KUMPULAN SOAL PREDIKSI OLIMPIADE BIOLOGI UDAYANA

30,083 views

Published on

  • Be the first to comment

KUMPULAN SOAL PREDIKSI OLIMPIADE BIOLOGI UDAYANA

  1. 1. KUMPULAN SOAL PREDIKSI OBU 2013  1. Dalam suatu ekosistem, organisme manakah yang memiliki jumlah terbanyak? A. Produsen B. Konsumen primer C. Konsumen sekunder D. Konsumen tersier E. Tergantung iklim yang ada pada ekosistem tersebut 2. Fiksasi nitrogen dalam siklus nitrogen dapat dilakukan melalui beberapa cara di bawah ini kecuali: A. Mikroorganisme yang ada di dalam tanah B. Proses industri melalui temperatur dan tekanan yang tinggi C. Mikroorganisme dalam nodul-nodul akar pada tumbuhan leguminose D. Beberapa jenis tumbuhan yang dapat mengabsorbsi langsung gas nitrogen E. Ketika terjadi petir/kilat di langit 3. Manakah diantara pernyataan di bawah ini yang menunjukkan proses nitrifikasi pada siklus nitrogen: A. Konversi dari ion amonium menjadi nitrat B. Konversi dari ion amonium menjadi nitrit C. Konversi dari gas nitrogen menjadi nitrit D. Konversi dari gas nitrogen menjadi nitrat E. Konversi dari nitrit menjadi nitrat 4. Manakah dari pernyataan di bawah ini yang paling tepat dalam mendeskripsikan peran detritivor dalam siklus karbon ? A. Merupakan mikroorganisme yang memisahkan senyawa organik dari materi yang telah mati B. Merupakan jamur yang menggunakan pencernaan ekstra-selular untuk memisahkan senyawa organik dari materi yang telah mati C. Merupakan organisme yang memakan kotoran makhluk hidup D. Merupakan hewan yang memperluas permukaan materi-materi yang sudah mati untuk dekomposer E. Merupakan hewan yang memisahkan senyawa organik dari materi yang telah mati 5. Manakah dari pernyataan di bawah ini yang menunjukkan faktor yang bergantung pada kepadatan populasi (density dependent factor) yang mengendalikan kepadatan suatu populasi : I. Insektisida yang digunakan untuk mengendalikan serangga hama II. Tupai yang bertahan hidup pada periode musim dingin III. Berkurangnya populasi burung karena kurangnya sumber makanan pada musim dingin IV. Meningkatnya hama wereng pada pertengahan musim tanam padi V. Siput dalam jumlah besar yang makan pada beberapa tanaman kubis Pilihlah salah satu jawaban yang benar di bawah ini: A. I dan II B. I, II, dan III C. III dan IV
  2. 2. D. III E. III, IV, dan V 6. Dari grafik kelulushidupan di bawah ini pilihlah penyataan mana yang benar : A. X = populasi ikan; Y = populasi burung; Z = populasi mamalia B. X = populasi mamalia; Y = populasi burung; Z = populasi ikan C. X = populasi burung; Y = populasi ikan; Z = populasi burung D. X = populasi burung; Y = populasi mamalia; Z = populasi ikan E. X = populasi mamalia; Y = populasi ikan; Z = populasi burung 7. Berdasarkan grafik pertumbuhan ragi di bawah ini, fase manakah yang menunjukkan “faktor internal“ sedang berperan pada populasi ragi tersebut : Pilihlah salah satu jawaban yang benar : A. I B. II C. I dan II D. III dan IV E. IV 8. Berdasarkan grafik pertumbuhan ragi di atas, disebut fase apakah fase III ? A. Fase Lag B. Fase Log C. Fase Leg D. Fase Stasioner E. Fase Penurunan 9. Tupai merah adalah hewan asli yang ada di kepulauan Inggris. Pada tahun 1876, tupai abu- abu Amerika dimasukkan ke Inggris yang menyebabkan punahnya tupai merah Inggris. Tupai merah Inggris saat ini hanya ditemukan di pulau-pulau yang tidak terdapat tupai abu-abu Amerika di dalamnya. Manakah diantara pernyataan di bawah ini yang paling benar ? A. Tupai merah dan abu-abu berbagi habitat dan relung yang sama B. Tupai merah dan abu-abu berbagi habitat yang sama C. Tupai merah dan abu-abu berbagi relung yang sama D. Tupai abu-abu menyerang tupai merah E. Tupai merah bermigrasi ke daerah yang tidak terdapat tupai abu-abu 10. Manakah berikut ini yang mungkin terjadi di dalam suatu ekosistem? A. Ketika jumlah mangsa menurun, jumlah predator meningkat. B. Ketika jumlah predator meningkat, jumlah mangsa meningkat. C. Ketika jumlah mangsa meningkat, jumlah predator meningkat. D. Ketika jumlah mangsa meningkat, jumlah predator menurun. E. Ketika jumlah predator menurun, jumlah mangsa menurun. 11. Pernyataan manakah yang paling baik menyimpulkan hubungan tersebut? A. Ketika puncak piramid dicapai, jumlah individu menurun tapi jumlah energinya meningkat. B. Ketika puncak piramid dicapai, jumlah individu meningkat, dan jumlah energi tetap sama dengan tingkatan lainnya. C. Pada dasar piramid, jumlah individu dan jumlah energi yang terlibat adalah paling
  3. 3. besar. D. Pada dasar piramid, jumlah individu dan jumlah energi yang terlibat adalah paling rendah. E. Pada semua tingkat, jumlah individu dan jumlah energi yang terlibat adalah 12. Kelinci menjadi ancaman di Australia karena.... A. mereka memindahkan ‘rabbit fever’ ke kangguru. B. liang mereka di dalam tanah berbahaya bagi ternak. C. tidak adanya musuh alami menyebabkan mereka berbiak tak terbatas. D. mereka menyebabkan myxomatosis bagi bayi-bayi yang baru lahir. E. mereka mengambil nutrisi yang berharga dari tanah. 13. Pada khatulistiwa, tipe pertumbuhan taiga.... (taiga:kutub utara) A. tidak mungkin. B. terjadi hanya di musim dingin. C. terjadi di lorong-lorong yang dalam. D. terjadi di gunung-gunung yang tinggi. E. terjadi hanya di gurun. 14. Dibandingkan dengan daratan, suhu bioma laut.... A. di bawah titik beku. B. lebih stabil. C. kurang stabil. D. lebih sedikit menyerap radiasi sinar matahari. E. memiliki kondisi ekstrim yang lebih. 15. Keanekaragaman spesies dalam suatu komunitas ditentukan oleh: A. frekuensi relatif spesies B. kelimpahan relatif spesies C. kekayaan/jumlah spesies D. A dan B benar E. B dan C benar 16. Sejenis ulat mempertahankan dirinya dari predator dengan cara membesarkan kepalanya sehingga menyerupai kepala ular yang ganas. Pertahanan seperti ini adalah contoh dari: A. mimikri Müllerian; DAPAT DIMAKAN SEPERTI TIDAK DAPAT DIMAKAN B. mimikri Batesian C. pertahanan aposematik D. pertahanan mekanis E. kamouflase 17. Kompetisi antara populasi dua spesies dengan relung (niche) yang hampir sama, pada akhirnya dapat mengakibatkan terjadinya: A. eliminasi (penyingkiran) populasi yang kalah bersaing B. pembagian sumber daya (resource partitioning) melalui seleksi alam C. proses koevolusi? D. jawaban A dan B benar E. jawaban A dan C benar 18. Fenomena menempelnya teritip/kerang-kerang kecil pada tubuh paus di laut dapat menggambarkan bentuk interaksi: A. Komensalisme
