Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Tema 2 biomoléculas orgánicas acidos nucleicos

14,662 views

Published on

Published in: Education
  • Be the first to comment

Tema 2 biomoléculas orgánicas acidos nucleicos

  1. 1. Biomoléculas orgánicas que constituyen las células: ácidos nucleicos Tema 2
  2. 2. Ácidos nucleicos: temario• 20.- Ácidos nucleicos: Definición de nucleósidos y nucleótidos. Fórmula química general. Bases púricas y pirimidínicas.• 21.- Ácido desoxirribonucleico (ADN): Composición, localización y función. Estructura primaria y secundaria (doble hélice): complementariedad y antiparalelismo de la cadena. Empaquetamiento del ADN en eucariotas (cromatina y cromosomas). Conocimiento del proceso de desnaturalización y renaturalización del ADN (consultar relación de prácticas obligatorias, nº 4).• 22.- Ácido ribonucleico (ARN): Composición y estructura general. Tipos de ARN (ARN mensajero, transferente y ribosómico): estructura, localización y función.
  3. 3. Ácidos nucleicos: orientaciones• 10.- Definir, conocer la composición y reconocer la estructura general de los nucleósidos, nucleótidos y ácidos nucleicos.• Describir el enlace fosfodiéster como característico de los polinucleótidos.• Diferenciar y analizar los diferentes tipos de ácidos nucleicos de acuerdo con su composición, estructura, localización y función.
  4. 4. Ácidos nucleicos: CONCEPTO• Químicamente, los ácidos nucleicos son polímeros constituidos por la unión mediante enlaces químicos de unidades menores llamadas nucleótidos.• Los ácidos nucleicos son compuestos de elevado peso molecular, esto es, son macromoléculas.
  5. 5. LOS NUCLEÓTIDOS: COMPONENTES• Los nucleótidos están formados por: – Una base nitrogenada (BN): púricas o pirimidínicas. – Un azúcar (A). Una pentosa: β-ribosa o β-desoxirribosa. – Un ácido fosfórico, H3PO4 (P). En los nucleótidos en forma de fosfato. Ion fosfato + + Pentosa Base nitrogenada
  6. 6. LAS BASES NITROGENADAS• Son sustancias derivadas de dos compuestos químicos: la purina y la pirimidina.• Las que derivan de la purina son las bases púricas. En los nucleótidos vamos a encontrar, normalmente, dos base púricas: la adenina (A) y la guanina (G).• Las que derivan de la pirimidina se llaman pirimidínicas. Tres son las bases pirimidínicas presentes en los ácidos nucleicos: la citosina (C), la timina, exclusiva del ADN (T) y el uracilo, exclusivo del ARN (U).
  7. 7. LAS BASES NITROGENADAS
  8. 8. EL AZÚCAR (GLÚCIDO)• El azúcar que interviene en los nucleótidos puede ser o la ribosa (R) o la desoxirribosa (dR).• Ambas son aldopentosas y las encontraremos en los nucleótidos como furanosas.• Conviene destacar que la única diferencia entre ambas está en que en el carbono 2 de la desoxirribosa hay un hidrógeno (-H) en lugar del grupo alcohol (-OH).
  9. 9. EL AZÚCAR (GLÚCIDO)Ribosa Desoxirribosa Desoxirribosa ARN ADNARN ADN
  10. 10. LOS NUCLEÓSIDOS• El azúcar y la base nitrogenada se unen entre sí como se indica en las figuras formando un nucleósido.• El enlace se forma entre el carbono anomérico (1) del azúcar y uno de los nitrógenos de la base nitrogenada, en concreto, (N-1 si esta es pirimidínica, o el N-9 si es púrica).• En la unión se forma una molécula de agua.• Este enlace recibe el nombre de enlace Nglicosídico.
  11. 11. NOMENCLATURA DE LOS NUCLEÓSIDOS• Los nucleósidos se nombran con el nombre de la base cambiando la terminación por la terminación osina si la base es púrica o idina si la base es pirimidínica. Si la pentosa es la desoxirribosa se añade el prefijo desoxi.
  12. 12. LOS NUCLEÓSIDOS
  13. 13. LOS NUCLEÓSIDOS Citosina NUCLEÓSIDO Desoxirribosa H2O Desoxicitidina +Para evitar confusiones a los átomos de las basesnitrogenadas se les numeran con la serie 1, 2, 3, 4,... ylos de las pentosas con la serie 1, 2, 3,....
