    Functional prediction using a gene tree is just like predicting the biology of a species using a species tree
  • <number>
    This is a tree of a rRNA gene that was found on a large DNA fragment isolated from the Monterey Bay. This rRNA gene groups in a tree with genes from members of the gamma Proteobacteria a group that includes E. coli as well as many environmental bacteria. This rRNA phylotype has been found to be a dominant species in many ocean ecosystems.
  • <number>
    This is a tree of a rRNA gene that was found on a large DNA fragment isolated from the Monterey Bay. This rRNA gene groups in a tree with genes from members of the gamma Proteobacteria a group that includes E. coli as well as many environmental bacteria. This rRNA phylotype has been found to be a dominant species in many ocean ecosystems.
    clone from the Sargasso Sea. This shows that this
  • <number>
  • <number>
  • <number>
  • <number>
  • <number>
  • <number>
    The Wolbachia genome revealed an unexpectedly high amount of repetitive DNA and mobile genetic elements (which were never seen before in a small-genomed intracellular species)
  • <number>
  • Phylogenomics and the diversification of microbes.

    1. 1. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Phylogenomics and the Diversification of Microbes Jonathan A. Eisen October 12, 2006 MCB Seminar
    2. 2. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Outline • Introduction – Origin of novelty – Phylogenomics • Phylogenomic tales – Carboxydothermus and functional predictions – Tetrahymena and genome diversification – Mutualisic symbioses and the acquisition of function – The hidden majority and phylogenomic forensics • Conclusions
    3. 3. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Eisen Lab Research • Origin of new functions and processes – Evolution of new genes – Change in function of existing genes – Acquisition of new functions • Evolvability – What are the constraints on the origin of novelty? – Role of DNA metabolism in the origin of novelty – Variation within and between taxa
    4. 4. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Eisen Lab Model Systems • Extremophiles – How far can novelty be pushed? – Parallel origins of each extremophily allows the identification of “rules” – Many applied uses of the information • Mutualistic Symbioses – Perhaps the most straightforward mechanism for novelty to originate – Also many parallel origins allowing rules to be identified – Key role in modern life and evolutionary history
    5. 5. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. “Nothing in biology makes sense except in the light of evolution.” T. H. Dobzhansky (1973)
    6. 6. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Comparative vs. Evolutionary Approaches • Comparative approaches involve documenting similarities and differences • Evolutionary approaches involve documenting how and why the similarities and differences arose
    7. 7. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Comparative vs. Evolutionary Topic Comparative Evolutionary Structure prediction for rRNA Conserved regions Correlated changes along tree Gene presence vs. phenotpye Presence and absence of genes Gain and loss, lateral transfer Selection Degree and pattern of conservation HKA, Ds/Dn Functional prediction Ranking by level of similarity Predicting function from trees
    8. 8. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Eisen Lab Methods: Phylogenomic Analysis • Evolutionary reconstructions greatly improve genome analyses • Genome analysis greatly improves evolutionary reconstructions • There is a feedback loop such that these should be integrated
    9. 9. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Phylogenomics I: Carboxydothermus and the Prediction of Gene Function
    10. 10. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Carboxydothermus hydrogenoformans • Isolated from a Russian hotspring • Thermophile (grows at 80°C) • Anaerobic • Grows very efficiently on CO (Carbon Monoxide) • Produces hydrogen gas • Low GC Gram positive (Firmicute)
    11. 11. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Genome Completed Wu et al. 2005 PLoS Genetics 1(5): e65
    12. 12. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. CO Metabolism • Streamlined genome may contribute to efficient growth • Five homologs of CooS found in the genome • CooS and relatives are carbon monoxide dehydrogenases
    13. 13. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. CooS Homologs are Divergent Wu et al. 2005 PLoS Genetics 1(5): e65
    14. 14. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Prediction of Functions for CooSs Wu et al. 2005 PLoS Genetics 1(5): e65
    15. 15. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Evolutionary Method PHYLOGENENETIC PREDICTION OF GENE FUNCTIONIDENTIFY HOMOLOGSOVERLAY KNOWN FUNCTIONS ONTO TREE INFER LIKELY FUNCTION OF GENE(S) OF INTEREST 1234563531A2A3A1B2B3B2A1B1A3A1B2B3BALIGN SEQUENCESCALCULATE GENE TREE1246CHOOSE GENE(S) OF INTEREST2A2A53Species 3Species 1Species 211222311A3A1A2A3A1A2A3A464564562B3B1B2B3B1B2B3B ACTUAL EVOLUTION (ASSUMED TO BE UNKNOWN) Duplication?EXAMPLE AEXAMPLE BDuplication?Duplication?Duplication5 METHODAmbiguous Eisen, 1998.