  4. 4. B. kompetisi C. mutualisme D. A dan B benar E. A, B, dan C benar. 19. Berkaitan dengan fenomena gangguan (disturbance) pada ekosistem, pernyataan yang tidak benar adalah bahwa gangguan …… A. dapat merusak komunitas biologi B. dapat membantu pencapaian equilibrium C. dapat menghilangkan organisme dari komunitas D. dapat mengubah ketersediaan sumber daya E. dapat menurunkan keanekaragaman 20. Hubungan antara dua spesies di alam seringkali sulit diklasifikasikan ke dalam salah satu bentuk interaksi sederhana yang dilihat berdasarkan manfaat & kerugian (mis. predasi, mutualisme dsb.). Contoh fenomena yang dapat menggambarkan lebih dari satu bentuk interaksi adalah ………. A. Tumbuhan Ficus (strangler fig) yang menjadi epifit pada pohon B. alelopati oleh tumbuhan C. penaungan tumbuhan herba oleh pohon yang lebih tinggi D. tidak ada yang benar E. semua benar 21. Tabel di bawah menunjukkan data kehadiran dan kelimpahan untuk spesies yang ditemukan pada empat komunitas ekologis. Berdasarkan data tersebut, simpulkanlah komunitas mana yang keanekaragaman spesiesnya paling tinggi. Spesies Komunitas I Komunitas II Komunitas III Komunitas IV Sp. 1 210 1243 1233 1341 Sp. 2 1233 1245 1144 98 Sp. 3 2004 1239 0 101 Sp. 4 0 1240 1547 1109 A. Komunitas I B. Komunitas II C. Komunitas III D. Komunitas IV E. Komunitas II dan IV 22. Grafik di bawah ini menunjukkan perubahan biomass basah untuk jagung, tomat, dan kacang dengan umur yang kira-kira sama pada satuan luas yang sama. Berdasarkan grafik di atas, manakah dari pernyataan di bawah ini yang benar? A. Pada minggu pertama, biomassa basah jagung mendekati dua kali biomassa basah tomat B. Selama pengamatan, ketiga jenis tumbuhan mengalami pertumbuhan C. Pada minggu kedua, biomassa kering tomat lebih besar daripada kacang D. Pada minggu ketiga, panen tegakan tomat adalah sama dengan biomassanya E. Semua benar 23. Semua populasi berikut ini kemungkinan besar pola penyebaran seragam, kecuali: A. Penguin yang bersarang pada suatu pantai yang sempit B. Teritori beruang di suatu hutan
  5. 5. C. Perdu perennial (spesies tertentu) yang tumbuh di habitat gurun D. Pohon tropis (spesies tertentu) di hutan hujan tropis E. Singa-singa di savanna 24. Pada suatu ekosistem, organisme manakah yang memiliki jumlah terkecil? A. Produsen B. Konsumen primer C. Konsumen sekunder D. Konsumen tersier E. Tergantung iklim yang ada pada ekosistem tersebut 25. Ketersediaan fosfor dalam siklus fosfor dapat dilakukan dari : A. Hasil dekomposisi materi organik tumbuhan dan hewan yang mati B. Proses industri melalui temperatur dan tekanan yang tinggi C. Mikroorganisme dalam nodul-nodul akar pada tumbuhan leguminose D. Mikroorganisme yang ada di dalam tanah E. Ketika terjadi petir/kilat di langit 26. Manakah diantara pernyataan di bawah ini yang menunjukkan proses denitrifikasi pada siklus nitrogen: A. Konversi dari ion amonium menjadi nitrat B. Konversi dari ion amonium menjadi nitrit C. Konversi dari nitrat menjadi nitrogen D. Konversi dari nitrogen menjadi ion amonium E. Konversi ion amonium menjadi amoniak 27. Manakah dari pernyataan di bawah ini yang paling tepat dalam mendeskripsikan peran dekomposer dalam siklus karbon ? A. Merupakan mikroorganisme yang memisahkan senyawa organik dari materi yang telah mati B. Merupakan jamur yang menggunakan pencernaan ekstra-selular untuk memisahkan senyawa organik dari materi yang telah mati C. Merupakan organisme yang memakan kotoran makhluk hidup D. Merupakan hewan yang mengubah materi anorganik menjadi materi organik E. Merupakan hewan yang memisahkan senyawa organik dari materi yang telah mati 28. Burung berkicau spesies A diketahui memiliki waktu periode kritis antara 10 hingga 50 hari. Seekor burung spesies A yang baru menetas dipelihara dalam kandang yang terisolasi, tetapi saat burung tersebut berumur 2 s/d 7 minggu, burung tersebut diberi kesempatan untuk mendengarkan burung berkicau spesies B. Setelah berumur 1 tahun : A. burung spesies A tersebut akan memiliki nyanyian sama seperti burung spesies A Lainnya B. burung spesies A tersebut akan memiliki nyanyian sama seperti burung spesies B C. burung spesies A tersebut akan memiliki nyanyian yang unik, tidak mirip nyanyian burung spesies maupun spesies B D. burung spesies A tersebut tidak akan bisa bernyanyi. 29. Sekelompok peneliti melakukan kajian hubungan antara beberapa induk kera dan anak- anaknya menggunakan induk semang buatan yang menyusui anak-anak kera tersebut. Setiap induk semang buatan memiliki ciri-ciri yang sama dengan induk asli kera tersebut, maupun ciri-ciri yang berbeda. Dua (2) induk semang buatan digunakan dalam kajian tersebut; satu (1) ekor dibuat dari kayu yang dicat, memiliki muka yang sangat mirip dengan
  6. 6. induk kera asli (induk semang A), satu (1) ekor lagi juga dibuat dari kayu, tidak dicat, tetapi diberi pakaian berbulu yang sangat mirip seperti induk aslinya (induk semang B). Kedua induk buatan (A dan B) dapat diberi botol berisi susu. Kelompok anak kera pertama (I) di tempatkan dengan induk semang A dan B, tetapi hanya induk semang B yang memiliki botol berisi susu. Kelompok anak kera kedua (II) jumlahnya sama dengan kelompok I, di tempatkan dengan induk semang A dan B, tetapi hanya induk semang A yang memiliki botol berisi susu. Kedua kelompok (I dan II) dikondisikan secara seragam (baik secara fisiologis maupun faktor lingkungan yang mempengaruhinya). Grafik dibawah ini menggambarkan umur anak kera (hari) dengan lama setiap kelompok anak kera menghabiskan waktu (jam/hari) bersama induk semang buatan. Garis B1 adalah kelompok I yang diberi susu oleh induk semang B Garis A1 adalah kelompok I yang diberi susu oleh induk semang A Garis B2 adalah kelompok II yang diberi susu oleh induk semang A Garis A2 adalah kelompok II yang diberi susu oleh induk semang B Dari keterangan dan data diatas, dapat diketahui bahwa kondisi fisik induk semang buatan dapat menarik perhatian anak-anak kera, kondisi fisik tersebut adalah : A. Warna dari tubuh induk semang kera B. Muka induk semang kera C. Ukuran tubuh induk semang kera D. Tekstur tubuh induk semang kera E. Dari semua keterangan diatas belum cukup dibuat kesimpulan 30. Pernyataan manakah yang benar dan didukung oleh data dari kajian di atas A. Kontak antara induk semang buatan dan beberapa kelompok anak kera saat periode menyusui tidak memberikan keuntungan fisiologis B. Penempatan jenis botol susu pada induk semang dapat menolong anak kera dalam mengenal induknya C. Seluruh anak kera dapat mengenali induk kera, sehingga semua jenis induk semang buatan dapat digunakan sebagai penganti induk asli D. Induk semang buatan yang tidak memberikan susu tidak disukai oleh anak kera E. Kelompok anak kera meluangkan waktu yang lebih banyak berhubungan dengan induk semang buatan yang sesuai 31. Dari kajian diatas, untuk mengetahui daya pikat induk semang B dengan lebih baik lagi, sebaiknya dilakukan : A. Kajian dengan perlakuan seperti diatas diulang dan ditambahan induk semang asli B. Perlakuan percobaan sudah cukup dan kajian dapat dilanjutkan hingga umur tertentu C. Kajian dilanjutkan, setelah periode waktu tertentu anak-anak kera tersebut ditempatkan kembali dengan induk aslinya. D. Kawinkan kelompok A1, A2, B1 dan B2, kemudian lakukan pengamatan terhadap Keturunannya 32. Pembuatan jaring oleh laba-laba merupakan contoh dari…. a. insting