  14. 14. ESTRUCTURA DE LOS NUCLEÓTIDOS• Los nucleótidos son los monómeros que constituyen los ácidos nucleicos.• Se forman cuando se unen el ácido fosfórico y un nucleósido.• Es un enlace éster que se produce al esterificarse un OH del fosfórico con un OH libre de la pentosa, frecuentemente el del C-5, en su formación se libera una de agua.• Según el azúcar sea la ribosa o la desoxirribosa, tendremos ribonucleótidos o desoxirribonucleótidos.• La timina nunca forma parte de los ribonucleótidos y el uracilo no forma parte de los desoxirribonucleótidos.
  15. 15. ESTRUCTURA DE LOS NUCLEÓTIDOS• Los nucleótidos son por consiguiente ésteres fosfóricos de nucleósidos o nucleósidos fosforilados normalmente en posición 5.• Tienen carácter ácido debido al grupo fosfato.• Se pueden nombrar de varias formas:• 1) Anteponiendo la palabra ácido al nombre de la base a la que se la hace terminar en ilico si la base es púrica o en idílico si es pirimidínica. Si la pentosa es la desoxirribosa se añade el prefijo desoxi al nombre de la base.• 2) Nombrando el nucleósido del que derivan (se le puede eliminar la a final), a continuación el número del carbono de la pentosa con el que se produce la esterificación del fosfórico, y por último el número de moléculas de fosfórico que se unen. Y mediante la siglas de la nombre desarrollado.
  16. 16. ESTRUCTURA DE LOS NUCLEÓTIDOSÁcido fosfórico H2O + NUCLEÓTIDO Desoxicitidina-5’-monofosfato NUCLEÓSIDO
  17. 17. ESTRUCTURA DE LOS NUCLEÓTIDOS
  18. 18. LOS POLINUCLEÓTIDOS• Dos nucleótidos van a poder unirse entre sí mediante un enlace ésterfosfato (fosfodiéster).• La unión se produce mediante un enlace éster que se forma, entre un OH del fosfórico de un nucleótido que esta unida al carbono 5’ de la pentosa y el OH del C-3 de la pentosa del siguiente nucleótido, por lo tanto cada molécula de fosfórico forma dos enlaces éster: uno con el C-5’ de la pentosa de un nucleótido y el otro con el C-3’ de la pentosa del siguiente nucleótido, a este enlace por eso se le denomina enlace fosfodiéster 5-3‘, con formación de una molécula de agua.• La unión de otros nucleótidos dará lugar a un polinucleótido.
  19. 19. LOS POLINUCLEÓTIDOS• Es de destacar que en toda cadena de polinucleótidos el nucleótido de uno de los extremos tendrá libre el OH del azúcar en posición 3, éste será el extremo 3 de la cadena. El ácido fosfórico del nucleótido que se encuentre en el extremo opuesto también estará libre, éste será el extremo 5.• Esto marca un sentido en la cadena de polinucleótidos.• Toda cadena podrá considerarse bien en sentido 3‘ 5 o en sentido 5 3 y así habrá que indicarlo.
  20. 20. LOS POLINUCLEÓTIDOSExtremo 5’ Adenosina-5’-monofosfato Enlace fosfodiéster + H2O Uridina-5’-monofosfato ARN de tres nucleótidos A-U-C H2O + Citidina-5’-monofosfatoExtremo 3’
  21. 21. ADN Y ARN: DIFERENCIAS A NIVEL QUÍMICO• El ADN (ácido desoxirribonucleico) sus nucleótidos tienen desoxirribosa como azúcar y no tiene uracilo.• El ARN (ácido ribonucleico) tiene ribosa y no tiene timina.
  22. 22. EL ADN (DNA): Concepto• Químicamente son polinucleótidos constituidos por d-AMP, d-GMP, d-CMP y d-TMP.• Los nucleótidos del ADN no tienen ni uracilo, ni ribosa, como ya se ha dicho.
  23. 23. EL ADN (DNA): Características• Tienen un peso molecular muy elevado (en el hombre 3,6 .1012).• En la mayoría de los casos es bicatenario, en algunos virus es monocatenario.• En algunos casos la molécula de ADN es circular (carece de extremos) como ocurre en las células procariotas, en algunos virus etc; en las células eucariotas es lineal.• Las moléculas de ADN son muy largas, su longitud varía desde los 0,5 μm en algunos virus, hasta 13 cm en la mosca del vinagre. En el hombre es de unos 5 cm (2,36 m si sumamos todo el ADN de todos los cromosomas de una célula humana).
