Tema 3: Principios mendelianos y extensiones<br />1<br />1/2 A<br />1/2 a<br />1/2 A<br />AA<br />Aa<br />aa<br />Aa<br />...
Tema 3: Principios mendelianos y extensiones<br />2<br />Objetivos tema<br />Principios mendelianos y extensiones <br />De...
Ilustrar los dos principios de la transmisión de los genes (la leyes de Mendel)
Cruce monohíbrido y principio de la segregación 1:1
Cruce dihíbrido y principio de la transmisión independiente
La naturaleza probabilística de los principios mendelianos
Relaciones genotipo-fenotipo
La distinción entre dominancia incompleta, parcial y codominancia
Alelismo múltiple
Gen esencial y letal
Penetrancia y expresividad
Interacción entre genes
Genética bioquímica: la hipótesis un gen-una enzima</li></li></ul><li>Tema 3: Principios mendelianos y extensiones<br />3<...
sigue normas estadísticas sencillas, resumidas en sus dos principios</li></li></ul><li>Tema 3: Principios mendelianos y ex...
Tema 3: Principios mendelianos y extensiones<br />5<br />Características del experimento de Mendel :<br /><ul><li>Elección...
Cruces genéticos de líneas puras (línea verde x línea amarilla)
Análisis cuantitativos de los fenotipos de la descendencia (proporción de cada fenotipo en la descendencia)</li></li></ul>...
Tema 3: Principios mendelianos y extensiones<br />7<br />Los siete caracteres estudiados <br />por Mendel<br />
Tema 3: Principios mendelianos y extensiones<br />8<br />Polinización cruzada<br />Autofecundación<br />Método de cruzamie...
Tema 3: Principios mendelianos y extensiones<br />9<br />Resultados de todos los cruzamientos monohíbridos de Mendel<br />
Tema 3: Principios mendelianos y extensiones<br />10<br />Interpretación genética del cruce monohíbrido de Mendel <br />
Tema 3: Principios mendelianos y extensiones<br />11<br />1/2 A<br />1/2 a<br />1/2 A<br />AA<br />Aa<br />aa<br />Aa<br /...
Tema 3: Principios mendelianos y extensiones<br />12<br />Cruce dihíbrido<br />Gen Color <br />Y (amarillo) &gt; y (verde)...
Tema 3: Principios mendelianos y extensiones<br />13<br />Segunda ley de Mendel: Cruce dihíbrido<br />El cuadrado de Punne...
Tema 3: Principios mendelianos y extensiones<br />14<br />Segunda ley de Mendel:<br />Transmisión independiente<br />Duran...
Tema 3: Principios mendelianos y extensiones<br />15<br />Segunda ley de Mendel:<br />Razón genotípica<br />AABB Aabb aaBB...
Tema 3: Principios mendelianos y extensiones<br />16<br />Segunda ley de Mendel: Cruce trihíbrido<br />P<br />F1<br />AABB...
Tema 3: Principios mendelianos y extensiones<br />17<br />Segunda ley de Mendel: Cruce trihíbrido<br />abc<br />abC<br />a...
Tema 3: Principios mendelianos y extensiones<br />18<br />Naturaleza probabilística de las leyes Mendel:<br />Las leyes so...
Permiten inferir el número de genes que influyen sobre un carácter</li></li></ul><li>Tema 3: Principios mendelianos y exte...
Tipo sanguíneo
Braquidactilia (dedos de manos y pies cortos)
Hoyuelos de la mejilla
Lóbulos oreja sueltos o adosados
Pecas en la cara
Pulgar hiperlaxo
Polidactilia</li></ul> OMIM - Online Mendelian Inheritance in Man<br />http://www.ncbi.nlm.nih.gov/sites/entrez?db=OMIM<br />
Tema 3: Principios mendelianos y extensiones<br />20<br />Caracteres mendelianos<br />Albinismo<br />
Tema 3: Principios mendelianos y extensiones<br />21<br />Alelismo múltiple<br /><ul><li> Grupos AB0
Fenotipo     Genotipo</li></ul>   A-          AA ó A0<br />   B-          BB ó B0<br />   AB             AB<br />    0    ...
Tema 3: Principios mendelianos y extensiones<br />22<br />A nivel de secuencia nucleotídica prácticamente cada copia de un...
Upcoming SlideShare
Loading in …5

Tema3. Principios mendelianos y extensiones.


