Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
ΕΠΑΝΑΛΗΨΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΗΣΗΣΑΣΚΗΣΗΈνα νουκλεϊκό οξύ συνίσταται από 100.000.000 νουκλεοτίδια.      α) Πόσες αζωτούχε...
ΑΣΚΗΣΗΣε ένα μόριο DNA υπάρχουν 10.000 άτομα φωσφόρου. Το μόριο αυτόμεταφέρεται και διπλασιάζεται σε περιβάλλον ραδιενεργο...
κωδικοποιεί τη μία από τις δυο πολυπεπτιδικές αλυσίδες μιας πρωτεΐνης.    Πόσα αμινοξέα αποτελούν την πρωτεΐνη αυτή;ΑΣΚΗΣΗ...
a. Ποιο είναι το προϊόν της δράσης της ECORI ;             b. Πόσοι φωσφωδιεστερικοί δεσμοί      διασπάστηκαν   και   πόσο...
1:1:ΑΣΚΗΣΗΣτο έντομο Drosophila melanogaster οι χαρακτήρες χρώμαματιών και σχήμα πτερύγων είναι μονογονιδιακοί και ελέγχον...
προσδιορίσετε την πιθανότητα στην δεύτερη θυγατρική γενιά      να προκύψει άτομο με άσπρα μάτια και ίσιες πτέρυγες.ΑΚΗΣΗΜι...
ΑΣΚΗΣΗΈνας γενετιστής ανίχνευσε σημειακή μεταλλαγή και προκειμένουνα ερευνήσει τις επιπτώσεις της στους ζωντανούς οργανισμ...
η οποία είναι τοξική για το βακτήριο. Πώς μπορούμε να επιλέξουμε ταμετασχηματισμένα βακτήρια που δέχτηκαν το ανασυνδυασμέν...
ΑΣΚΗΣΗΠώς θα μεταβληθεί η καμπύλη που δείχνει τις φάσεις μια κλειστήςκαλλιέργειας  1. Αν αυξηθεί το θρεπτικό υλικό  2. Αν ...
Upcoming SlideShare
Loading in …5
×