  24. 24. EL ADN (DNA): Localización• El ADN fue aislado por primera vez en 1869, (Miescher) pero hasta 1950 no se empezó a conocer su estructura.• En células eucariotas: – Se encuentra en el núcleo de las células asociado a proteínas (histonas y otras no histónicas) formando la cromatina, sustancia que constituye los cromosomas y a partir de la cual se transcribe la información genética. – También hay ADN en ciertos orgánulos celulares (por ejemplo: plastos y mitocondrias). Este ADN es similar al de las células procariotas
  25. 25. EL ADN (DNA): Localización• En células procariotas:• Está asociado a proteínas parecidas a las histonas, a ARN y a proteínas no histónicas formando una condensación llamada nucleoide.
  26. 26. EL ADN (DNA)
  27. 27. EL ADN (DNA): ESTRUCTURA• Se pueden distinguir 3 niveles estructurales: – Estructura primaria: La secuencia de los nucleótidos. – Estructura secundaria: La doble hélice. – Estructura terciaria: Torsión de la doble hélice sobre sí misma. Collar de perlas, estructura cristalina, ADN superenrollado. – En las células eucariotas, a partir de la estructura 3ª, se dan otros niveles de empaquetamiento de orden superior: superespiralización: cromosomas.
  28. 28. EL ADN (DNA): ESTRUCTURAESTRUCTURA PRIMARIA ESTRUCTURA SECUNDARIA ESTRUCTURA TERCIARIASecuencia de nucleótidos Doble hélice ADN superenrollado
  29. 29. EL ADN (DNA): ESTRUCTURA 1ª• Es la secuencia de nucleótidos de una cadena o hebra. Nos indica cuantos, de que clase y como están ordenados los nucleótidos en la cadena.• En las cadenas de nucleótidos se diferencian: – El eje de la cadena que esta formado por desoxirribosa y fosfórico que se van sucediendo alternativamente y es común para todas las clases de ADN. – Las diferentes bases (A,G,C,T) que salen del eje a nivel de la desoxirribosa. La colocación o secuencia de estas bases es lo que diferencia a las distintas clases de ADN. Esta secuencia de bases constituye el mensaje genético, en esta secuencia es donde reside la información necesaria para la síntesis de las proteínas, y por lo tanto esta información es la que determina las características biológicas del individuo.
  30. 30. EL ADN (DNA): ESTRUCTURA 1ª• Todas las cadenas tienen polaridad, en ellas se diferencian dos extremos: el extremo 5’, es el que lleva el grupo fosfato libre unido al carbono 5’ de la pentosa; el extremo 3’ es el que lleva el OH del carbono 3’ de la pentosa libre.• Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5 y 3 de la cadena nucleotídica.• Así, por ejemplo: 5ACGTTTAACGACAAGGACAAGTATTAA3
  31. 31. EL ADN (DNA): ESTRUCTURA 1ª Extremo 5´ Extremo 3’
  32. 32. EL ADN (DNA): ESTRUCTURA 1ª• La posibilidad de combinar cuatro nucleótidos diferentes y la gran longitud que pueden tener las cadenas polinucleotídicas, hacen que pueda haber un elevado número de polinucleótidos posibles, lo que determina que el ADN pueda contener el mensaje biológico o información genética y explica la diversidad del mensaje genético de todos los seres vivos.
  33. 33. EL ADN (DNA): ESTRUCTURA 2ª• Corresponde a la disposición en el espacio de dos hebras o cadenas que forman una doble hélice con las bases nitrogenadas enfrentadas unidas por enlaces puente de H.• Esta estructura se dedujo a partir de: – Densidad y viscosidad superior a las esperadas. – Igual número de A que de T, e igual número de C que de G. Esto implicaba la complementariedad de las bases. – El ADN tiene una estructura fibrilar de 20 A de diámetro.
  34. 34. EL ADN (DNA): ESTRUCTURA 2ª CHARGAFF• A) A finales de los años 40 CHARGAFF y sus colaboradores estudiaron los componentes del ADN y emitieron los siguientes resultados: – La concentración de bases varía de una especie a otra. – El porcentaje de A, G, C y T es el mismo en los individuos de la misma especie y no por esto el mensaje es el mismo. – Tejidos diferentes de la misma especie tienen la misma composición en bases. – La composición en bases del ADN de una misma especie no varía con la edad del organismo ni con su estado nutricional ni con las variaciones ambientales.