    16. 16. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Phylogenetic Prediction of Function • Termed phylogenomics (Eisen, et al 1997) • Greatly improves accuracy of functional predictions compared to similarity based methods (e.g., blast) • Somewhat challenging to automate • Automated methods now available – Eddy, Brenner, Sjolander, etc. • But …
    17. 17. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Non homology functional prediction • Many genes have homologs in other species but no homologs have ever been studied experimentally • Non-homology methods can make functional predictions for these
    18. 18. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Non-Homology Predictions: Phylogenetic Profiling • Step 1: Search all genes in organisms of interest against all other genomes • Ask: Yes or No, is each gene found in each other species • Cluster genes by distribution patterns (profiles)
    19. 19. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture.
    20. 20. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Homologs of Sporulation Genes QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. Wu et al. 2005 PLoS Genetics 1(5): e65
    21. 21. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Carboxydothermus sporulates Wu et al. 2005 PLoS Genetics 1(5): e65
    22. 22. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Predicting Novel Sporulation Genes Wu et al. 2005 PLoS Genetics 1(5): e65
    23. 23. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Phylogenomics II: Tetrahymena and the Mechanisms of Diversification
    24. 24. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Tetrahymena thermophila Macronuclear Genome Project • Collaboration between TIGR (Eisen), UCSB (Orias) and Stanford (Cherry) • Shotgun sequencing of the MAC genome • Annotation and analysis • Creation of TGD, the Tetrahymena Genome Database at http://www.ciliate.org • Closure and EST sequencing under way as well • SAB made up of 15 members of the Tetrahymena research community Supported by NSF, NIGMS
    25. 25. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Tetrahymena as a Model Organism • Good genetic tools available • Relatively easy to grow and work with • Has been used for many fundamental discoveries – Telomeres and telomerase – Dynein motors – Histone acetylation – Catalytic RNA
    26. 26. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Consensus Eukaryotic Tree of Life Eisen et al. PLoS Biology 4(9): e286
    27. 27. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Tetrahymena’s two nuclear genomes Micronucleus (MIC) Germline Genome (Silent) 5 pairs of chromosomes Macronucleus (MAC) Somatic genome (Expressed) 250-300 chromosomes @ ~45 copies each 1 chromosome at > 5000 copies
    28. 28. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Genome Processing in Ciliates
    29. 29. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Mac Chosen for Shotgun Sequencing • MAC benefits – Less repetitive DNA – Site of gene expression – Assortment can be used to reduce polymorphisms • MAC drawbacks – 200+ chromosomes – Not all in equal copy numbers – Excised DNA could be interesting
    30. 30. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Evolution and Genome Processing • Probably exists as a defense mechanism • Analogous to RIPPING and heterochromatin silencing • Presence of repetitive DNA in MAC but not TEs suggests the mechanism involves targeting foreign DNA • Thus unlike RIPPING ciliate processing does not limit diversification by duplication
    31. 31. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Lineage Specific Duplications
    32. 32. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Lineage Specific Gene Family Expansions • Lineage specific expansions frequently associated with adaptive evolution • Most large expansions in T. thermophila are in families with roles in sensing and responding to environment – Signal transduction – Transport – Proteolysis – Cytoskeletal structure and function
    33. 33. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Transporter Expansion in T. thermophila Comparisons of major transporter families in Tetrahymena and other eukaryotes 0 50 100 150 200 250 300 350 T. thermophila H. sapiens A. thaliana D. melanogaster C. elegans N. crassa S. cerevisiae S. pombe E. cuniculi P. falciparum ABC MFS VIC P-ATPase
    34. 34. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Even Tubulins are Expanded
    35. 35. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Phylogenomics III: The Hidden Majority and Microbial Forensics
    36. 36. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Great Plate Count Anomaly Culturing Microscope CountCount
    37. 37. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Great Plate Count Anomaly Culturing Microscope CountCount <<<<
    38. 38. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Who is Out There? rRNA PCR and the Uncultured QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. Phylotyping Diversity Indices Bohannan and Hughes 2003 Hugenholtz 2002
    39. 39. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. rRNA: A Phylogenetic Anchor to Determine Who’s Out There Eisen et al. 1992 Biology not similar enough
    40. 40. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. What are they Doing? rRNA Anchors and Metagenomics Beja et al. 2000
    41. 41. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Limits of Large Insert Approach • Large insert libraries less random and less representative than small inserts • Lower throughput • Requires some thinking
    42. 42. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. shotgunshotgun sequencesequence Warner Brothers, Inc.Warner Brothers, Inc. The Final Frontier Environmental Shotgun Sequencing
    43. 43. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Who is Out There?
