Optometry Admission Test Practice Biology Questions

11,336 views

Published on

Practice questions for the biology section of the Optometry Admission Test (OAT). For more questions and tips on how to do well on the Optometry Admission Test, please visit us at http://www.ioatprep.com/

Published in: Education
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
11,336
On SlideShare
0
From Embeds
0
Number of Embeds
4
Actions
Shares
0
Downloads
100
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Optometry Admission Test Practice Biology Questions

  1. 1.                                                    OPTOMETRY ADMISSION TEST PRACTICE BIOLOGY QUESTIONS (FULL SET)                            iOATprep   www.ioatprep.com   iOATprep    
  2. 2.    …………………………………………………………………………………………………………………………………………………………………………………..   1-­‐10     (Cell  and  Molecular  Biology)   31-­‐34   (Developmental  Biology)   11-­‐20   (Animal  Structures)     35-­‐37   (Diversity)   21-­‐30     (Genetics)       38-­‐40   (Evolution)  …………………………………………………………………………………………………………………………………………………………………………………..    A.  Cell  and  Molecular  Biology  ___  1.  Plant  cells  contain  all  of  the  following  EXCEPT:   A. Cell  Wall   B. Vacuoles   C. Centrioles   D. Plastids    ___  2.  Prokaryotes’  and  Eukaryotes’  main  difference  lies  in  this  structure  of  the  cell.   A. Cell  Wall   B. Nucleus   C. Cytoplasm   D. Mitochondria    ___  3.  Which  of  the  following  is  TRUE  of  the  features  of  an  active  site  of  an  enzyme?   A. This  site  takes  up  more  than  half  of  the  total  volume  of  all  enzymes.   B. Several  strong  attractions  bind  the  substrate  to  the  enzyme.   C. This  site  is  a  crevice  in  the  enzyme.   D. Overall  specificity  of  its  binding  process  depends  on  the  cofactors  and  substrates.      For  questions  4  and  5,  take  a  look  at  this  graph.  (This  graph  shows  the  effect  of  inhibition  to  the  normal  enzymatic  reaction)   A   B    ___  4.  Line  A  represents  this  type  of  inhibition.   A. Competitive   B. Non-­‐Competitive   C. Uncompetitive   D. Irreversible    ___  5.  Line  B  represents  a  type  of  inhibition  having  these  characteristics.   A. Same  Km,  Different  Vmax  iOATprep   www.ioatprep.com   iOATprep    
  3. 3. B. Same  Km,  Same  Vmax   C. Different  Km,  Same  Vmax   D. Different  Km,  Different  Vmax  ___  6.  The  cell  cycle  has  how  many  checkpoints?   A. 1   B. 2   C. 3   D. 4    ___  7.  Homologue  pairings  and  crossing  overs  occur  in:   A. Mitosis   B. Meiosis   C. Both   D. None  of  the  Above    ___  8.  The  following  are  TRUE  of  cellular  respiration  EXCEPT:   A. Glycolysis  is  a  process  of  producing  ATP  from  glucose  via  substrate-­‐level   phosphorylation.   B. Oxygen  is  an  excellent  electron  acceptor  to  recycle  NADH  into  NAD+.   C. In  the  electron  transport  chain,  3  ATP’s  can  be  produced  from  NADH  while  only  2  ATP’s   can  be  activated  from  FAD2.   D. 2  oxidations  occur  in  the  Kreb’s  cycle,  oxidation  of  α-­‐ketoglutarate  and  succinate.    ___  9.  The  actual  yield  of  ATP  in  respiration  is  lower  than  the  theoretical  yield  because:   A. The  inner  mitochondrial  membranes  are  leaky  to  proteins.   B. Chemiosmotic-­‐generated  proton  gradient  is  not  solely  used  for  ATP  synthesis.   C. Both   D. None  of  the  Above    ___  10.  Cactus  is  a  succulent  desert  plant  that  uses  this  type  of  photosynthesis.   A. C3   B. C4   C. CAM   D. Only  B  &  C      B.  Animal  Structures  ___  11.  All  of  the  statements  are  TRUE,  EXCEPT.   A. There  are  more  cavities  in  the  coelom  of  the  Reptiles  than  the  Amphibians.   B. Diaphragm  separates  the  peritoneal  cavity  from  the  thoracic  cavity.   C. Thoracic  cavity  can  be  divided  into  2:  peritoneal  cavity  and  pleural  cavity.   D. None  of  the  Above.    ___  12.  The  largest  organ  of  the  body  is  the:   A. Liver   B. Brain   C. Skin  iOATprep   www.ioatprep.com   iOATprep    