  35. 35. EL ADN (DNA): ESTRUCTURA 2ª CHARGAFF Puente de hidrógeno Extremo 3’Extremo 5’ Extremo 5’ Extremo 3’
  36. 36. EL ADN (DNA): ESTRUCTURA 2ª CHARGAFF• A) A finales de los años 40 CHARGAFF y sus colaboradores estudiaron los componentes del ADN y emitieron ESTOS OTROS resultados: – Las densidades y viscosidades corresponden a la existencia de enlaces de hidrógeno entre los grupos NH y los grupos CO. – La concentración de Adenina es igual a la de Timina, y la de Citosina a la de Guanina. Las dos primeras establecen dos puentes de hidrógeno entre ellas, y las últimas tres puentes. A/T=1, C/G=1 – La cantidad de puricas es igual a la cantidad de pirimidinas. A+G/C+T=1,
  37. 37. EL ADN (DNA): ESTRUCTURA 2ª Modelo de la estructura secundaria del ADN.
  38. 38. EL ADN (DNA): ESTRUCTURA 2ª FRANKLIN Y WILKINS• B) Por medio del método analítico de difracción de rayos X, FRANKLIN y WILKINS observaron una estructura fibrilar de 20 Å (Amstrongs) de diámetro con repeticiones cada 3,4 Å y una mayor cada 34 Å. Diámetro del ADN (20 Ǻ) Distancia entre un par de bases (3,4 Ǻ) Longitud de una vuelta de hélice (34 Ǻ)
  39. 39. EL ADN (DNA): ESTRUCTURA 2ª WATSON y CRICK• C) WATSON y CRICK postularon en 1953 un modelo tridimensional para la estructura del ADN que estaba de acuerdo con todos los datos disponibles anteriores: el modelo de doble hélice.• Este modelo, además de explicar cómo era el ADN, sugería los mecanismos que explicaban su función biológica y la forma como se replicaba.
  40. 40. EL ADN (DNA): ESTRUCTURA 2ª WATSON y CRICKParejas de bases Parejas de bases
  41. 41. Modelo de la doble hélice
  42. 42. Modelo de la doble hélice• Según el modelo de la doble hélice de WATSON y CRICK: – 1) El ADN estaría constituido por dos cadenas o hebras de polinucleótidos enrolladas helicoidalmente en sentido dextrógiro sobre un mismo eje formando una doble hélice. – 2) Ambas cadenas serían antiparalelas, una iría en sentido 35 y la otra en sentido inverso, 5 3. – 3) Los grupos fosfato estarían hacia el exterior y de este modo sus cargas negativas interaccionarían con los cationes presentes en el nucleoplasma dando más estabilidad a la molécula.
  43. 43. Modelo de la doble hélice• Según el modelo de la doble hélice de WATSON y CRICK: – 4) Las bases nitrogenadas estarían hacia el interior de la hélice con sus planos paralelos entre sí y las bases de cada una de las hélices estarían apareadas con las de la otra asociándose mediante puentes de hidrógeno (entre la adenina y la timina se forman 2, y entre la guanina y la citosina 3) . – 5) El apareamiento se realizaría únicamente entre la adenina y la timina, por una parte, y la guanina y la citosina, por la otra. – 6) El enrollamiento de la doble hélice es dextrógiro y plectonímico (para que se separen las cadenas han de girar una respecto a al otra).
  44. 44. Modelo de la doble hélice• Las bases nitrogenadas se sitúan en el interior de la doble hélice, mientras que los ejes (pentosa-fosfato) de las cadenas forman el esqueleto externo. Los planos de los anillos de las bases nitrogenadas que están enfrentadas son paralelos entre sí y perpendiculares al eje de la doble hélice.• El grosor de la doble hélice es de 2 nm (20 A), la longitud de cada vuelta es de 3,4nm y cada 0,34 nm se encuentra un par de bases, por lo que en cada vuelta hay 10 pares de nucleótidos.
  45. 45. Modelo de la doble hélice
  46. 46. Modelo de la doble hélice La molécula de ADN se asemeja a una escalera de caracol, cuyos pasamanos se corresponderían con los esqueletos de polidesoxirribosa-fosfato y los peldaños serían los pares de bases enfrentadas entre sí. A este modelo estructural se le denomina forma B, hoy se sabe que además de este modelo existen otros dos modelos: la forma A y la forma Z.