    44. 44. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. rRNA Phylotyping in Sargasso Sea Metagenomic Data Venter et al., 2004
    45. 45. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. GSSEA rRNA Phylotypes 0 5 10 15 20 25 30 35 Unclassified AcidobacteriaActinobacteria CFB Group Cyanobacteria Firmicutes OP11 Planctomyces Proteobacteria-unassigned Proteobacteria-AlphaProteobacteria-BetaProteobacteria-Delta Proteobacteria-Gamma Thermomicrobia Phylogenetic group % of Clones Venter et al., 2004
    46. 46. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Shotgun Sequencing Allows Use of Alternative Anchors (e.g., RecA) Venter et al., 2004
    47. 47. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Sargasso Phylotypes 0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 0.45 0.5 AlphaproteobacteriaBetaproteobacteria GammaproteobacteriaEpsilonproteobacteria Deltaproteobacteria Cyanobacteria Firmicutes Actinobacteria Chlorobi CFB Chloroflexi SpirochaetesFusobacteria Deinococcus-Thermus EuryarchaeotaCrenarchaeota Major Phylogenetic Group Weighted % of Clones EFG EFTu HSP70 RecA RpoB rRNA Other Markers Give Similar Phylotpyes Venter et al., 2004
    48. 48. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. What Are They Doing?
    49. 49. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Diversity of Proteorhodopsins by Metagenomics Venter et al., 2004
    50. 50. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Linking Who and What is Still Challenging With Metagenomic Data
    51. 51. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Phylogenomics IV: Symbioses and the Acquisition of Function Symbionts as model metagenomic systems
    52. 52. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Endosymbioses Drove Eukaryotic Evolution QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture.
    53. 53. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Wolbachia pipientis wMel • Wolbachia are obligate, maternally transmitted intracellular symbionts • Wolbachia infect many invertebrate species – Many cause male specific deleterious effects – Model system for studying sex ratio changes in hosts – Some are mutualistic (e.g., in filarial nematodes) • wMel selected as model system because it infects Drosophila melanogaster
    54. 54. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Wolbachia Metagenomic Sequencing shotgunshotgun sequencesequence QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. Analysis led by Matin Wu in collaboration with lab of Scott O’Neill
    55. 55. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture.
    56. 56. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture.
    57. 57. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture.
    58. 58. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture.
