Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Genética, Genómica y Psiquiatría

4,815 views

Published on

Instituto Nacional de Psiquiatría
Ramón de la Fuente Muñiz
Videoconferencia
Genética, Genómica y Psiquiatría
Ponente:Dr. Carlos Cruz Fuentes
Fecha: 03-Febrero-2010

Published in: Health & Medicine
  • Be the first to comment

Genética, Genómica y Psiquiatría

  1. 1. Gen ética, Genómica y Psiquiatría Dr. Carlos Cruz Fuentes Departamento de Genética Psiquiátrica, División de Investigaciones Clínicas, Instituto Nacional de Psiquiatría “ Ramón de la Fuente Muñiz” [email_address]
  2. 2. ¿ Psiquiatr ía? Rama de la Medicina. Dedicada al diagn óstico, tratamiento, prevenci ón de los trastornos mentales.
  3. 4. ¿Que causa Trastornos Psiqui átricos ? . Factores : PsicoSociales PsicoBiol ógicos
  4. 5. Mente- cerebro Los procesos mentales tienen una relación íntima con diferentes procesos neurobiológicos .
  5. 6. ¿ Gen ética? Disciplina de la Biolog ía Ciencia de los genes , de la herencia y de la variabilidad de los individuos de especie.
  6. 7. ¿ Gen ómica? Estudio del genoma de los organismos
  7. 8. http://www.ornl.goc/hgmis <ul><li>“ ... el conocimiento exacto de la estructura del DNA permitirá aplicar este al desarrollo de nuevas formas para diagnosticar, tratar y posiblemente algún día prevenir las miles de enfermedades que nos afectan . Además permitirá obtener pistas para entender la biología humana así como también de organismos no humanos. Por otra parte el entender la información impresa en la secuencia del DNA permitirá tener un mejor entendimiento de sus capacidades naturales que podrán ser aplicadas para tratar de resolver problemas en los campos de la salud, la energía, la agricultura y el medio ambiente .” </li></ul>
  8. 9. ¿De donde viene la idea de que las enfermedades mentales se heredan? <ul><li>Estudios en familias, en gemelos y en sujetos dados en adopción, apoyan la existencia de un componente genético asociado y heredable para los principales problemas mentales. </li></ul>
  9. 10. Modelo de labilidad a una enfermedad
  10. 11. Labilidad individual desarrollar el trastorno Li = a(Ai) + c(Ci) + e(Ei) FACTORES GENETICOS a FACTORES AMBIENTALES COMUNES c FACTORES AMBIENTALES ESPECIFICOS e Labilidad individual desarrollar el trastorno Li = a(Ai) + c(Ci) + e(Ei)
  11. 12. Estimados de heredabilidad para algunos trastornos psiquiátricos
  12. 13. ¡ Heredabilidad ! <ul><li>Los trastornos psiquiátricos poseen un componente genético considerable </li></ul>
  13. 14. ¡ Heredabilidad ! <ul><li>¡ A la b úsqueda de los genes ! </li></ul>
  14. 16. Fragmento de la secuencia de información del Genoma Humano Genoma humano = 3,200, 000 ,000 de pares de bases 25,000 genes aprox.
  15. 18. ¿Cómo identificar los genes involucrados ? <ul><li>Estrategias </li></ul><ul><li>Estudios de linkage </li></ul><ul><li>Estudios de asociación con genes candidatos </li></ul><ul><li>Estudios de desequilibrio de enlace </li></ul>
  16. 19. Variabilidad genética humana 99.9 % de la secuencia de información genética es idéntica entre los seres humanos
  17. 20. Individualidad genética humana 0.1 % de la información genética es específica para cada sujeto de una población dada
  18. 21. Variabilidad genética en la secuencia de información de un gen alelo T alelo C TT T C CC
  19. 22. MspI TT T C CC
  20. 23. Estudios de linkage