  4. 4. D. Heart        ___  13.  The  following  are  TRUE  of  endoskeleton  EXCEPT:   A. Composed  of  rigid  internal  bones  and  cartilages.   B. Moves  the  body  by  contraction  of  muscles  attached  to  the  skeleton.   C. Limits  the  size  of  an  individual.   D. Capable  of  remodeling.    For  questions  14  and  15,  take  a  look  at  this  illustration.  (This  is  an  electron  microscopic  view  of  a  sarcomere)      ___  14.  The  white  arrows  represent  what  part  of  the  sarcomere?   A. M-­‐line   B. Z-­‐disk   C. H-­‐band   D. I-­‐band    ___  15.  The  black  arrows  point  to  heavily  shaded  lines  representing  what  kind  of  fibers?   A. Thin  Fibers   B. Thick  Fibers   C. Both   D. None  of  the  Above    ___  16.  In  humans,  there  are  three  pairs  of  salivary  glands  that  secrete  saliva  through  ducts  in  the     mouth’s  mucosal  lining.  These  are:   A. Submandibular,  Sublingual  and  Parotid     B. Submandibular,    Submaxillary  and  Parotid   C. Submandibular,  Submaxillary  and  Sublingual   D. Submaxillary,  Sublingual  and  Parotid    ___  17.  The  following  associations  between  immunologic  cell  types  and  their  functions  are  TRUE,     EXCEPT:   A. Helper  T-­‐cells  detects  infection  and  sounds  the  alarm,  initiating  both  T  cell  and  B  cell   responses.   B. Plasma  cells  produce  antibodies  directed  against  specific  foreign  antigens.   C. Cytotoxic  T-­‐cells  detects  and  kills  infected  body  cells.  iOATprep   www.ioatprep.com   iOATprep    
  5. 5. D. Inducer  T-­‐cells  induce  an  inflammatory  response,  aiding  the  arrival  of  leukocytes  at  a   site  of  infection.        ___  18.  Which  of  the  following  are  stored  in  the  Neurohypophysis?   A. Vasopressin  and  Oxytocin   B. Prolactin  and  Oxytocin   C. Vasopressin  and  Prolactin   D. None  of  the  Above    ___  19.  True  of  the  Nervous  System.   A. Schwann  cells  produce  myelin  in  the  CNS.   B. Transmission  through  an  unmyelinated  sheath  is  enhanced  by  “Saltatory  Conduction”.   C. Dendrites  covered  in  myelin  sheaths  are  said  to  be  myelinated.   D. The  simplest  nervous  systems  occur  among  cnidarians.    ___  20.  These  are  mechanoreceptors  are  all  intermittently  activated  (phasic)  EXCEPT:   A. Hair  follicle  receptors   B. Meissner’s  corpuscles   C. Pacinian  corpuscles   D. Merkel  cells      C.  Genetics  For  question  21.  Refer  to  the  illustration  below.  (This  is  a  graphical  representation  of  Adenine)  ___  21.  What  type  of  nitrogen-­‐containing  base  is  the  structure  given  above?   A. Purine   B. Pyrimidine   C. Both   D. None  of  the  Above    ___  22.  During  transcription,  the  gene  must  be  spliced  to  remove  non-­‐coding  regions  which  will  not     translate  any  polypeptide.  The  sequence  that  will  be  spliced  out  are  the:       A. Exons   B. Introns   C. Cistrons   D. None  of  the  Above    ___  23.  What  kind  of  mutation  can  be  seen  in  the  following  example?  iOATprep   www.ioatprep.com   iOATprep    
  6. 6.     Normal  sequence   :  ACTGGGTACGCCAAGTGTACG         Mutated  sequence   :  ACTGGGTACACCAAGTGTACG   A. Germ-­‐line  mutation   B. Somatic  tissue  mutation   C. Point  mutation   D. Spontaneous  mutation  For  questions  24  and  25.  Refer  to  the  illustration  below.  (This  is  a  Punnet  Square  showing  a  monohybrid  cross)   A   B    ___  24.  What  is  the  genotype  of  seed  A?   A. AA   B. Aa   C. aa   D. None  of  the  Above    ___  25.  If  there  will  be  a  cross  between  seed  A  and  seed  B,  what  will  be  the  genotypic  ratio?   E. 1:2:1   F. 2:1:1   G. 1:1:2   H. 3:1    ___  26.  A  case  was  presented  where  a  couple  with  blood  types  A  and  B  for  the  mother  and  father     respectively,  had  a  child  having  a  blood  type  of  O.  Is  this  possible?     A. Yes.   B. No.   C. Lack  of  information.   D. None  of  the  Above.    For  question  27.  Refer  to  the  illustration  below.    iOATprep   www.ioatprep.com   iOATprep    