  7. 7. b. 'conditioned reflex' c. tindakan yang diperoleh, otomatis d. kebiasaan e. cara belajar 'trial and error' 33. Seekor hamster melalui labirin untuk pertama kalinya dengan.... a. insting b. 'trial and error' c. kebiasaan d. 'reasoning' e. 'conditioned reflex' 34. Memainkan piano adalah contoh dari.... a. kebiasaan b. 'inborn activity' c. insting d. 'conditioned reflex' e. refleks 35. Mengerjakan persoalan matematika adalah contoh dari.... a. 'involuntary act' b. 'voluntary act' c. insting d. tropisme e. refleks 36. Gunakan pilihan di bawah ini untuk menjawab pertanyaan 1 dan 2. a. Pengkondisian klasik b. ‘imprinting’ c. Insting d. ‘observational learning’ e. ‘trial and error learning’ Monyet liar Jepang memakan gandum yang tersebar di pantai. Dalam hal ini monyet perlu mengumpulkan butiran gandum satu demi satu dan memisahkannya dari butiran pasir. Seekor monyet mengetahui bahwa dengan melempar segenggam pasir ke laut, pasirnya akan tenggelam dan gandumnya akam mengapung. Ia kemudian dapat dengan mudah mengumpulkan gandum-gandum tersebut. Tak lama kemudian monyet-monyet lain di dalam kelompok tersebut ikut melakukan hal yang sama untuk memisahkan gandum tersebut dan pasir. Teknik pembelajaran yang digunakan oleh monyet ketika ia menentukan bahwa ia dapat memisahkan pasir dan gandum menggunakan air, adalah…‘trial and error learning’ 37. Teknik pembelajaran yang digunakan oleh monyet-monyet lain dalam kelompok, yaitu… ‘observational learning’ 38. Pelatihan anjing untuk mengikuti perintah (seperti jalan, duduk, diam) melibatkan pengaturan pola kelakuan yang mana ? a. Imprinting b. Conditioning c. Mimikri
  8. 8. d. ‘Habituation’ e. Insting 39. Aphis indica atau A. melefera dapat menentukan secara tepat lokasi makanannya karena individu lain dalam kelompoknya dapat melakukan suatu tarian, contoh tingkah laku tersebut digambarkan seperti dibawah ini. Berdasarkan contoh tsb dari lebah madu yang melakukan tarian bawah ini, dimana letak lokasi sumber makanannya ? 40. Nyanyian yang dilakukan oleh burung merupakan suatu perilaku oleh proses belajar. Burung jantan menggunakan nyanyiannya untuk menguasai suatu teritori tertentu dan menarik betinanya untuk berkopulasi. Hal tersebut dapat terjadi dikarenakan : a. Testosterone pada burung dapat menyebabkan perkembangan otak sebagai organ yang bertanggung jawab agar burung tersebut dapat bernyanyi b. Nyanyian burung diatur oleh gen yang memberikan pengaruh pada otak burung tersebut c. Testosterone yang dihasilkan kelenjar eksokrin menyebabkan perkembangan otak, sehingga burung betina dapat mengenali nyanyian burung jantan d. Nyanyian burung diatur oleh sekitar 20 gen yang bertanggung jawab dalam perilaku kawin 41. Seseorang memberi makan ikan di aquarium pada jam yang sama setiap harinya. Suatu saat ia mendekati aquarium pada jam yang sama tanpa memberi makan. Ikan tersebut tetap berenang ke permukaan seolah-olah akan mendapat makanan. Peristiwa ini dikenal sebagai : A. operant conditioning B. classical conditioning C. habituation D. instinct E. imprinting 42. Contoh sederhana dari proses belajar yang mengakibatkan hilangnya sensitivitas adalah A. reasoning B. imprinting C. classical conditioning D. habituation E. instinct 43. Seseorang memberi makan ikan di aquarium pada jam yang sama setiap harinya. Suatu saat ia mendekati aquarium pada jam yang sama tanpa memberi makan. Ikan tersebut tetap berenang ke permukaan seolah-olah akan mendapat makanan. Peristiwa ini dikenal sebagai : A. operant conditioning B. classical conditioning C. habituation D. instinct E. imprinting 44. Apabila suatu hewan belajar agar memiliki asosiasi yang kuat dengan organisme lain selama periode singkat dalam tahap perkembangannya disebut A. conditioning B. imprinting
  9. 9. C. reinforcement D. habituation E. trial and error learning 45. Komunikasi pada hewan merupakan suatu perilaku yang terdiri dari “displays” dan “signal”. Displays dan signal bergantung pada anatomi dan fisiologi hewan tersebut. Bombyx mori betina yang berada sekitar 4 km dari lawan jenisnya dapat terdeteksi oleh jantannya. Hal tersebut dapat terjadi dikarenakan B. mori betina dan jantan dapat berkomunikasi dengan bantuan : A. alomon B. feromon C. kairomon D. alo-kairomon E. alelokemi 46. Burung bernyanyi, tupai bercakap-cakap, harimau meninggalkan fesesnya di suatu tempat tertentu, dan serigala mengeluarkan urin. Keseluruhan hal tersebut merupakan : A. tanda bahaya bagi anggota populasinya B. menandai daerah teritorinya C. menarik lawan jenisnya untuk kawin D. menyatakan dominansi di dalam habitatnya E. mempertahankan diri dari predatornya 47. “Suatu struktur diperoleh, membesar, tereduksi atau hilang melalui penggunaan dan penghentian penggunaan. Perubahan tersebut diturunkan pada generasi berikutnya.” Pendapat tersebut adalah pendapat …. A. Darwin B. Lamarck C. Mendel D. Wallace E. Oparin 48. Pada fenomena manakah berikut ini pengamatan Darwin tentang burung finch di kepulauan Galapagos menjadi contoh klasik? A. Kesetimbangan Hardy-Weinberg B. Spesiasi simpatrik C. Radiasi adaptif D. Evolusi konvergen E. Ketidakmampuan untuk terbang 49. Pada situasi manakah berikut ini evolusi berjalan paling lambat untuk suatu populasi ‘inter- breeding’? migrasi tekanan seleksi variasi karena mutasi …. A. tidak ada rendah rendah B. tidak ada tinggi tinggi C. tinggi rendah tinggi D. tinggi tinggi rendah E. tinggi tinggi tinggi 50. Yang dimaksud dengan struktur analog adalah .... A. struktur yang memiliki karakter anatomi dasar yang sama, asal evolusi yang berbeda, tapi dapat digunakan untuk fungsi yang sama.