  21. 25. Genética Molecular de algunos trastornos psiquiátricos : Evidencias de ligamiento genético <ul><li>Esquizofrenia : 1p , 5q, 6p, 8p, 10p, 13q , 18p y 22q. </li></ul><ul><li>Bipolar: 4p , 6p, 16p, 12q , 13q, 18p , 18q, 21q, y 22q, Xq </li></ul><ul><li>Autismo 6q, 7q </li></ul><ul><li>Dependencia al alcohol: 1, 7 </li></ul><ul><li>Enfermedad de Alzheimer 21, 1, 14 , 19 </li></ul>
  22. 26. Trastornos complejos <ul><li>Herencia no mendeliana </li></ul><ul><li>Penetrancia reducida </li></ul><ul><li>Expresividad variable </li></ul><ul><li>Fenocopias </li></ul><ul><li>Heterogeneidad genética </li></ul>
  23. 27. Estudios de asociación
  24. 28. Genes candidatos
  25. 29. Isoformas Apolipoproteína E E2 E4 E3 Cys Cys Cys Arg Ar g Arg Codón 112 Cys Codón 158 Arg U GU C GU U GC C GC
  26. 30. <ul><li>La frecuencia del alelo  4 fue significativamente mayor en la población de ancianos del Hospital Español que presentaban demencia que en los sujetos no demenciados . </li></ul>Análisis gene ApoE Hospital Español
  27. 31. ApoE Efecto de carga genética 0 1 2
  28. 32. Genética Molecular de algunos trastornos psiquiátricos : Evidencias de estudios de asociación con genes candidatos <ul><li>Alzheimer tardío: APOE </li></ul><ul><li>Esquizofrenia: Neuroregulina, sinapsina 1 </li></ul><ul><li>Bipolar/depresión: 5HTT </li></ul><ul><li>TDAH: DAT, DRD4 </li></ul>
  29. 33. Matsumoto et al. , 1995, Asherson y Curran, 2001, Ding et al. , 2002, Grady et al. , 2003, D´Souza et al. , 2004, Wang et al. , 2004 Ejemplo de la secuencia de 4 repetidas (4R) de 48pb: haplotipo 1-2-3-4 … CGCCTTCCCCCACGCC 1R ACCCGCGCCC CGCCTCCCCC AGGACCCCTG CGGCCCCGAC TGTGCGCC 2R CCCCGCGCCC GGCCTTCCCC GGGGTCCCTG CGGCCCCGAC TGTGCGCC 3R GCCGCGCCCA GCCTCCCCCA GGACCCCTGT GGCCCCGACT GTGCGCCC 4R CCCGCGCCCG GCCTCCCCCC GGACCCCTGC GGCTCCAACT GTGCTCC C CCCGACGCCGTAGAGCCGCCGCGCTCCCACCCCAGACTCCACCGCAGACCCGCAGAGGCGGCGTGCCAAATCACCGGCCGGGAGCGCAAGGCATGAGGGGTCT Estructura del gen DRD4 humano (Chr 11p15.5), con énfasis en la región VNTR del exón 3 2-11 2 R = 9% 4 R = 65% 7 R = 19% Exón 1 Exón 2 Exón 4 Exón 3
  30. 34. Asociaciones positivas del gen DRD4 exon 3 VNTR con trastornos psiqui átricos <ul><li>S índrome Gilles de la Tourette </li></ul><ul><li>Esquizofrenia </li></ul><ul><li>Trastorno por déficit de atención (hiperactividad) </li></ul>
  31. 35. Asociaciones positivas del gen DRD4 exon 3 VNTR con trastornos psiqui átricos (lab Genética INPRF) <ul><li>Trastorno Obsesivo Compulsivo con tics </li></ul><ul><li>Trastornos Psic óticos (esquizofrenia) </li></ul><ul><li>Trastorno por déficit de atención (hiperactividad) </li></ul>
  32. 36. Asociaciones positivas del gen DRD4 exon 3 VNTR con rasgos, s íntomas , conductas <ul><li>B úsqueda de Novedades ( Novelty seeking) </li></ul><ul><li>Extraversi ón </li></ul><ul><li>Atención </li></ul><ul><li>Sedentarismo vs. Nomadismo </li></ul><ul><li>Conducta sexual </li></ul>
  33. 37. ¿Existen los genes de los trastornos mentales? <ul><li>R = No! </li></ul>
  34. 38. ¿Existen los genes de los trastornos mentales? <ul><li>M ás probable que existan genes asociados a endofenotipos: </li></ul><ul><li>Fenotipos intermedios heredables </li></ul>
  35. 39. Ejemplos endofenotipos en Psiquiatr ía : <ul><li>Movimientos sac ádicos ; esquizofrenia </li></ul><ul><li>Alteraciones en potenciales evocados :esquizofrenia </li></ul><ul><li>Susceptibilidad efectos intoxicantes del alcohol </li></ul><ul><li>Rasgos de Personalidad </li></ul>
  36. 42. 1990-2008.
  37. 43. Genes vs crianza Genes y crianza