  47. 47. Síntesis semiconservativa• Por lo tanto, la estructura primaria de una cadena estaría determinada por la de la otra, ambas cadenas serían complementarias.• La complementariedad de las cadenas sugiere el mecanismo por el cual el ADN se copia -se replica- para ser trasferido a las células hijas.• Ambas cadenas o hebras se pueden separar parcialmente y servir de molde para la síntesis de una nueva cadena complementaria (síntesis semiconservativa).
  48. 48. Síntesis semiconservativa
  49. 49. DESNATURALIZACIÓN• Si una disolución de ADN se calienta suficientemente (hasta 100º C) ambas cadenas se separan, pues se rompen los enlaces de hidrógeno que unen las bases, y el ADN se desnaturaliza.• La temperatura de desnaturalización depende de la proporción de bases.• A mayor proporción de C-G, mayor temperatura de desnaturalización, pues la citosina y la guanina establecen tres puentes de hidrógeno, mientras que la adenina y la timina sólo dos y, por lo tanto, a mayor proporción de C-G, más puentes de hidrógeno unirán ambas cadenas.• La desnaturalización se produce también variando el pH o a concentraciones salinas elevadas. Si se restablecen las condiciones (se enfría por debajo de 65º C), el ADN se renaturaliza y ambas cadenas se unen de nuevo.
  50. 50. RENATURALIZACIÓN E HIBRIDACIÓN• La renaturalización permite la hibridación, es decir que se puedan unir dos hebras de distinta procedencia y formar una molécula híbrida de ADN, siempre que entre ambas exista una secuencia complementaria.• Cuanto más relacionados están los ADN mayor porcentaje de renaturalización se producirá.
  51. 51. RENATURALIZACIÓN E HIBRIDACIÓN• Entre individuos de la misma especie habrá más porcentaje de renaturalización cuando los individuos están emparentados.• Entre individuos de distinta especie la renaturalización será mayor cuanto más relacionados evolutivamente estén.• La hibridación se utiliza con distintas finalidades: detectar enfermedades genéticas, localizar genes relacionados en distintas poblaciones, etc.
  52. 52. ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS.• Las grandes moléculas de ADN de las células eucariotas están muy empaquetadas ocupando así menos espacio en el núcleo celular y además como mecanismo para preservar su transcripción.• En las células eucariotas el ADN se encuentra en el núcleo asociado a ciertas proteínas: nucleoproteínas, formando la cromatina.• En la cromatina, la doble hélice de ADN se enrolla alrededor de unas moléculas proteicas globulares, las histonas, formando los nucleosomas.
  53. 53. ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS.• Primer nivel de empaquetamiento fibra de cromatina de 100 A o collar de perlas.• La fibra de ADN de 20 A se une a proteínas histonas, formando un alineamiento de partículas globulares llamadas nucleosomas.• La cadena de nucleosomas se denomina fibra de cromatina de 100 A o collar de perlas.• Cada nucleosoma está formado por un octámero de histonas (2H2A, “2H2B, 2H3 y 2H4) y una hebra de ADN de 200 pares de bases.• El ADN que separa y une a dos nucleosomas se llama ADN espaciador.• Si el nucleosoma se une a otra proteína histona H1 la fibra se condensa.
  54. 54. ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS. Primer nivel de empaquetamiento Doble hélice de ADN100 Ǻ Fibra de cromatina compacta Histona H1 Octámero de histonas
  55. 55. ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS.
  56. 56. ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS.• Segundo nivel de empaquetamiento o fibra de cromatina de 300 A (solenoide).• La fibra de 100 A condensada (con H1) puede enrollarse sobre sí misma formando fibras de un grosor de 30 nm (fibra de 30 nm o 300 A).• Según el modelo del solenoide las fibras se forman al enrollarse seis nucleosomas por vuelta alrededor de un eje formado por las histonas H1.
  57. 57. ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS. Nucleosoma300 Ǻ Nucleosoma Segundo nivel de empaquetamiento Histona H1
  58. 58. ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS.
  59. 59. ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS.• Tercer nivel de empaquetamiento o dominios en forma de bucle. – Cada fibra se volvería a enrollar formando bucles estabilizados por un andamio proteico.