  10. 10. B. struktur yang memiliki karakter anatomi dasar yang sama, asal evolusi yang sama, tapi dapat digunakan untuk fungsi yang sama. C. struktur yang memiliki karakter anatomi dasar yang sama, asal evolusi yang berbeda, tapi dapat digunakan untuk fungsi yang berbeda. D. struktur yang memiliki karakter anatomi dasar yang berbeda, asal evolusi yang berbeda, tapi dapat digunakan untuk fungsi yang sama. E. struktur yang memiliki karakter anatomi dasar yang sama, asal evolusi yang sama, tapi dapat digunakan untuk fungsi yang berbeda. 51. Gunakanlah pilihan berikut ini untuk menjawab pertanyaan no. 5 dan 6. I. Leher jerapah. II. Berat bayi manusia pada waktu lahir. III. Populasi burung Finch di Galapagos. IV. Kadal Aristelliger kecil bermasalah dalam mempertahankan teritorinya, sedangkan yang besar mudah dimangsa burung hantu. V. Populasi Biston betularia pada waktu revolusi industri. VI. Resistensi DDT pada serangga. Seleksi stabilisasi (’stabilizing selection’) ditunjukkan oleh....: MENYUKAI KONDISI RATA-RATA A. II dan IV B. III dan VI C. II dan V D. IV saja E. III saja 52. Seleksi mengarahkan (’directional selection’) ditunjukkan oleh....MENYUKAI VARIAN EKSTRIM A. III, V dan VI B. I, II dan III C. II, III dan V D. I, V dan VI E. II, IV dan V 53. Berikut ini pernyataan yang salah adalah.... A. Seleksi alam bekerja pada individu. B. Evolusi adalah perubahan pada frekuensi alel dari suatu populasi. C. Seleksi alam mengarahkan populasi menjadi lebih sesuai terhadap lingkungannya. D. Materi genetik dari individu adalah genotip, sedangkan materi genetik dari populasi adalah ‘gene pool’. E. Seleksi alam menyebabkan perubahan genetik pada individual. 54. Dua spesies yang berbeda tidak dapat melakukan perkawinan karena adanya mekanisme isolasi reproduktif. Jika spesies yang serupa memiliki perbedaan struktural pada organ-organ reproduksinya, maka mekanisme isolasi reproduksi ini disebut dengan.... A. isolasi gametik B. isolasi perilaku C. isolasi mekanis D. isolasi temporal E. isolasi sterilisasi
  11. 11. 55. Jika kembar identik albino menikah dengan kembar identik berambut keriting, anak dari kedua pasangan secara genetis kemungkinan.... A. berbeda, karena adanya segregasi acak pada waktu meiosis induk. B. berbeda, karena tingginya kemungkinan terjadinya mutasi acak. C. identik, karena ‘gene pool’ yang sifatnya umum dari induk. D. identik, karena rendahnya kemungkinan mutasi. E. identik, kecuali terjadi pindah silang. 56. Manakah berikut ini yang merupakan kesamaan antara teori Darwin dan teori Lamarck mengenai evolusi? A. Adaptasi merupakan hasil dari perbedaan kesuksesan reproduksi. B. Evolusi mengarahkan organisme menjadi lebih kompleks. C. Adaptasi evolusioner merupakan hasil dari interaksi antara organisme dengan lingkungannya. D. Adaptasi merupakan hasil dari penggunaan dan penghentian penggunaan struktur anatomi. E. Catatan fosil mendukung pendapat bahwa spesies adalah tetap, tidak berubah. 57. Pada tahun 1889, biologiwan August Weissmann mencoba untuk mengetahui apakah ia dapat menghasilkan galur mencit tanpa ekor. Ia mengoperasi mencit untuk menghilangkan ekornya, lalu membiarkan mencit tersebut bereproduksi. Hasilnya, semua anak mencit memiliki ekor panjang. Ia mengulangi prosedur yang sama selama 22 generasi, dan selalu mendapatkan hasil yang sama. Hasil penelitiannya membantu menolak teori.... A. 'natural selection' B. 'survival of the fittest' C. 'struggle for existence' D. 'inheritance of acquired characteristics' E. 'continuity of germplasm' 58. Semua pernyataan berikut ini mengenai evolusi adalah benar, kecuali.... A. makhluk hidup mengalami perubahan. B. makhluk hidup modern berkembang dari organisme yang lebih sederhana. C. evolusi telah berlangsung selama jutaan tahun. D. evolusi masih terus berlangsung. E. evolusi telah berhenti. 59. Adanya celah insang pada embrio kelinci mengindikasikan bahwa ….. A. kelinci bernapas dengan insang pada tahap gastrula. B. kelinci adalah turunan dari amfibi. C. vertebrata memiliki nenek moyang yang sama. D. sifat-sifat yang diperoleh dapat diturunkan. E. teori regenerasi mungkin benar. 60. Uji presipitin membantu memperkokoh bukti evolusi dalam bidang ….. A. anatomi B. biokimia komparatif C. embriologi D. 'breeding' hewan dan tumbuhan E. distribusi geografis
  12. 12. 61. Menurut Lamarck, evolusi terjadi sebagai hasil dari…. A. seleksi alam B. teori rekapitulasi C. overproduksi D. 'blending inheritance' E. 'inheritance of acquired characteristics' 62. Menurut Weismann, perubahan pada.... A. somatoplasma diturunkan. B. plasma nutfah diturunkan. C. somatoplasma dan plasma nutfah diturunkan. D. sel-sel tubuh diturunkan. E. sel-sel tubuh dan plasma nutfah diturunkan. 63. Supaya populasi ikan cod tetap konstan, jumlah telur yang diproduksi oleh satu ikan cod yang harus sintas adalah.... A. 1 B. 2 C. 4 D. 1 juta E. 10 juta 64. Dalam perjuangan untuk bertahan hidup, hewan-hewan yang sintas adalah yang.... A. Paling besar B. Paling kuat C. Paling cepat D. Paling berat E. Paling fit 65. Berdasarkan prinsip Hardy-Weinberg, 'gene pool' dapat tetap stabil jika terdapat.... A. perkawinan acak B. banyak mutasi C. migrasi yang sering D. perkawinan yang tidak acak E. mutasi acak 66. Hasil persilangan F1 pada persilangan dihibrid yang dilakukan Mendel menghasilkan perbandingan 9;3;3;1. Hal ini terjadi karena semua sifat terletak pada kromosom yang berbeda. Namun apa bila kedua sifat terletak pada kromosom yang sama maka hasil persilangan F1-nya adalah..... A. tetap 9:3:3:1 B. 1:1 C. 9:3:4 D. 12:3:1 E. 9:7 67. Pada golongan darah terdapat tiga jenis alel, IA, IB, IO. Apabila seseorang memiliki alel IAIB di dalam tubuhnya maka orang tersebut memiliki golongan darah AB. Sifat alel IAIB dalam pembentukan golongan darah AB disebut.... A. Kodominan