  7. 7.  ___  27.  This  pedigree  analysis  shows  what  mode  of  inheritance?   A. Sex-­‐linked  Dominant   B. Sex-­‐linked  Recessive   C. Autosomal  Dominant   D. Autosomal  Recessive    ___  28.  Trisomy  13  is  what  genetic  disorder?     A. Down  syndrome   B. Patau  syndrome   C. Edwards  syndrome   D. None  of  the  above    ___  29.  A  genetic  disorder  involving  a  nondisjunction  of  the  sex  chromosomes  where  an  XX  gamete     combines  with  a  Y  gamete  resulting  to  an  XXY  zygote  and  developing  into  a  sterile  male  who  has   many  female  body  characteristics  and,  in  some  cases,  mental  retardation.     A. Turner  Syndrome   B. Klinefelter  Syndrome   C. Jacob’s  Syndrome   D. Triple  X  Syndrome    ___30.  True  of  Polymerase  Chain  Reaction  (PCR).     A. Annealing  is  needed  to  dissociate  the  double  helix  DNA  into  single  strands.   B. Primer  extension  may  be  done  at  a  temperature  of  about  50  -­‐  65°C   C. Denaturation  is  an  optional  step  in  PCR  but  may  be  done  to  optimize  the  reaction.   D. An  agarose  gel  electrophoresis  is  done  after  PCR  to  see  the  DNA  bands.    D.  Developmental  Biology  ___31.  If  fertilization  does  not  occur,  corpus  luteum  develops.  After  it  has  reached  its  maximal     development,  these  next  series  of  events  occur  EXCEPT:   A. Degeneration  of  lutean  cells  causing  the  corpus  luteum  to  shrink.     B. Corpus  albicans  now  forms  as  a  mass  of  fibrotic  tissue.   C. Progesterone  production  now  increases.   D. Menstrual  bleeding  ensues.    ___32.  Identify  the  decidua  part  that  is  found  on  top  of  the  chorion  frondosum.   A. Decidua  Capsularis     B. Decidua  Basalis   C. Decidua  Parietalis   D. Decidua  Marginalis    ___33.  All  of  these  contribute  to  the  development  of  the  body’s  skeletal  system  EXCEPT:   A. Paraxial  Mesoderm   B. Somatic  Mesoderm   C. Splanchnic  Mesoderm   D. Neural  Crest    iOATprep   www.ioatprep.com   iOATprep    
  8. 8. ___34.  In  the  cloacal  membrane,  mesenchymal  cells  migrate  to  form  cloacal  folds,  cranial  to  this  is  the     genital  tubercle  while  caudal  to  this  is  the  urethral  fold  which  in  males  swells  and  becomes  the:   A. Penis     B. Scrotum   C. Testes   D. Prostate  Gland    E.  Diversity  ___35.  In  taxonomy,  the  correct  hierarchy  of  classification  of  all  living  things  is:   A. Kingdom-­‐Phylum-­‐Class-­‐Family-­‐Order-­‐Genus-­‐Species   B. Kingdom-­‐Phylum-­‐Family-­‐Class-­‐Order-­‐Genus-­‐Species   C. Kingdom-­‐Phylum-­‐Order-­‐Class-­‐Family-­‐Genus-­‐Species   D. Kingdom-­‐Phylum-­‐Class-­‐Order-­‐Family-­‐Genus-­‐Species    ___36.  The  following  are  all  phyla  from  the  Kingdom  Fungi  EXCEPT:   A. Ascomycota   B. Acrasiomycota   C. Basidiomycota   D. Zygomycota    ___37.  In  terms  of  body  cavity,  which  of  the  following  is  different?   A. Phylum  Platyhelminthes   B. Phylum  Molusca   C. Phylum  Annelida   D. Phylum  Arthropoda    F.  Evolution,  Ecology  and  Behavior  ___  38.  According  to  the  Hardy–Weinberg  principle,  both  the  allele  and  genotype  frequencies  in  a  large,     random-­‐mating  population  will  remain  constant  from  generation  to  generation  if  none  of  these   processes  would  occur:   A. Selection   B. Mutation   C. Gene  Flow   D. All  of  the  Above    ___  39.  Cladistics  is…   A. A  biological  approach  that  reconstructs  and  studies  all  phylogenies.   B. A   biological   approach   that   constructs   differences   and   similarities   between   organisms   into  an  evolutionary  tree     C. A  biological  approach  that  infers  phylogeny  according  to  the  similarities  derived  from  a   common  ancestor     D. All  of  the  Above    ___  40.  True  of  community  ecology:   A. Niche  is  synonymous  with  habitat.   B. Habitat  is  a  pattern  of  living   C. Interspecific  competition  may  occur  within  their  niche.  iOATprep   www.ioatprep.com   iOATprep    
  9. 9. D. Habitat   is   described   in   terms   of   space   utilization,   food   consumption   and   temperature   range  to  name  a  few.          For  answers  go  to:  http://www.ioatprep.com/optometry-­‐admission-­‐test-­‐practice-­‐biology-­‐answer-­‐key.html        iOATprep   www.ioatprep.com   iOATprep    

×