    59. 59. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Completed Genome Allows Detailed Analysis of Uncultured Species Wu et al., PLoS Biology 2004
    60. 60. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. alanine/glycine Na+ alanine/glycine Na+ alanine/glycine Na+ proline/betaine H+ proline/betaine H+WD0168 WD0414 WD1046 WD1047 WD0330 Na+ glutamate/aspartate Na+ WD0211 WD0229 glutamate/aspartate ornithine putrescine WD0957 H+ Na+ H+ Na+ WD0316 WD0407 H+ WD1107 WD1299 WD1300 WD1391 WD0816 WD0765 Mg2+ WD0375 H+ Zn2+ /Cd2+ WD1042 ATPADP Zn2+ WD0362 WD0938 WD0937 ATPADP Fe3+ WD1136 WD0153 WD0897 glycerol-3-phosphate/ hexose-6-phosphate phosphate WD0619 H+ drugs H+ drugs WD0056 WD0248 H+ drugs H+ drugs WD1320 WD0384 H+ ? H+ ? WD0621 WD0099 H+ metabolite? WD0470 H+ metabolite? WD1033 H+WD0249 metabolite? ATPADP heme WD0411 WD1093 WD0340 K+ WD1249 Na+ H+ drugs ATP ADP WD0400 phosphate ATPADP ORF00100 ORF00714 ORF00927 ORF00940 (2?) H+ F-type ATPase ATP ADP WD1233 WD0203 WD0204 WD0427 WD0428 WD0429 WD0655 WD0656 phosphoenolpyruvate 1,3-bisphosphoglycerate 3-phosphoglycerate 2-phosphoglycerate pyruvate acetyl-CoA citrate isocitrate oxaloacetate suc-CoAsuccinate fumarate malate oxaloacetate TCA CYCLE glyceraldehyde-3P fructose-1,6-P2 dihydroxyacetone-P WD1238 WD0091 WD0451 WD1167 WD0868 WD0494 WD0690 WD0105 WD0791 WD1309 WD0544 WD0751 WD1209 WD1210 WD0437 WD0727 WD1221 WD1222 WD0492 WD1121 mannose-1P mannose-6P WD0695 MALATEWD0488 WD1177 WD0416 WD0473 WD0751 WD0325 Non-oxidative Pentose Phosphate Pathway xylulose-5P glyceraldehyde-3P sedoheptulose-7P fructose-6P ribose-5P ribulose-5P glyceraldehyde-3P WD0551 WD0387 WD0387 WD0712 erythrose-4P WD1151 glycerol-3P WD0731 Amino Acid catabolism GLUTAMATE glutamine WD1322 GLUTAMINE glutamateWD0535 CYSTEINE alanine WD0997 THREONINE glycine WD0617,WD0617 PROLINE glutamate WD0103 SERINE glycineWD1035 Fatty Acid Biosynthesis WD0985, WD0650, WD1083, WD1170, WD0085 PRPP WD0036 Thiamine metabolismWD1109,WD0763,WD0029,WD0913,WD1018,WD1024 AMP,ADP,dAMP, dADP,ATP,dATP,ITP, dITP,IMP,XMP,GMP,GDP,dGDP,dGTP,dGMP WD1142 WD1305 WD1023 WD0786 WD0867 WD0337 WD0786 WD0661 WD1183 WD0197 WD0089 WD0195 WD0439 WD0197 adenylosuccinate WD0786 Purine Metabolism UMP UDP WD0684 WD1295 WD0895 WD0230 WD1239 WD0228 WD0461 aspartate semialdehydeaspartateWD1029 WD0960 WD0954
    61. 61. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Mitochondrial Origin Unresolved
    62. 62. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Wolbachia Evolutionary Rate is Accelerated
    63. 63. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Endosymbiont Trends • Compared to free-living relatives – Smaller genomes – Lower GC content – Higher pIs – Higher rates of sequence evolution • Wolbachia shows ALL of these
    64. 64. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Explanations for Endosymbiont Differences with Free-Living Relatives • Repair hypothesis – Loss of DNA repair genes leads to increased mutation rate – Trends are the direct and indirect result of this increased mutation rate • Population genetics hypothesis – Smaller effective population size leads to more genetic drift – Trends are mostly the result of accumulation of slightly deleterious mutations • PopGen explanations favored – Wolbachia has full suite of repair genes
    65. 65. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Endosymbiont Trends • Compared to free-living relatives – Smaller genomes – Lower GC content – Higher pIs – Higher rates of sequence evolution • Wolbachia shows ALL of these • However ….