  13. 13. B. Epistasis C. Interaksi alel D. Kriptomeri E. Inkomplit dominan 68. Dua ekor ayam disilangkan dan diperoleh keturunan sebagai berikut: 10 walnut dan 3 rose. Berdasarkan keterangan diatas, maka genotip dari kedua induk adalah..... A. rrPp dan RRPp B. RrPP dan RRPp C. rrPP dan rrPp D. RrPP dan rrpp E. RrPp dan rrPP 69. Seorang ibu carrier terhadap sifat buta warna menikah dengan laki-laki normal. Apabila pasangan keluarga tersebut berharap memiliki 3 anak lelaki, maka peluang keluarga tersebut memiliki dua anak laki-laki normal dan satu buta warna adalah...... A. 4.7% B. 1.56% C. 12.5% D. 18.75% E. 6.25% 70. Berat buah labu ditentukan oleh beberapa gen yang dikenal dengan istilah poligeni. Labu dengan genotip AABbcc memiliki berat buah 27 gr sedangkan labu dengan genotip AaBBCc memiliki berat buah 30 gr. Berdasarkan keterangan tersebut tentukanlah jumlah fenotip dari hasil persilangan kedua labu tersebut! A. 6 fenotip B. 4 fenotip C. 5 fenotip D. 9 fenotip E. 7 fenotip 71. Pada lalat buah diketahui bahwa sayap panjang (V) dominan terhadap sayap pendek (v) dan mata merah (M) dominan terhadap mata coklat (m). Seekor lalat yang heterozigot terhadap kedua sifat disilangkan dengan lalat yang homozigot resesif untuk kedua sifat. Hasil persilangannya adalah sebagai berikut: 180 ekor sayap panjang mata coklat; 35 ekor sayap panjang ekor sayap panjang mata merah; 33 ekor sayap pendek mata coklat; 182 ekor pendek mata merah. Berdasarkan informasi diatas maka pernyataan berikut yang benar adalah.... A. Gen yang mengatur panjang sayap dan dan warna mata terletak pada kromosom yang Sama B. Gen yang mengatur panjang sayap dan warna mata terletak pada kromosom yang terpisah C. Gen yang mengatur warna mata terpaut kromosom seks sedangkan gen yang mengatur panjang sayap terletak pada autosom
  14. 14. D. Kedua gen terpaut dan pada saat pembentukan gamet terjadi peristiwa pindah silang. E. Kedua gen bersifat kodominan. 72. Pada suatu populasi yang terdiri atas 1000 penduduk diketahui bahwa jumlah orang yang bergolongan darah O adalah adalah 16% dari jumlah penduduk dan jumlah penduduk yang bergolongan darah AB dan B masing-masing adalah 100 dan 90 orang. Tentukanlah frekuensi alel IA pada populasi tersebut. A. 0.5 B. 0.2 C. 0.4 D. 0.7 E. 0.6 73. Populasi dengan alel T dan t yang seimbang memiliki 36% individu dalam populasi dengan fenotip resesif. Tiba-tiba kondisi lingkungan berubah dan menyebabkan kematian dari semua individu yang homozigot dominan sebelum mencapai usia dewasa. Setelah kejadian tersebut, kondisi lingkungan kembali normal. Berapa frekuensi alel T setelah satu generasi? A. 0,4. B. 0,26. C. tidak dapat ditentukan D. 0,7. E. 0,58. 74. Seorang wanita bergolongan darah O Rh- menikah dengan laki-laki dengan golongan darah AB Rh+. Apabila anak pertama mereka adalah laki-laki A Rh- maka pernyataan berikut yang tepat adalah.... A. Peluang untuk memperoleh anak kedua perempuan dengan golongan darah A dan Rh+ adalah 0% B. Peluang memperoleh anak kedua perempuan, bergolongan darah B dan Rh+ adalah 12.5% C. Jika anak kedua adalah Rh+ dan bergolongan darah A maka kemungkinan anak ketiga lahir normal adalah 12.5% D. Probabilitas anak kedua bergolongan darah A dan AB adalah sama E. Probabilitas anak bergolongan darah O sama dengan Probabilitas anak A dan B 75. Seorang laki dengan genotip AaBaCCDd (A dengan D terpaut). Apabila ia menghasilkan sperma, maka jumlah gamet yang dapat dibentuknya adalah.... A. 4 B. 8 C. 16 D. tidak dapat ditentukan E. 2 76. Haemofilia merupakan penyakit menurun yang terpaut seks dan bersifat resesif. Jika seorang wanita yang ayahnya haemofilia menikah dengan laki-laki normal. Berapakah kemungkinan pasangan tersebut memiliki anak laki-laki yang menderita haemofilia? A. 0% B. 25% C. 50% D. 75% E. 100%
  15. 15. 77. Jika A menunjukan alel dominan dan a adalah alel resesif, apakah genotip dari orang tua yang menghasilkan 300 keturunan dengan sifat dominan dan 100 keturunan dengan sifat resesif? A. AA x AA B. AA x Aa C. AA x aa D. Aa x aa E. Aa x Aa 78. Bagaimana jenis lilin telinga diturunkan? A. Lilin lengket dominan B. Lilin kering dominan C. Ada epistasis D. Tidak mungkin ditentukan berdasarkan data yang diberikan 79. Mengapa tidak ada rasio 1 : 1 atau 3 : 1 pada data tabel di atas? A. Jumlah anak terlalu sedikit B. Genotipe pasangan orang tua dengan fenotipe yang sama belum tentu sama. C. Tidak ada orang tua yang homozigot resesif D. Tidak ada orang tua yang homozigot dominan 80. Penyakit galaktosemia merupakan penyakit akibat gen resesif dan gejala penyakit dapat dikurangi dengan membatasi jumlah laktosa dan glukosa yang dimakan. Ida dan Adi sama- sama heterozigot untuk gen galaktosemia. Bila Ida melahirkan dua anak kembar fraternal berapa probabilitas kedua anak adalah perempuan yang sakit galaktosemia? 81. Bila Ida dan Adi mempunyai empat anak (tidak ada yang kembar), berapa probabilitas paling sedikit satu anak sakit galaktosemia? anak perempuan dan menderita adalah 1/16*1/4=1/64 82. Kebotakan pada manusia dianggap sebagai sifat yang dikendalikan oleh suatu alel B, gen autosom. Anggapan yang lebih mendalam yaitu bahwa alel tersebut adalah dominan pada pria dan resesif pada wanita, ”dipengaruhi jenis kelamin”. Jika seorang pria botak dan seorang wanita tidak botak, dalam suatu populasi perkawinan acak yang terdiri dari 51% pria berkepala botak, memiliki satu orang anak, berapa kemungkinan bahwa anak-anaknya menjadi botak? 