Published on

Contiene los siguientes apartados:
1.El método experimental y la terminología de Mendel
2. Ilustra los dos principios de la transmisión de los genes (la leyes de Mendel)
a) Cruce monohíbrido y principio de la segregación 1:1
b) Cruce dihíbrido y principio de la transmisión independiente
3. La naturaleza probabilística de los principios mendelianos
4.Relaciones genotipo-fenotipo
a) La distinción entre dominancia incompleta, parcial y codominancia
b) Alelismo múltiple
c) Gen esencial y letal
d) Pleiotropía
e) Penetrancia y expresividad
f) Interacción entre genes
5. Genética bioquímica: la hipótesis un gen-una enzima

  • Be the first to comment

  • Be the first to like this

No Downloads
Total views
On SlideShare
From Embeds
Number of Embeds
Embeds 0
No embeds

No notes for slide

Tema3. Principios mendelianos y extensiones.

  1. 1. Tema 3: Principios mendelianos y extensiones<br />1<br />1/2 A<br />1/2 a<br />1/2 A<br />AA<br />Aa<br />aa<br />Aa<br />1/2 a<br />Principios mendelianos y extensiones <br />Razón genotípica<br />1/4 AA<br />1/2 Aa<br />1/4 aa<br />Razón fenotípica<br />3/4 A-<br />1/4 aa<br />
  2. 2. Tema 3: Principios mendelianos y extensiones<br />2<br />Objetivos tema<br />Principios mendelianos y extensiones <br />Deberán quedar bien claros los siguientes puntos<br /><ul><li>El método experimental y la terminología de Mendel
  3. 3. Ilustrar los dos principios de la transmisión de los genes (la leyes de Mendel)
  4. 4. Cruce monohíbrido y principio de la segregación 1:1
  5. 5. Cruce dihíbrido y principio de la transmisión independiente
  6. 6. La naturaleza probabilística de los principios mendelianos
  7. 7. Relaciones genotipo-fenotipo
  8. 8. La distinción entre dominancia incompleta, parcial y codominancia
  9. 9. Alelismo múltiple
  10. 10. Gen esencial y letal
  11. 11. Pleiotropía
  12. 12. Penetrancia y expresividad
  13. 13. Interacción entre genes
  14. 14. Genética bioquímica: la hipótesis un gen-una enzima</li></li></ul><li>Tema 3: Principios mendelianos y extensiones<br />3<br />Los experimentos de Mendel demuestran que:<br /><ul><li>La herencia se transmite por elementos particulados (no herencia de las mezclas), y
  15. 15. sigue normas estadísticas sencillas, resumidas en sus dos principios</li></li></ul><li>Tema 3: Principios mendelianos y extensiones<br />4<br />Monje austriaco Gregor Mendel (1822-1884)<br />Jardín del monasterio agustino de Santo Tomás de Brunn, actual república Checa, donde Mendel realizó sus experimentos de cruces con el guisante<br />Mendel Web: http://www.mendelweb.org/<br />
  16. 16. Tema 3: Principios mendelianos y extensiones<br />5<br />Características del experimento de Mendel :<br /><ul><li>Elección de caracteres discretos, cualitativos (alto-bajo, verde-amarillo, rugoso-liso, ...)