    66. 66. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Wolbachia Overrun by Mobile Elements Repeat Class Size (Median) Copies Protein motifs/families IS Family Possible Terminal Inverted Repeat Sequence 1 1512 3 Transposase IS4 5’ ATACGCGTCAAGTTAAG 3’ 2 360 12 - New 5’ GGCTTTGTTGCATCGCTA 3’ 3 858 9 Transposase IS492/IS110 5’ GGCTTTGTTGCAT 3’ 4 1404.5 4 Conserved hypothetical, phage terminase New 5’ ATACCGCGAWTSAWTCGCGGTAT 3’ 5 1212 15 Transposase IS3 5’ TGACCTTACCCAGAAAAAGTGGAGAGAAAG 3’ 6 948 13 Transposase IS5 5’ AGAGGTTGTCCGGAAACAAGTAAA 3’ 7 2405.5 8 RT/maturase - 8 468 45 - - 9 817 3 conserved hypothetical, transposase ISBt12 10 238 2 ExoD - 11 225 2 RT/maturase - 12 1263 4 Transposase ??? 13 572.5 2 Transposase ??? None detected 14 433 2 Ankyrin - 15 201 2 - - 16 1400 6 RT/maturase - 17 721 2 transposase IS630 18 1191.5 2 EF-Tu - 19 230 2 hypothetical - Wu et al. 2004
    67. 67. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture.
    68. 68. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Wu et al. PLoS Biology 2006 Glassy Winged Sharpshooter Symbiont • Vector for Pierce’s disease in grapes • Potential bioterror agent • Feeds on nutrient poor xylem sap • Needs to get amino- acids and other nutrients from symbionts like aphids
    69. 69. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Sharpshooter Shotgun Sequencing shotgunshotgun sequencesequence
    70. 70. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture.
    71. 71. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture.
    72. 72. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. 400,000 100,000 200,000 300,000 500,000 600,000 1
    73. 73. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Higher Evolutionary Rates in Clade
    74. 74. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Endosymbiont Trends • Compared to free-living relatives – Smaller genomes – Lower GC content – Higher pIs – Higher rates of sequence evolution • Baumannia shows ALL of these
    75. 75. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Explanations for Endosymbiont Differences with Free-Living Relatives • Repair hypothesis • Population genetics hypothesis • PopGen explanations favored
    76. 76. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Variation in Evolution Rates Correlated with Repair Gene Presence MutS MutL + + + + + + + + _ _ _ _
    77. 77. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Explanations for Endosymbiont Differences with Each Other • Repair hypothesis • Population genetics hypothesis • Repair explanations favored
    78. 78. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Polymorphisms in Metapopulation • Data from ~200 hosts – 104 SNPs – 2 indels • PCR surveys show that this is between host variation • Much lower ratio of transitions:transversions than in Blochmannia • Consistent with absence of MMR from Blochmannia
    79. 79. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Baumannia Predicted Metabolism
    80. 80. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. No Amino-Acid Synthesis
    81. 81. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. ???????
    82. 82. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Binning by Phylogeny • Identified putative genes • Built phylogenetic trees of genes • Examined and classified trees
    83. 83. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Binning by Phylogeny • Four main “phylotypes” – Gamma proteobacteria (Baumannia) – Arthropoda (sharpshooter) – Bacteroidetes (Sulcia) – Alpha-proteobacteria (Wolbachia)
    84. 84. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Binning by Phylogeny • Four main “phylotypes” – Gamma proteobacteria (Baumannia) – Arthropoda (sharpshooter) – Bacteroidetes (Sulcia) - only a.a. genes here – Alpha-proteobacteria (Wolbachia)
    85. 85. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. But …. • Key questions unresolved – Was the pre-organelle ancestor free-living? – What the ancestor a mutualist? a parasite? – What happened early in the evolution of the symbiosis? • The problems with organelles – Symbioses were so long ago that it is nearly impossible to figure out what the early events were. – May represent frozen accidents • Solution? – Study more recent and more diverse symbioses
    86. 86. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Symbionts as a model for studying uncultured microbes
    87. 87. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Finished 130 kb of Sulcia
    88. 88. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Co-Symbiosis?
    89. 89. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture.
    90. 90. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. A B C D E F G T U V W X Y Z Binning in More Complex Systems?