83. Beberapa lalat CcDd disilangkan dengan lalat ccdd. Keturunannya: 903 Cc Dd, 897 cc dd, 98 Cc dd dan 102 cc Dd. Jarak c d : ....................... CM 84. Pada pohon silisilah suatu keluarga, warna mata coklat adalah dominan, dan biru adalah resesif. Joan dan Jane kembar. Dari diagram di bawah, dapat ditentukan bahwa …. A. Thomas dan Mary homozigot untuk mata coklat. B. Joan dan Jane adalah kembar identik. C. Jane heterozigot untuk mata biru. D. Jane homozigot untuk mata biru. E. Joan dan Samuel homozigot untuk mata coklat. 85. Seorang petani memperoleh 252 bunga merah, 235 bunga putih, dan 503 bunga merah muda ketika ia menyilangkan bunga merah muda. Kesimpulan manakah yang dapat ditarik
  16. 16. dari informasi di atas? A. Fenotip hibrid sama dengan genotipnya. B. Fenotip tipe murni berbeda dengan fenotipnya. C. Fenotip hibrid berbeda dengan genotipnya. D. Keturunannya menunjukkan fenotip dari gen dominan. E. Semua pernyataan di atas salah. 86. Pria buta warna menikah dengan wanita normal yang heterozigot untuk pandangan warna. Bagaimanakah kemungkinan dua anak laki-laki mereka untuk buta warna? A. 0% B. 25% C. 50% D. 75% E. 100% 87. Jumlah kombinasi gen yang berbeda, yang mungkin dari gamet tumbuhan trihibrid TtYySs adalah …. A. 2 B. 4 C. 6 D. 8 E. 10 88. Jika sepasang marmot hitam hibrid dikawinkan, dan ada empat keturunan, kemungkinan fenotipnya adalah…. A. Semua hitam B. Tiga hitam, satu putih C. Dua hitam, dua putih D. Satu hitam, tiga putih E. Semua mungkin 89. Gambar 1 menggambarkan sebuah pendapat mengenai sejarah evolusi pada kerajaan tumbuhan. Anda diminta melengkapi gambar di atas dengan mengganti angka dengan karakter yang dimiliki oleh organisme di atas. Yaitu berurutan berdasarkan angka: A. Pembuluh, biji, berbunga B. Uniseluler, berspora, berstrobilus C. Metagenesis, rizoid, spora D. Multiseluler, reproduksi vegetatif, reproduksi generatif E. Rizoid, akar serabut, akar tunggang 90. Gambar 2 di atas menggambarkan siklus hidup lumut. Lengkapilah gambar di atas dengan pernyataan di bawah ini, berurutan dari angka 1 ke angka 2! A. Mitosis, meiosis B. Meiosis, meiosis C. Fertilisasi, amfimiksis D. Meiosis, fertilisasi E. Mitosis, gametofit 91. Pada gambar 3 di atas, angka nomor 5 (lima) menunjukkan adanya sebuah proses. Proses tersebut adalah ....
  17. 17. A. Meiosis & mitosis B. Mitosis & Meiosis C. Diferensiasi & Meiosis D. Diferensiasi & Mitosis E. Diferensiasi 92. Gambar 4 di atas merupakan siklus hidup angiospermae. Proses manakah (yang ditunjukkan dengan angka) yang terjadi pada fase gametofit : A. 1,2,3 B. 4,5,6 C. 6,1,2 D. 3,4,5 E. 1,3,6 93. Anggota filum Mollusca yang tidak memiliki radula, terutama dari kelas … A. Gastropoda B. Cephalopoda C. Pelecypoda D. Cephalopoda dan Bivalvia E. Scaphopoda dan Bivalvia 94. Kekhasan dan keunikan pada filum Mollusca yaitu dengan dimilikinya …. A. Radula B. Tentakel C. Cangkang kapur D. Radula dan cangkang kapur E. Nefridia 95. Trochophore merupakan stadium larva pada kelompok takson hewan… A. Bryozoa, Rotifera, Bivalvia dan Polychaeta B. Bryozoa, Cnidaria, Annelida dan Mollusca C. Porifera, Cnidaria, Turbellaria dan Oligochaeta D. Porifera, Annelida, Mollusca dan Echinodermata E. Echinodermata, Crustacea, Annelida dan Mollusca 96. Pertumbuhan biji yang tidak terlindungi oleh ovarium merupakan karakteristik dari...... A. Angiospermae B. Paku C. Alga hijau D. Gymnospermae E. Lumut 97. Gunakanlah tabel berikut untuk menjawab pertanyaan no. 1 Tissue Factor A Protein Kinase Activity Protein Phosphatase Activity Muscle + - - Heart + + - Brain + - + Transkripsi gen X dikendalikan oleh transkripsi faktor A. Gen X ditranskripsi hanya ketika
  18. 18. faktor A difosforilasi. Data pada distribusi jaringan dari faktor A dan aktivitas dari suatu protein kinase dan protein fosfatase spesifik untuk faktor A ditunjukkan pada tabel di atas. Dari tiga jaringan ini, gen X akan ditranskripsi pada … A. otot saja B. jantung saja C. otak saja D. otak dan jantung saja E. otot, jantung, dan otak 98. Lac operon....... A. ditemukan di sel eukariot B. mengkode urutan asam amino pada laktase C. mengatur translasi dari mRNA D. mengatur transkripsi dengan mengaktifkan atau menginaktifkan produksi dari protein represor E. mengatur replikasi DNA dengan mengaktifkan atau menginaktifkan protein induser 99. Dalam usaha untuk mengklon protein manusia, material dari sel manusia di masukan ke dalam bakteri. Material yang berasal dari sel manusia tersebut adalah.... A. Segmen DNA yang mengkode mRNA yang di transkripsi B. rRNA dan tRNA yang dipergunakan selama proses translasi C. protein yang mentraskripsi mRNA di inti D. protein mRNA yang ditemukan di sitoplasma E. intron yang dilepaskan dari protein mRNA yang di transkripsi dan belum diproses 100. Tanda panah pada diagram menunjukkan tempat pemotongan dari enzim Tag I. Manakah hasil pemotongan yang tepat dari enzim tersebut? A. Two fragments: 5’-TCT 3’-AGAGC and CGACT-3’ 3’-AGAGCTGA-5’ B. Two fragments: 5’-TCTCGACT-3’ and 3’-AGAGCTGA-5’ C. Two fragments: 5’-TCTCGAGA-3’ and 3’-AGAGCACT-5’ D. Four fragments: 5’-TCT, 3’-AGAGC, CGACT-3’, and TGA-5’ E. Four fragments: 5’-TCTCG, ACT-3’, 3’-AGAGC, and TGA-5’ 101. Metode yang digunakan untuk mendeteksi suatu protein adalah … A. Polymerase chain reaction (PCR) B. Western blotting C. Southern blotting D. Northern blotting E. Eastern blotting 102. Metode yang digunakan untuk mendeteksi DNA adalah … A. Polymerase chain reaction (PCR) B. Western blotting C. Southern blotting D. Northern blotting: MENDETEKSI EKSPRESI GEN E. Eastern blotting