  60. 60. ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS. Tercer nivel de empaquetamiento Bucle Andamio proteico
  61. 61. NIVELES SUPERIORES DE EMPAQUETAMIENTO• Niveles superiores: – Seis bucles se empaquetarían asociándose a un " esqueleto nuclear" produciéndose un rosetón, 30 rosetones formarían una espiral y 20 espirales formarían una cromátida. Niveles superiores de empaquetamiento Proteínas SMC
  62. 62. NIVELES SUPERIORES DE EMPAQUETAMIENTO• Todo ello produciría un gran acortamiento de las largas cadenas de ADN.• En los espermatozoides el ADN se encuentra aún mucho más empaquetado, se dice que tiene " estructura cristalina“ gracias a proteínas protaminas.• Los ADN de las bacterias, virus, mitocondrias y plastos no presentan estructuras tan complejas y no están asociados a histonas, aunque sí están asociados a otras proteínas.
  63. 63. NIVELES SUPERIORES DE EMPAQUETAMIENTO
  64. 64. TIPOS DE ADN • Según su número de cadenas se distinguen los siguientes tipos de ADN: – Monocatenarios o de una cadena; por ejemplo los de algunos virus. – Bicatenarios, con dos hebras o cadenas (algunos virus, las bacterias y los eucariotas).• Según su forma: - Lineal, como por ejemplo el del núcleo de las células eucariotas y el de algunos virus. - Circular, como el de las mitocondrias, cloroplastos, bacterias y algunos virus.
  65. 65. TIPOS DE ADN MONOCATENARIO Lineal Circular BICATENARIOLineal Superenrollado Concatenado Circular
  66. 66. TIPOS DE ADN• Según el tipo de moléculas que sirven de soporte para empaquetar:• ADN asociado a histonas. Núcleo de células eucariotas excepto espermatozoides.• ADN asociado a protaminas. Núcleo de los espermatozoides.• ADN procariota. Asociado a proteínas parecidas a histonas y a otras.
  67. 67. EL ARN (RNA).• El ARN, ácido ribonucleico, es un polirribonucleótido que, a diferencia del ADN, no contiene ni desoxirribosa ni timina, pero sí ribosa y uracilo.• El ARN no forma dobles cadenas, salvo en ciertos virus (por ej. los reovirus). Lo que no quita que su estructura espacial pueda ser en ciertos casos muy compleja.
  68. 68. EL ARN (RNA).• Por su estructura y su función se distinguen tres clases de ARN: – ARN mensajero (ARNm). – ARN transferente (ARNt). – ARN ribosómico (ARNr).
  69. 69. CLASES DE ARN: ARNm• Es un polirribonucleótido constituido por una única cadena lineal sin ninguna estructura de orden superior.• Su masa molecular suele ser elevada.• Este ARN se sintetiza en el núcleo celular copiando la información del ADN y pasa al citoplasma transportando la información para la síntesis de proteínas.• La duración de los ARNm en el citoplasma celular es de escasos minutos siendo degradados rápidamente por enzimas específicas.
  70. 70. CLASES DE ARN: ARNm• ARNm eucariótico.• Presenta zonas de doble hélice debido a la complementariedad de las bases (lazos en herradura).• Es monocistrónico, lleva información para la síntesis de una proteína.• En el extremo 5´ tiene una capucha de GTP (señal de inicio de síntesis) y en el extremo 3´una cola de poli- A.• Se distinguen exones o fragmentos con información de los intrones o fragmentos sin información que son eliminados.
  71. 71. CLASES DE ARN: ARNm Codos y bucles debido a la complementariedad de las bases Conjunto de proteínas
  72. 72. CLASES DE ARN: ARNm
  73. 73. CLASES DE ARN: ARNm• ARNm procariótico.• No presenta intrones, no tiene capucha ni cola poli-A.• Puede ser policistrónico, puede contener información para dos o más cadenas polipeptídicas.
  74. 74. CLASES DE ARN: ARNt• El ARNt (ARN de transferencia) transporta los aminoácidos para la síntesis de proteínas.• Está formado por una sola cadena, aunque en ciertas zonas se encuentra replegada (forma de hoja de trébol) y asociada internamente mediante puentes de hidrógeno entre bases complementarias. Estructura 3ª en forma de L. Su peso molecular es del orden de 25.000 da. Está formado por entre 70 y 90 nucleótidos y constituye el 15 % del total del ARN de la célula. Se sintetiza en el núcleo y sale hacia el citoplasma para realizar su función.• En el ARNt podemos distinguir un brazo aceptor de aminoácidos abierto y un triplete de bases en un bucle anticodon (complementario de un triplete de bases del ARNm llamado codón).