  17. 17. Cruces genéticos de líneas puras (línea verde x línea amarilla)
  18. 18. Análisis cuantitativos de los fenotipos de la descendencia (proporción de cada fenotipo en la descendencia)</li></li></ul><li>Tema 3: Principios mendelianos y extensiones<br />6<br />Flor de la planta <br />del guisante, Pisum sativum<br />estudiada por Mendel<br />
  19. 19. Tema 3: Principios mendelianos y extensiones<br />7<br />Los siete caracteres estudiados <br />por Mendel<br />
  20. 20. Tema 3: Principios mendelianos y extensiones<br />8<br />Polinización cruzada<br />Autofecundación<br />Método de cruzamiento empleado por Mendel<br />
  21. 21. Tema 3: Principios mendelianos y extensiones<br />9<br />Resultados de todos los cruzamientos monohíbridos de Mendel<br />
  22. 22. Tema 3: Principios mendelianos y extensiones<br />10<br />Interpretación genética del cruce monohíbrido de Mendel <br />
  23. 23. Tema 3: Principios mendelianos y extensiones<br />11<br />1/2 A<br />1/2 a<br />1/2 A<br />AA<br />Aa<br />aa<br />Aa<br />1/2 a<br />Primera ley de Mendel: <br />Segregación equitativa<br />Los dos miembros de un par de alelos segregan en proporciones 1:1. La mitad de los gametos lleva un alelo y la otra mitad el otro alelo<br />Razón genotípica<br />1/4 AA<br />1/2 Aa<br />1/4 aa<br />Razón fenotípica<br />3/4 A-<br />1/4 aa<br />
  24. 24. Tema 3: Principios mendelianos y extensiones<br />12<br />Cruce dihíbrido<br />Gen Color <br />Y (amarillo) &gt; y (verde)<br />Gen textura semilla <br />R (liso) &gt; r (rugoso) <br />
  25. 25. Tema 3: Principios mendelianos y extensiones<br />13<br />Segunda ley de Mendel: Cruce dihíbrido<br />El cuadrado de Punnett ilustra los genotipos que dan lugar a las proporciones <br />9 : 3 : 3 : 1<br />
  26. 26. Tema 3: Principios mendelianos y extensiones<br />14<br />Segunda ley de Mendel:<br />Transmisión independiente<br />Durante la formación de los gametos la segregación de alelos de un gen es independiente de la segregación de los alelos en el otro gen<br />
  27. 27. Tema 3: Principios mendelianos y extensiones<br />15<br />Segunda ley de Mendel:<br />Razón genotípica<br />AABB Aabb aaBB<br />1/16:1/16:1/16:<br />aabb AaBb AABb<br />1/16:4/16:2/16:<br />aaBb AaBB Aabb<br />2/16:2/16:2/16<br />1/4 ab<br />1/4 aB<br />1/4 Ab<br />1/4 AB<br />AABB<br />AAbB<br />AaBB<br />AaBb<br />1/4 AB<br />1/4 Ab<br />AABb<br />AAbb<br />AabB<br />Aabb<br />1/4 aB<br />AaBB<br />AaBb<br />aaBB<br />aaBb<br />1/4 ab<br />AaBb<br />Aabb<br />aaBb<br />aabb<br />Razón fenotípica<br />9/16 A-B- 3/16 A-bb 3/16 aaB- 1/16 aabb<br />
  28. 28. Tema 3: Principios mendelianos y extensiones<br />16<br />Segunda ley de Mendel: Cruce trihíbrido<br />P<br />F1<br />AABBCC x aabbcc<br />AaBbCc x AaBbCc <br />abc<br />abC<br />aBc<br />aBC<br />Abc<br />AbC<br />ABc<br />ABC<br />AaBbCc<br />AaBbCC<br />AaBBCc<br />AaBBCC<br />AABbCc<br />AABbCC<br />AABBCc<br />AABBCC<br />ABC<br />AaBbcc<br />AaBbCc<br />AaBBcc<br />AaBBCc<br />AABbcc<br />AABbCc<br />AABBcc<br />AABBCc<br />ABc<br />AabbCc<br />AabbCC<br />AaBbCc<br />AaBbCC<br />AAbbCc<br />AAbbCC<br />AABbCc<br />AABbCC<br />AbC<br />Aabbcc<br />AabbCc<br />AaBbcc<br />AaBbCc<br />AAbbcc<br />AAbbCc<br />AABbcc<br />AABbCc<br />Abc<br />aaBbCc<br />aaBbCC<br />aaBBCc<br />aaBBCC<br />AaBbCc<br />AaBbCC<br />AaBBCc<br />AaBBCC<br />aBC<br />aaBbcc<br />aaBbCc<br />aaBBcc<br />aaBBCc<br />AaBbcc<br />AaBbCc<br />AaBBcc<br />AaBBCc<br />aBc<br />aabbCc<br />aabbCC<br />aaBbCc<br />aaBbCC<br />AabbCc<br />AabbCC<br />AaBbCc<br />AaBbCC<br />abC<br />aabbcc<br />aabbCc<br />aaBbcc<br />aaBbCc<br />Aabbcc<br />AabbCc<br />AaBbcc<br />AaBbCc<br />abc<br /> <br />