  19. 19. 103. Berapa banyak sisi restriksi yang terdapat pada urutan plasmid bakteri? A. Tidak ada B. 1 C. 2 D. 3 E. Lebih dari 3 104. Enzim manakah yang seharusnya digunakan untuk memasukkan urutan DNA manusia ke dalam plasmid bakteri? A. ERA I B. CRO I C. MEM II D. CRO I dan ERA I E. ERA I, CRO I, dan MEM II 105. Seorang teman sekelas anda memberikan suatu plasmid untuk ekspresi gen yang mengkode monooksigenase pada E. Coli. Gen tersebut diklon pada bagian hilir promoter PR lamda. Plasmid yang sama juga membawa gen yang mengkode repressor lamda peka temperatur (repressor aktif pada suhu 30oC, inaktif pada 42oC) yang terletak di sebelah hilir suatu promoter konstitutif. Asumsikan pertumbuhan E. Coli diperlambat oleh ekspresi metana mooksigenase. Jawablah pertanyaan di bawah ini dengan jawaban yang singkat dan tepat. A. Bagaimanakah ekspresi metana monokoksigenase dapat dicegah selama pertumbuhan sel? B. Bagaimanakah ekspresi gen yang mengkode metana monoksigenase dapat diinduksi? C. Aktivitas enzimatik dari metana monooksigenase dapat secara langsung diukur. Dua substrat apakah yang terdapat pada reaksi kimia tersebut? D. Produk apakah yang mengandung karbon? E. Bagaimanakah aktivitas radioisotop dapat dimanfaatkan untuk mengukur aktivitas metana oksigenase? (jawaban tidak boleh lebih dari 1 kalimat) F. Tipe organisme heterofilik apakah yang diharapkan memiliki sumber gen asal yang mengkode methane monooksigenase?tentukan seara spesifik 106. Pernyataan mana yang tidak selalu benar tentang virus dengan genom DNA? Replikasi virus melibatkan proses translasi pada ribosom sel A. Nukleokapsid virus dibungkus oleh membran lipid B. Genom virus dibungkus oleh protein C. Gen-gen virus ditranskripsi sebelum terjadi replikasi DNA virus 107. Waktu lahir, mata seorang anak berwarna biru, tetapi sekarang warna matanya coklat. Pernyataan mana di bawah ini yang dapat menjelaskan fenomena tersebut: A. Anak tersebut tidak mempunyai gen untuk pigmen mata coklat waktu lahir. B. Warna mata waktu lahir dipengaruhi oleh gen ibu. C. Aktivator gen penghasil pigmen coklat belum aktif waktu lahir. D. Represor gen penghasil pigmen coklat belum aktif waktu lahir. 108. Anda telah mengidentifikasi suatu gen untuk sintesis pigmen pada suatu mikroorganisme patogen. Ketika anda melakukan ‘plating’ pada mikroba ini untuk memperoleh koloni tunggal, diperoleh 50% koloni berpigmen dan sisanya tidak berpigmen. Jika salah satu dari koloni-koloni yang tidak berpigmen tersebut ditumbuhkan dan dilakukan ‘plating’ sama
  20. 20. seperti sebelumnya, 50% koloni yang dihasilkan berpigmen. Jika salah satu dari koloni berpigmen yang dihasilkan tersebut diisolasi, ditumbuhkan pada kultur dan dilakukan ‘plating’ agar diperoleh satu koloni, sebanyak 50% koloni yang dihasilkan tidak berpigmen. Pemeriksaan gen pigmen itu sendiri pada genom koloni berpigmen dan tidak berpigmen menunjukkan tidak adanya perbedaan struktural pada gen tersebut, tetapi urutan yang bersebelahan dengan gen tersebut berbeda pada setiap tipe pigmen. Berikut ini manakah yang merupakan penjelasan terbaik dari pengamatan di atas? A. Gen-gen pigmen diselingi dengan suatu transposon B. Gen-gen pigmen diregulasi melalui suatu urutan DNA invertible C. Gen-gen pigmen berada pada suatu plasmid D. Gen-gen pigmen berada pada suatu bakteriofag yang terintegrasi 109. Selama tahap infeksi lanjut, Listeria monocytogenes memiliki resistensi yang tinggi terhadap perlakuan dengan antibiotik gentamisin, sedangkan pada tahap infeksi awal mikroba tersebut cukup rentan. Pernyataan manakah yang paling tepat menggambarkan mekanisme kolonisasi sesuai pengamatan tersebut? A. Flagella pada Listeria monocytogenes membantunya berasosiasi dengan jaringan bermutasi dengan sempurna sehingga resisten sepenuhnya terhadap gentamisin B. Listeria monocytogenes bermutasi dengan sempurna sehingga resisten sepenuhnya terhadap gentamisin C. Sekali saja inang terinfeksi, bakteri tersebut kehilangan kerentanannya pada semua antibiotik D. Gentamisin tidak masuk ke dalam sel-sel eukariotik 110. Anda menemukan bahwa suatu mikroorganisme baru yang tumbuh pada minuman ringan (Diet Coke) yang menggunakan aspartam (pemanis buatan) dalam keadaan tanpa oksigen melalui fermentasi dan menghasilkan asam butirat. Hal ini memberitahukan apa kepada Anda tentang metabolisme aspartam? A. Merupakan sumber yang rendah energi B. Aspartam dapat diproses menjadi senyawa antara/intermediet kaya energi C. Penggunaannya bergantung pada rantai transport elektron D. Merupakan suatu prekursor asam amino 111. Proses denitrifikasi menggunakan nitrogen dalam bentuk teroksidasi sebagai ……… dan secara bertahap dapat menghasilkan gas N2 A. Akseptor elektron terminal B. Sumber energi C. Substrat fermentasi D. Pembawa elektron 112. Proses transport elektron berbalik (reverse) pada mikroba fotosintetik dan mikroba kemolitotrofik digunakan saat kondisi manakah? A. Kondisi anaerob B. Kekurangan energi cahaya C. Level ATP seluler yang tinggi D. Level yang rendah dari pembawa elektron (contoh: NADH, NAD(P)H, FADH2) 113. Di bawah ini merupakan peta dari daerah DNA yang ingin anda petakan dengan Analisis Restriction Fragment Length Polymorfism (RFLP).