  38. 44. <ul><li>Influencia del estrés en la depresión: Moderación por un polimorfismo en el gen del transportador de serotonina. </li></ul><ul><li>Caspi A, Sugden K, Moffitt, TE, y cols. </li></ul><ul><li>Science, Jul 2003;386-389. </li></ul>
  39. 45. 1037 niños 847 (96%) 3 años 26 años 5 7 9 11 13 15 18 21
  40. 46. Depresi ón, crianza, genética
  41. 48. Modelo del desarrollo Esquizofrenia
  42. 49. La era “gen ómica” de la Psiquiatría <ul><li>… I am confident that during the upcoming years the heritage of the double helix will help psychiatrists,neuroscientists, and behavioral scientists unlock many secrets of the mind and brain. Although challenging because of their genetic complexity, mental illnesses are among the most important diseases to be studied with the tools of molecular biology. </li></ul><ul><li>James Watson Am J Psychiatry 160;4, 2003 </li></ul>
  43. 51. La era “gen ómica” de la Psiquiatría <ul><li>“ ·….. The “genomic era” is about much more than “finding genes.” It is about understanding how they get turned on, or turned off. It is about examining the complex interactions between genes and the huge array of nongenetic factors that influence their effects. It is about our capacity as scientists and clinicians to improve diagnosis, treatment, and, ultimately, prevention…..” </li></ul><ul><li>Nancy Andreasen </li></ul><ul><li>Am J. Psychiatry 160;4, 2003 </li></ul>
  44. 52. La era “gen ómica” de la Psiquiatría en México <ul><li>Curso Gen ómica y Psiquiatría (INPRF) </li></ul><ul><li>Maestría en Ciencias Médicas UNAM ( Psiquiatría) Curso de Biología Molecular </li></ul><ul><li>Curso de Alta Especialidad (UNAM) </li></ul>
  45. 53. Farmacogenética: Predicción de la respuesta de un paciente a un medicamento particular
  46. 54. Farmacogenética de antipsicóticos.
  47. 55. Expert Review of Molecular Diagnostics May 2006, Vol. 6, No. 3, Pages 277-286 (doi:10.1586/14737159.6.3.277) AmpliChip CYP450 Test: personalized medicine has arrived in psychiatry Jose de Le ó n MD The US FDA has granted market approval for the first pharmacogenetic test using a DNA microarray, the AmpliChip CYP450, which genotypes cytochrome P450 (CYP)2D6 and CYP2C19. The test uses software to predict phenotypes and tests for 27 CYP2D6 alleles, including the deletions and duplications, and three CYP2C19 alleles. Other DNA microarray platforms are being developed for CYP testing, but none have been completely developed or approved by the FDA to date. The differences between an implementation of pharmacogenetic tests centered on the individual and implementation using a public health approach are discussed. In this review, the major obstacles to the wide implementation of pharmacogenetic testing in the clinical environment are summarized.
  48. 57. Genética y alcoholismo: gene al receptor a dopamina D2 <ul><li>Asociación alélica entre alelo A1 y alcoholismo (Blum et al, 1990), “Gene del alcoholismo”. </li></ul><ul><li>Relación con severidad, P300 en hijos de padres alcohólicos, respuesta farmacológica a apetencia (craving) y ansiedad (Noble et al., 1996; Blum et al., 1996) </li></ul>
  49. 58. La densidad de receptores tipo D2 a dopamina en diferentes regiones del cerebro se modifica en relación al genotipo molecular del sistema TaqIA Lapohañieen et al1998 Johnsson et al, 1998) +A1 -A1
  50. 59. La era “gen ómica” de la Psiquiatría
  51. 60. La era “gen ómica” de la Psiquiatría

×