Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
ΓΙΑΓΩΝΙ΢ΜΑ ΒΙΟΛΟΓΙΑ΢ Γ ΛΤΚΔΙΟΤ ΘΔΣΙΚΗ΢ ΚΑΣΔΤΘΤΝ΢Η΢                            ΚΔΦΑΛΑΙΟ: 4               ΣΔΥΝΟΛΟΓΙΑ ΣΟΤ ΑΝΑ...
Upcoming SlideShare
Loading in …5
×

Κεφάλαιο 4 διαγώνισμα βιολογίας Γ λυκείου θετικης κατευθυνσης

  • Be the first to comment

  • Be the first to like this

Κεφάλαιο 4 διαγώνισμα βιολογίας Γ λυκείου θετικης κατευθυνσης

  1. 1. ΓΙΑΓΩΝΙ΢ΜΑ ΒΙΟΛΟΓΙΑ΢ Γ ΛΤΚΔΙΟΤ ΘΔΣΙΚΗ΢ ΚΑΣΔΤΘΤΝ΢Η΢ ΚΔΦΑΛΑΙΟ: 4 ΣΔΥΝΟΛΟΓΙΑ ΣΟΤ ΑΝΑ΢ΤΝΓΤΑ΢ΜΔΝΟΤ DNA ΓΙΑΡΚΔΙΑ : 45 ΛΔΠΣΑΔΡΩΣΗ΢Η : 1Α. Πνηα έλδπκα ζπκκεηέρνπλ ζηε δεκηνπξγία γνληδηωκαηηθήο βηβιηνζήθεο;(ΜΟΝΑΓΔ΢ 8)Β. Ση είλαη θνξέαο θιωλνπνίεζεο; (ΜΟΝΑΓΔ΢ 12)ΔΡΩΣΗ΢Η: 2΢ε έλα επθαξπωηηθό θύηηαξν έλα γνλίδην είλαη ππεύζπλν γηα ηελ παξαγωγή κηαοπξωηεΐλεο 148 ακηλνμέωλ. Αλ ην ίδην γνλίδην θιωλνπνηεζεί ζε έλα βαθηεξηαθόπιεζπζκό, ζα παξαρζεί ε αθξηβήο πξωηεϊλε; (ΜΟΝΑΓΔ΢ 6)Να αηηηνινγήζεηε ηε απάληεζή ζαο. (ΜΟΝΑΓΔ΢ 14)ΔΡΩΣΗ΢Η: 3΢ε έλα κακνύζ ειηθίαο 40.000 εηώλ βξέζεθε DNA. Πνηα κέζνδνο πηζηεύεηε όηη ζαρξεζηκνπνηεζεί από ηνπο εξεπλεηέο πξνθεηκέλνπ λα πνιιαπιαζηαζηεί ην DNA θαη λακειεηεζεί από ηνπο εξεπλεηέο;(ΜΟΝΑΓΔ΢ 10)ΔΡΩΣΗ΢Η: 4 Σν ηκήκα ηνπ DNA πνπ θαίλεηαη παξαθάηω εηζάγεηαη ζε βαθηήξην E. Coli 5’ GAAGAATTCGGCAATGAATTCAGTGAATTCAA 3’ 3’ CTTCTTAAGCCGTTACTTAAGTCACTTAAGTT 5’a. Πνην είλαη ην πξνϊόλ ηεο δξάζεο ηεο ECORI ; (ΜΟΝΑΓΔ΢ 10)b. Πόζνη θωζθωδηεζηεξηθνί δεζκνί δηαζπάζηεθαλ θαη πόζνη δεζκνί Τδξνγόλνπ θαηαζηξάθεθαλ; (ΜΟΝΑΓΔ΢ 20)c. Αλ ζέινπκε λα θιωλνπνηήζνπκε ηα παξαγόκελα ηκήκαηα DNA πόζα πιαζκίδηα πξέπεη λα ρξεζηκνπνηήζνπκε; (ΜΟΝΑΓΔ΢ 20) Καιή Δπηηπρία !!!

    Be the first to comment

    Login to see the comments

Views

Total views

4,784

On Slideshare

0

From embeds

0

Number of embeds

2

Actions

Downloads

57

Shares

0

Comments

0

Likes

0

×