επανάληψη στη Βιολογία Γ κατεύθυνσης

Related Audiobooks

Free with a 30 day trial from Scribd

See all
  • Be the first to comment

  • Be the first to like this

επανάληψη στη Βιολογία Γ κατεύθυνσης

  1. 1. ΕΠΑΝΑΛΗΨΗ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΗΣΗΣΑΣΚΗΣΗΈνα νουκλεϊκό οξύ συνίσταται από 100.000.000 νουκλεοτίδια. α) Πόσες αζωτούχες βάσεις, πεντόζες και φωσφορικές ομάδες περιέχει; β) Πόσους φωσφοδιεστερικούς δεσμούς περιέχει; γ) Πόσες ελεύθερες φωσφορικές ομάδες διαθέτει; δ) Αν η κυτοσίνη αποτελεί το 10% των αζωτούχων βάσεων, ποιο είναι το ποσοστό και το πλήθος των άλλων αζωτούχων βάσεων;ΑΣΚΗΣΗΣε ένα δίκλωνο μόριο DNA βρέθηκαν 2 · 107 Α και 8 · 107 φωσφοδιεστερικοίδεσμοί. Πόσα είναι τα νουκλεοτίδια και οι δεσμοί υδρογόνου που περιέχει;ΑΣΚΗΣΗΣε ένα μόριο DNA από κύτταρο εντοπίστηκαν 55.000.000 φωσφοδιεστερικοίδεσμοί και 65.000.000 δεσμοί υδρογόνου. Ποιο είναι το πλήθος καθεμιάς απότις αζωτούχες βάσεις; 1
  2. 2. ΑΣΚΗΣΗΣε ένα μόριο DNA υπάρχουν 10.000 άτομα φωσφόρου. Το μόριο αυτόμεταφέρεται και διπλασιάζεται σε περιβάλλον ραδιενεργού φωσφόρου. Πόσαάτομα ραδιενεργού φωσφόρου θα υπάρχουν μετά τον πρώτο και πόσα μετά τοντρίτο διπλασιασμό ; Εξηγήστε την απάντηση σας .ΑΣΚΗΣΗΈνα μόριο βακτηριακού DNA έχει την παρακάτω ακολουθία: -TACCCAGGTCTCGACCCATAGTGTGACATTCACTTCCTG- -ATGGGTCCAGAGCTGGGTATCACACTGTAAGTGAAGGAC-Αν είναι γνωστό ότι μια αλυσίδα δίνει λειτουργικό προϊόν (πρωτεΐνη) να βρείτε: α) Ποια αλυσίδα είναι η κωδική και ποια η μεταγραφόμενη β) Την αλληλουχία των βάσεων στο mRNA που παράγεται γ) Από πόσα αμινοξέα αποτελείται η πρωτεΐνη που παράγεται δ) Πόσοι δεσμοί πεπτιδικοί συγκρατούν την πρωτεΐνη αυτήΑΣΚΗΣΗΔυο γονίδια ευκαρυωτικού κυττάρου συνίστανται συνολικά από 6000 νουκλεοτίδια. Οι αμετάφραστες περιοχές τους και τα εσώνιά τους αποτελούν το 50% του μήκους τους. Το καθένα από τα γονίδια αυτά 2
  3. 3. κωδικοποιεί τη μία από τις δυο πολυπεπτιδικές αλυσίδες μιας πρωτεΐνης. Πόσα αμινοξέα αποτελούν την πρωτεΐνη αυτή;ΑΣΚΗΣΗΠόσα μόρια DNA θα προκύψουν από κόψιμο με ECOR I … A. Ενός δίκλωνου γραμμικού μορίου το οποίο φέρει μία θέση αναγνώρισης για το ένζυμο; B. Ενός δίκλωνου γραμμικού μορίου το οποίο φέρει δύο θέσεις αναγνώρισης για το ένζυμο; C. Ενός πλασμιδίου το οποίο φέρει μια θέση αναγνώρισης για το ένζυμο; D. Ενός πλασμιδίου το οποίο φέρει δύο θέσεις αναγνώρισης για το ένζυμο;ΑΣΚΗΣΗ Το τμήμα του DNA που φαίνεται παρακάτω εισάγεται σε βακτήριο E. Coli 5’ GAAGAATTCGGCAATGAATTCAGTGAATTCAA 3’ 3’ CTTCTTAAGCCGTTACTTAAGTCACTTAAGTT 5’ 3
  4. 4. a. Ποιο είναι το προϊόν της δράσης της ECORI ; b. Πόσοι φωσφωδιεστερικοί δεσμοί διασπάστηκαν και πόσοι δεσμοί Υδρογόνου καταστράφηκαν;Αν θέλουμε να κλωνοποιήσουμε τα παραγόμενα τμήματα DNA πόσα πλασμίδιαπρέπει να χρησιμοποιήσουμε;ΑΣΚΗΣΗ Ένα πλασμίδιο που χρησιμοποιείται ως φορέας κλωνοποίησης για την κατασκευή μιας γονιδιωματικής βιβλιοθήκης διαθέτει το γονίδιο ανθεκτικότητας στην αμπικιλίνη και την τετρακυκλίνη. Η μοναδική θέση αναγνώρισης από την ECO RI εμπεριέχεται στο γονίδιο της τετρακυκλίνης, το οποίο κωδικοποιεί μια πρωτεΐνη η οποία είναι τοξική για το βακτήριο. Πώς μπορούμε να επιλέξουμε τα μετασχηματισμένα βακτήρια που δέχτηκαν το ανασυνδυασμένο πλασμίδιο;Να συμπηρώσετε το πινακάκι ΤΡΟΠΟΣ ΑΝΑΛΟΓΙΑ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑΣ 3:1 9:3:3:1 1:2:1 4