  29. 29. Tema 3: Principios mendelianos y extensiones<br />17<br />Segunda ley de Mendel: Cruce trihíbrido<br />abc<br />abC<br />aBc<br />aBC<br />Abc<br />AbC<br />ABc<br />ABC<br />AaBbCc<br />AaBbCC<br />AaBBCc<br />AaBBCC<br />AABbCc<br />AABbCC<br />AABBCc<br />AABBCC<br />AaBbcc<br />AaBbCc<br />AaBBcc<br />AaBBCc<br />AABbcc<br />AABbCc<br />AABBcc<br />AABBCc<br />AabbCc<br />AabbCC<br />AaBbCc<br />AaBbCC<br />AAbbCc<br />AAbbCC<br />AABbCc<br />AABbCC<br />Aabbcc<br />AabbCc<br />AaBbcc<br />AaBbCc<br />AAbbcc<br />AAbbCc<br />AABbcc<br />AABbCc<br />aaBbCc<br />aaBbCC<br />aaBBCc<br />aaBBCC<br />AaBbCc<br />AaBbCC<br />AaBBCc<br />AaBBCC<br />aaBbcc<br />aaBbCc<br />aaBBcc<br />aaBBCc<br />AaBbcc<br />AaBbCc<br />AaBBcc<br />AaBBCc<br />aabbCc<br />aabbCC<br />aaBbCc<br />aaBbCC<br />AabbCc<br />AabbCC<br />AaBbCc<br />AaBbCC<br />aabbcc<br />aabbCc<br />aaBbcc<br />aaBbCc<br />Aabbcc<br />AabbCc<br />AaBbcc<br />AaBbCc<br />Razón fenotípica <br />1<br />3<br />3<br />3<br />9<br />9<br />9<br />27<br />P<br />F1<br />AABBCC x aabbcc<br />AaBbCc x AaBbCc <br />ABC<br />ABc<br />AbC<br />Abc<br />aBC<br />aBc<br />abC<br />abc<br /> <br /> <br />
  30. 30. Tema 3: Principios mendelianos y extensiones<br />18<br />Naturaleza probabilística de las leyes Mendel:<br />Las leyes son probabilísticas (como si los alelos de los genes se cogieran al azar de urnas), no deterministas<br /><ul><li>Permiten predecir la probabilidad de los distintos genotipos y fenotipos que resultan de un cruce
  31. 31. Permiten inferir el número de genes que influyen sobre un carácter</li></li></ul><li>Tema 3: Principios mendelianos y extensiones<br />19<br />Caracteres mendelianos en humanos:<br /><ul><li>Capacidad de sentir el sabor de la feniltiocarbamida
  32. 32. Albinismo
  33. 33. Tipo sanguíneo
  34. 34. Braquidactilia (dedos de manos y pies cortos)
  35. 35. Hoyuelos de la mejilla
  36. 36. Lóbulos oreja sueltos o adosados
  37. 37. Pecas en la cara
  38. 38. Pulgar hiperlaxo
  39. 39. Polidactilia</li></ul> OMIM - Online Mendelian Inheritance in Man<br />http://www.ncbi.nlm.nih.gov/sites/entrez?db=OMIM<br />
  40. 40. Tema 3: Principios mendelianos y extensiones<br />20<br />Caracteres mendelianos<br />Albinismo<br />
  41. 41. Tema 3: Principios mendelianos y extensiones<br />21<br />Alelismo múltiple<br /><ul><li> Grupos AB0
  42. 42. A=B>0
  43. 43. Fenotipo Genotipo</li></ul> A- AA ó A0<br /> B- BB ó B0<br /> AB AB<br /> 0 00<br /><ul><li>Color pelaje conejo</li></ul>C+ &gt; Cch &gt; Ch &gt; c<br />
  44. 44. Tema 3: Principios mendelianos y extensiones<br />22<br />A nivel de secuencia nucleotídica prácticamente cada copia de un gen es diferente en algún nucleótido de su secuencia. El alelismo múltiple es ubicuo. <br />BRCA2<br />Individual 1acgtagcatcgtatgcgttagacgggggggtagcaccagtacag<br />Individual 2acgtagcatcgtatgcgttagacggggtggtagcaccagtacag<br />Individual 3acgtagcatcgtatgcgttagacggcggggtagcaccagtacag<br />Individual4acgtagcatcgtttgcgttagacgggggggtagcaccagtacag<br />Individual5acgtagcatcgtttgcgttagacgggggggtagcaccagtacag<br />Individual6acgtagcatcgtttgcgttagacggcatggcaccggcagtacag<br />Individual7acgtagcatcgtttgcgttagacggcatggcaccggcagtacag<br />Individual8acgtagcatcgtttgcgttagacggcatggcaccggcagtacag<br />Individual9acgtagcatcgtttgcgttagacggcatggcaccggcagtacag<br />Alelismo múltiple<br />