  75. 75. PARTES DEL ARNt• Brazo aceptor. Es el brazo que no tiene bucle, en él se sitúan los dos extremos de la cadena: el extremo 5 que termina siempre en el nucleótido de la guanina que tiene el grupo fosfato libre y el extremo 3 que termina siempre en el triplete CCA sin aparear, con él es con quien se une el aminoácido que van a transportar.• Brazo del anticodón, se sitúa en el lado opuesto al brazo aceptor, en el bucle de este brazo existe un triplete de bases denominadas anticodón, que determina el aminoácido que transportara el ARNt. Los anticodones son complementarios de tripletes de bases del ARNm (codones) con los que se unen de forma transitoria en la traducción de la información durante la síntesis de proteínas.• Además existen otros dos brazos: el brazo D, por donde se une al enzima (aminoacil-ARNt sintetasa) que cataliza la unión con el aminoácido que transporta. El brazo T es por donde se fija el ARNt al ribosoma.
  76. 76. CLASES DE ARN: ARNt Alanina Guanina (en el extremo 5’) Brazo aceptor Puentes de hidrógenoBrazo D y su asa Brazo T y su asa Ribotimidina Dihidrouridina Brazo anticodón y su asa Anticodón Codón ARNm
  77. 77. CLASES DE ARN: ARNt
  78. 78. CLASES DE ARN: ARNt
  79. 79. FUNCIONES DEL ARNtExisten unos 50 tipos diferentes de ARNt. Sesintetizan en el núcleo por la transcripción dezonas concretas del ADN, una vez formadossalen al citoplasma donde realiza su función.Su función es la de captar aminoácidos en elcitoplasma y transportarlos a los ribosomas,colocándolos según indica la secuencia delARNm para sintetizar las proteínas.
  80. 80. CLASES DE ARNr• El ARNr (ARN ribosomal) es el ARN de los ribosomas origina lugares adecuados para la unión con el ARNm y con el ARNt.• Presenta segmentos monocatenarios y segmentos en doble hélice.• La masa de los ARNr se expresa según el coeficiente de sedimentación de Sverberg (S).• Las células procariotas tienen ribosomas de 70S y las células eucariotas de 80 S.
  81. 81. CLASES DE ARNr
  82. 82. FUNCION DE LOS ACIDOS NUCLEICOSEl ADN es la molécula que lleva la información genética, esdecir la información que determina las características delindividuo. Estas características están expresadas en lasproteínas, por consiguiente el ADN lleva la información quepermite la síntesis de todas las proteínas del organismo.Esta información viene determinada por la secuencia debases.
  83. 83. FUNCION DE LOS ACIDOS NUCLEICOSEste proceso de síntesis de proteínas se realiza en dosetapas y en él interviene también los ARN:1)Transcripción: En esta etapa se copia la información deun fragmento de ADN, correspondiente a un gen, al ARNm.2)Traducción: La secuencia de nucleótidos del ARNm setraduce, en los ribosomas con la ayuda de los ARNt, en unadeterminada secuencia de aminoácidos, es decir en unadeterminada proteína.El ADN además gracias a la propiedad de autoduplicacióno replicación que tiene puede transmitir esta información deuna generación a otra.La función del ARN en la mayoría de los organismos es la deextraer la información del ADN y posteriormente dirigir apartir de esta información la síntesis proteica.
  84. 84. DIFERENCIAS ENTRE ADN Y ARN•En cuanto a la composición:-El ADN tiene como pentosa la ß-D-desoxirribofuranosa, como base tiene timina yno tiene uracilo.-El ARN tiene como pentosa la ß-D-ribofuranosa, como base tiene uracilo y notiene timina.•En cuanto a la localización:La mayor parte del ADN se localiza en el núcleo, aunque también algo se localizaen mitocondrias y plastos.El ARN se localiza tanto en el núcleo como en el citoplasma.•En cuanto a la estructura:La mayor parte de las moléculas de ADN son bicatenarias y mucho más grandecomplejas que las del ARN.La mayoría de las moléculas de ARN son unicatenarios y de tamaño muchomenor.•En cuanto a la función:El ADN es la molécula que lleva la información y dicta las órdenes en la síntesisde proteínas.El ARN ejecuta las órdenes dictadas por el ADN.

×