  5. 5. 1:1:ΑΣΚΗΣΗΣτο έντομο Drosophila melanogaster οι χαρακτήρες χρώμαματιών και σχήμα πτερύγων είναι μονογονιδιακοί και ελέγχονταιαπό γονίδια που το κάθε ένα έχει δύο αλληλόμορφα.Από την διασταύρωση θηλυκής δροσόφιλας με άσπρα μάτια καιίσιες πτέρυγες με αρσενική με κόκκινα μάτια και αναδιπλωμένεςπτέρυγες στην πρώτη θυγατρική γενιά όλοι οι απόγονοι έχουν ίσεςπτέρυγες ενώ όσον αφορά το χρώμα ματιών όλοι οι θηλυκοίαπόγονοι έχουν κόκκινα μάτια και όλοι οι αρσενικοί άσπρα. Στονχαρακτήρα χρώμα ματιών το γονίδιο που κωδικοποιεί το κόκκινοχρώμα επικρατεί του γονιδίου που κωδικοποιεί το άσπρο χρώμα. 1. Να αναφέρετε τον τύπο κληρονομικότητας που ακολουθεί κάθε χαρακτήρας (επικρατής, φυλοσύνδετος) 2. Αφού συμβολίσετε κατάλληλα τα αλληλόμορφα κάθε ιδιότητας να προσδιορίσετε τους γονότυπους των ατόμων της πατρικής γενιάς 3. Να δείξετε την διασταύρωση μεταξύ ενός αρσενικού και ενός θηλυκού ατόμου της πρώτης θυγατρικής γενιάς και να 5
  6. 6. προσδιορίσετε την πιθανότητα στην δεύτερη θυγατρική γενιά να προκύψει άτομο με άσπρα μάτια και ίσιες πτέρυγες.ΑΚΗΣΗΜια γυναίκα έχει σύνδρομο Turner και βλέπει κανονικά ταχρώματα, ενώ η μητέρα της είχε μερική αχρωματοψία. Πόσααυτοσωμικά και πόσα φυλετικά χρωμοσώματα έχει η γυναίκα αυτήστα σωματικά της κύτταρα; Πώς δημιουργήθηκαν οι γαμέτες για ναγεννηθεί αυτό το άτομο; 6
  7. 7. ΑΣΚΗΣΗΈνας γενετιστής ανίχνευσε σημειακή μεταλλαγή και προκειμένουνα ερευνήσει τις επιπτώσεις της στους ζωντανούς οργανισμούςτην κλωνοποίησει την αλληλουχίες που την εμπεριέχει σε βακτήριο. Για τον σκοπό αυτό έγινε πέψη της αλληλουχίας με τοπεριοριστικό ένζυμο ECORI. Το τμήμα του DNA που φαίνεται παρακάτω εισάγεται σε βακτήριο E. Coli 5’ GAAGAATTCGGCAATGAATTCAGTGAATTCAA 3’ 3’ CTTCTTAAGCCGTTACTTAAGTCACTTAAGTT 5’ 1. Ποιο είναι το προϊόν της δράσης της ECORI ; 2. Πόσοι φωσφωδιεστερικοί δεσμοί διασπάστηκαν και πόσοι δεσμοί Υδρογόνου καταστράφηκαν; 3. Αν θέλουμε να κλωνοποιήσουμε τα παραγόμενα τμήματα DNA πόσα πλασμίδια πρέπει να χρησιμοποιήσουμε;ΑΣΚΗΣΗΈνα πλασμίδιο που χρησιμοποιείται ως φορέας κλωνοποίησης για την κατασκευήμιας γονιδιωματικής βιβλιοθήκης διαθέτει το γονίδιο ανθεκτικότητας στηναμπικιλίνη και την τετρακυκλίνη. Η μοναδική θέση αναγνώρισης από την ECO RIεμπεριέχεται στο γονίδιο της τετρακυκλίνης, το οποίο κωδικοποιεί μια πρωτεΐνη 7
  8. 8. η οποία είναι τοξική για το βακτήριο. Πώς μπορούμε να επιλέξουμε ταμετασχηματισμένα βακτήρια που δέχτηκαν το ανασυνδυασμένο πλασμίδιο; Να κάνετε Hb A Φυσιολογική αιμοσφαιρίνη την Hb A2 Δρεπανοκυτταρική αναιμία παρακάτω Hb F Φορέας β μεσογειακής Hb s αναιμίας Α1 αντιθρυψίνη Δρεπανοκυτταρική αναιμία Ινσουλίνη Πάγκρεας Παραγοντας ΙΧ Ήπαρ Παράγοντας VIII Αιμορροφιλία Α Lactobacillus Αιμορροφιλία Β Clostridium Ρ.Η. 4-5 Υποχρεωτικά αναερόβιοαντιστοίχιση 8
  9. 9. ΑΣΚΗΣΗΠώς θα μεταβληθεί η καμπύλη που δείχνει τις φάσεις μια κλειστήςκαλλιέργειας 1. Αν αυξηθεί το θρεπτικό υλικό 2. Αν γίνουν βέλτιστες οι συνθήκες (ρ. Η. θερμοκρασία) 3. Αν ενεργοποιηθεί οπερόνιο 4. Αν προστεθεί αντιβιοτικό 5. Aν προστεθεί μικροβιοκτόνος ουσία (χλωρίνη, αιθανόλη ) 9

×