  45. 45. Tema 3: Principios mendelianos y extensiones<br />23<br />Se usa la notación AA, Aa y aa para denominar a los genotipos mendelianos que determinan un fenotipo, pero en realidad éstos son internamente heterogéneos en el nivel de DNA. Su asignación como genotipo AA ó aa se debe generalmente a que todas las secuencias que pertenecen al genotipo AA comparten un fenotipo distinto de los que pertenecen al genotipo aa y esta diferencia fenotípica se debe posiblemente a un (o a unos pocos) nucleótido que sería el verdadero genotipo que causa los diferentes fenotipos <br />Alelo A<br />Secuencia 11acgtagcatcgtatgcgttagacgggggggtagcaccagtacag<br />Secuencia 22acgtagcatcgtatgcgttagacggggtggtagcaccagtacag<br />Secuencia 33acgtagcatcgtatgcgttagacggcggggtagcaccagtacag<br />Secuencia 4 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag<br />Secuencia 5acgtagcatcgtttgcgttagacgggggggtagcaccagtacag<br />Secuencia 6acgtagcatcgtttgcgttagacggcatggcaccggcagtacag<br />Secuencia 77acgtagcatcgtttgcgttagacggcatggcaccggcagtacag<br />Secuencia 88acgtagcatcgtttgcgttagacggcatggcaccggcagtacag<br />Secuencia 9 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag<br />Alelo a<br />
  46. 46. Tema 3: Principios mendelianos y extensiones<br />24<br /><ul><li>Gen letal y esencial
  47. 47. Un gen que cuando está alterado es letal, es un gen esencial
  48. 48. Gen y del ratón doméstico es un ejemplo</li></ul>Alelo y es dominante para el color amarillo, letal en homocigosis. Alteración proporciones mendelianas de la F2 es 2:1<br />
  49. 49. Tema 3: Principios mendelianos y extensiones<br />25<br /><ul><li>Edad de aparición de un fenotipo
  50. 50. Temprana
  51. 51. Tardía</li></ul>Aparición tardía de la enfermedad de Huntington<br /><ul><li>Impronta parental
  52. 52. Ejemplo </li></ul>Factor crecimiento II tipo insulina (Igf2) en ratón. <br />Mutante homocigoto -&gt; enano. <br />El fenotipo del heterocigoto depende del origen del alelo<br />Alelo salvaje es paterno -&gt; fenotipo salvaje<br />Alelo salvaje es materno -&gt; fenotipo enano<br />
  53. 53. Tema 3: Principios mendelianos y extensiones<br />26<br />Relaciones genotipo-fenotipo<br />P1<br />Ausencia de <br />dominancia<br />en el Dondiego <br />de noche (Mirabilis jalapa)<br />F1<br />F2<br />
  54. 54. Tema 3: Principios mendelianos y extensiones<br />27<br />Cruce dihíbrido con ausencia de dominancia<br />Razón genotípica ?<br />1/4 A1B2<br />1/4 A2B1<br />1/4 A2B2<br />1/4 A1B1<br />A1A1B1B1<br />1/4 A1B1<br />1/4 A1B2<br />1/4 A2B1<br />1/4 A1B2<br />Número fenotipos distintos? Razón fenotípica ?<br />
  55. 55. Tema 3: Principios mendelianos y extensiones<br />28<br />Los número esperados de cruces mendelianos<br />Monohíbrido Dihíbrido Trihíbrido Regla general <br /> n=1 n=2 n=3 n<br /> 2 4 8 2n<br /> 1/4 1/16 1/64 (¼)n<br /> 2 4 8 2n<br /> 3 9 27 3n<br />Tipos de gametos en la F1<br />Proporción de homocigotos recesivos en la F2<br />Número de fenotipos distintos de la F2 suponiendo dominancia completa<br />Número de genotipos distintos de la F2 (o fenotipos si no hay dominancia)<br />
  56. 56. Tema 3: Principios mendelianos y extensiones<br />29<br />Relación genotipo-fenotipo: <br />Variación en la dominancia<br />
  57. 57. Tema 3: Principios mendelianos y extensiones<br />30<br />Relación genotipo-fenotipo: <br />Codominancia<br /><ul><li>Presencia de ambos fenotipos paternos en el heterocigoto
  58. 58. Grupo AB
  59. 59. Heterocigoto proteína detectada por electroforesis en hemoglobina </li></li></ul><li>Tema 3: Principios mendelianos y extensiones<br />31<br />Relación genotipo-fenotipo: <br />Niveles de dominancia<br />HbAHbA: Normal. HbSHbS: Anemia grave. HbAHbS: No anemia<br />
  60. 60. Tema 3: Principios mendelianos y extensiones<br />32<br />Relación genotipo-fenotipo: Retinoblastoma hereditario<br />R &gt; r en el nivel celular<br />pero <br />r &gt; R en el nivel del organismo<br />