    91. 91. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Venter et al., 2004
    92. 92. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Acidobacteria Bacteroides Fibrobacteres Gemmimonas Verrucomicrobia Planctomycetes Chloroflexi Proteobacteria Chlorobi Firmicutes Fusobacteria Actinobacteria Cyanobacteria Chlamydia Spriochaetes Deinococcus-Thermus Aquificae Thermotogae TM6 OS-K Termite Group OP8 Marine GroupA WS3 OP9 NKB19 OP3 OP10 TM7 OP1 OP11 Nitrospira Synergistes Deferribacteres Thermudesulfobacteria Chrysiogenetes Thermomicrobia Dictyoglomus Coprothmermobacter • At least 40 phyla of bacteria
    93. 93. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Acidobacteria Bacteroides Fibrobacteres Gemmimonas Verrucomicrobia Planctomycetes Chloroflexi Proteobacteria Chlorobi Firmicutes Fusobacteria Actinobacteria Cyanobacteria Chlamydia Spriochaetes Deinococcus-Thermus Aquificae Thermotogae TM6 OS-K Termite Group OP8 Marine GroupA WS3 OP9 NKB19 OP3 OP10 TM7 OP1 OP11 Nitrospira Synergistes Deferribacteres Thermudesulfobacteria Chrysiogenetes Thermomicrobia Dictyoglomus Coprothmermobacter • At least 40 phyla of bacteria • Genome sequences are mostly from three phyla
    94. 94. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Acidobacteria Bacteroides Fibrobacteres Gemmimonas Verrucomicrobia Planctomycetes Chloroflexi Proteobacteria Chlorobi Firmicutes Fusobacteria Actinobacteria Cyanobacteria Chlamydia Spriochaetes Deinococcus-Thermus Aquificae Thermotogae TM6 OS-K Termite Group OP8 Marine GroupA WS3 OP9 NKB19 OP3 OP10 TM7 OP1 OP11 Nitrospira Synergistes Deferribacteres Thermudesulfobacteria Chrysiogenetes Thermomicrobia Dictyoglomus Coprothmermobacter • At least 40 phyla of bacteria • Genome sequences are mostly from three phyla • Some other phyla are only sparsely sampled
    95. 95. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Acidobacteria Bacteroides Fibrobacteres Gemmimonas Verrucomicrobia Planctomycetes Chloroflexi Proteobacteria Chlorobi Firmicutes Fusobacteria Actinobacteria Cyanobacteria Chlamydia Spriochaetes Deinococcus-Thermus Aquificae Thermotogae TM6 OS-K Termite Group OP8 Marine GroupA WS3 OP9 NKB19 OP3 OP10 TM7 OP1 OP11 Nitrospira Synergistes Deferribacteres Thermudesulfobacteria Chrysiogenetes Thermomicrobia Dictyoglomus Coprothmermobacter • At least 40 phyla of bacteria • Genome sequences are mostly from three phyla • Some other phyla are only sparsely sampled • Solution: sequence more phyla
    96. 96. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. What is Next? • More endosymbioses – Diversity of host species – Diversity of symbionts – Diversity of biology • Epibionts and other obligate symbioses • Commensals – Human gut – Hotspring mats
    97. 97. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. TIGRTIGR Other peopleOther people Mom and DadMom and Dad H. OchmanH. OchmanF. RobbF. Robb J. BattistaJ. Battista E. OriasE. Orias D. BryantD. Bryant S. O’NeillS. O’Neill M. EisenM. Eisen N. MoranN. Moran R. MyersR. Myers C. M. CavanaughC. M. Cavanaugh P. HanawaltP. Hanawalt J. HeidelbergJ. Heidelberg N. WardN. Ward J. VenterJ. Venter C. FraseC. Fraser S. SalzbergS. Salzberg I. PaulsenI. Paulsen $$$$$$ NSFNSF DOEDOE NIHNIH M. WuM. Wu D. WuD. Wu S. ChatterjiS. Chatterji H. HuseH. Huse A. HartmanA. Hartman MooreMoore VIVI D. RuschD. Rusch A. HalpernA. Halpern EisenEisen GroupGroup J. MorganJ. Morgan JGIJGI E. EisenstadtE. Eisenstadt M. FrazierM. Frazier T. WoykeT. Woyke E. RubinE. Rubin

    ×