  61. 61. Tema 3: Principios mendelianos y extensiones<br />33<br />Pleiotropía<br />Ejemplo anemia falciforme<br />Cambio de un nucleótido<br /> en el DNA del gen de<br /> la hemoglobina<br />Rápida destrucción de <br />los glóbulos rojos<br />Baja concentración de <br />oxígeno en lo tejidos<br />Daño <br />cerebral<br />Daños en <br />otros órganos<br />Anemia<br />Agregación de la hemoglobina S para <br />formar estructuras casi cristalinas en <br />aguja en los glóbulos rojos<br />Debilidad <br />física<br />Fallo <br />cardiaco<br />Parálisis<br />Función mental <br />disminuida<br />Fallo renal<br />Neumonía<br />Reumatismo<br />Problemas <br />circulatorios<br />Acumulación de células <br />falciformes en el bazo<br />Producción de hemoglobina S <br />en lugar de la A<br />Daño en<br />el bazo<br />Distorsión de los glóbulos rojos, <br />adquieren forma de hoz (falciforme)<br />
  62. 62. Tema 3: Principios mendelianos y extensiones<br />34<br />Penetrancia y expresividad<br />Ambos conceptos se refieren a la expresión fenotípica variable de ciertos genes<br />Penetrancia: Proporción de individuos en una población que presentan el fenotipo correspondiente a su genotipo. Si P &lt; 1 se habla de penetrancia incompleta<br />Expresividad: El grado de expresión individual de un fenotipo para un genotipo dado<br />
  63. 63. Tema 3: Principios mendelianos y extensiones<br />35<br />Expresividad<br />La polidactilia se manifiesta en grados distintos <br />
  64. 64. Tema 3: Principios mendelianos y extensiones<br />36<br />Expresividad<br />10 grados de expresividad variable en el carácter piel manchada en perros. <br />
  65. 65. Tema 3: Principios mendelianos y extensiones<br />37<br />Caracteres determinados por más de un gen<br />
  66. 66. Tema 3: Principios mendelianos y extensiones<br />38<br />Caracteres determinados por más de un gen<br />
  67. 67. Tema 3: Principios mendelianos y extensiones<br />39<br />Interacción entre genes: <br />dos o más genes determinan el fenotipo de un modo que alteran las proporciones mendelianas esperadas<br />
  68. 68. Tema 3: Principios mendelianos y extensiones<br />40<br />Tipos de interacción genética según la modificación de las proporciones mendelianas<br />9<br />3<br />3<br />1<br />13:3<br />9:7<br />9:3:4<br />12:3:1<br />15:1<br />A-B-<br />A-bb<br />aaB-<br />aabb<br /><ul><li>Mutación supresora 13:3
  69. 69. Duplicación génica recesiva 9:7
  70. 70. Epistasia recesiva 9:3:4
  71. 71. Epistasia dominante 12:3:1
  72. 72. Duplicación génica dominante 15:1</li></li></ul><li>Tema 3: Principios mendelianos y extensiones<br />41<br />Genética bioquímica: estudio de la relación entre genes y enzimas<br />Hipótesis un gen - una enzima (Beadle y Tatum 1941) -&gt; Estudio de la ruta biosintética de la niacina (vitamina B3 en el hongo del pan Neurospora crassa) <br />
  73. 73. Tema 3: Principios mendelianos y extensiones<br />42<br />Genética bioquímica: muchos genes cooperan en el producto final<br />
  74. 74. Tema 3: Principios mendelianos y extensiones<br />43<br />Explicación bioquímica de la proporción 9:7 <br />en el color de la aleurona del maíz<br />Precursor Intermediario Producto final<br /> blanco blanco púrpura<br />Enzima A<br />Enzima B<br />Gen A<br />Gen B<br />Para obtener el producto final púrpura necesitamos que tanto el gen A como el B produzcan una enzima funcional. Si uno de los dos genes falla (genotipo aa ó bb), el producto final será blanco<br />
  75. 75. Tema 3: Principios mendelianos y extensiones<br />44<br />Genética bioquímica: Relación concentración enzima y producto final<br />