  21. 21. Garis vertikal dengan huruf dibawahnya menunjukan daerah pemotongan dari enzym Pst I Daerah 3 dan 4 adalah polimorfik dan yang lain tidak. Jarak pemotongan antara Pst I diberikan pada gambar di atas. Panjang probe yang digunakan untuk mendeteksi RLFP di tunjukan oleh garing lurus di atas peta pemotongan. Anda memotong DNA dari individu yang berbeda dengan Pst I, mengelektroforesisnya, mem-blot mereka ke dalam membran, dan hibridisasi dengan probe yang diberi label radioaktif. Gambarlah larik-larik pita DNA yang muncul apabila DNA berasal dari individu yang homozigot dengan haplotipe sebagai berikut: Haplotipe Daerah 3 Daerah 4 A Ada Ada B Ada Tidak ada C Tidak ada Ada D Tidak ada Tidak ada 114. Anda memetakan gen yang bertanggung jawab terhadap penyakit genetis pada manusia. Anda tahu bahwa gen tersebut dapat dihibridisasi dengan probe b-101 pada metode RFLP. Berdasarkan pengetahuan tersebut, anda menghibridisasi DNA yang berasal dari hibrid sel tikus dan manusia. Tabel berikut menunjukan keberadaan jenis kromosom manusia pada tiap sel hibrid, dan juga hasil hibridisasinya dengan probe. Kromosom manakah yang membawa penyakit menurun tersebut? Sel hibrid Kromosom manusia yang terdapat pada sel hibrid Hasil hibridisasi dengan menggunakan probe A 1,2,17 - B 3,5,9,12 + C 5,18,22 - D 1,3,9 + E 2,9,18 - F 2,3,7 + 115. Suatu polipeptida panjangnya sepuluh asam amino dan hanya terdiri atas tiga jenis asam amino saja; leusin (L), serin (S) dan sistein (C). Polipeptida tersebut diberi perlakuan enzim yang memotong ikatan peptida tertentu. Potongan-potongan molekul berikut ini diperoleh dari campuran reaksi. Enzim memotong ikatan peptida Potongan yang diperoleh Antara L dan S L, S, CS dan LCCC Antara L dan C CCC dan LSLSCSL Antara C dan S SLCCC dan LSLSC Urutan sepuluh asam amino pada polipeptida di atas adalah…. A. LSCLSCLSCL B. LSLSCSLCCC C. CCCLSLSCSL D. SLCCCLSLSC 116. Bakteri penyebab tetanus hanya dapat dibunuh dengan pemanasan yang lama di atas titik didih. Hal ini mengindikasikan bahwa bakteri tetanus…. A. memiliki dinding sel yang mengandung peptidoglikan B. melindungi diri sendiri dengan menyekresikan antibiotik
  22. 22. C. mensekresikan endotoksin D. autotrof E. menghasilkan endospora 117. Suatu galur E. coli yang tidak memiliki DNA polymerase I akan mengalami defisiensi dalam …..... DNA A. perbaikan B. metilasi C. penggabungan D. degradasi E. transkripsi 118. Penyelesaian fase S dari siklus sel suatu sel mammalia ditandai dengan berikut ini kecuali.............. A. Kandungan histon per sel dua kali lipat dibanding ketika sel berada pada G1 B. Pada DNA yang mengalami replikasi, basa-basa nitrogen yang baru terbentuk berpasangan dengan basa-basa parental C. Setiap kromosom yang mengalami replikasi memiliki empat telomer D. Sister chromatids berpisah dari satu sama lain E. Nukleus mengandung jumlah DNA yang ekivalen dengan suatu sel tetraploid yang berada pada G1 119. Pada organisme manakah berikut ini respirasi aerob terjadi? I Mammalia II. Tumbuhan tinggi III. Protozoa A. hanya I B. hanya II C. hanya I dan III D. hanya II dan III E. I, II dan III 120. Struktur lipid mengandung semua hal berikut ini, kecuali…. A. gugus karboksil B. struktur dasar CH2O C. molekul gliserol D. molekul asam lemak E. gugus OH 121. RNA ditemukan pada.... A. nukleus saja B. sitoplasma saja C. nukleus dan sitoplasma D. protein E. asam amino 122. Selama proses respirasi, energi dipindahkan dari molekul glukosa ke molekul.... A. ACTH B. DNA C. RNA D. ATP E. BCG
  23. 23. 123. Ribosom terlibat pada semua dari berikut ini kecuali A. Pembentukan ikatan peptida B. Aminoasilasi dari tRNA C. Pengikatan faktor protein selama elongasi D. Pengikatan aminoasil tRNA pada mRNA E. Pengikatan mRNA pada kodon inisiasi 124. Kerusakan umum yang dijumpai pada DNA setelah pendedahan terhadap sinar ultraviolet adalah…. A. dimer pirimidin B. rusaknya rantai tunggal C. delesi basa D. dimer purin E. transposisi 125. Struktur terspesialisasi yang berada pada ujung kromosom eukariot disebut A. terminator B. telomer C. long terminal repeat (LTR) D. sentromer E. kinetokor 126. Tipe flagella pada bakteri adalah sebagai berikut, kecuali : A. Lofotrika B. Monotrika C. Atrika D. Amphitrika E. Politrika 127. Bentuk-bentuk bakteri adalah sebagai berikut, kecuali : A. Sarcina B. Basil C. Spiral D. Kokoid E. Pseudo 128. Bakteri penyebab tetanus hanya dapat dibunuh dengan pemanasan yang lama di atas titik didih. Hal ini mengindikasikan bahwa bakteri tetanus…. A. memiliki dinding sel yang mengandung peptidoglikan B. melindungi diri sendiri dengan menyekresikan antibiotik C. mensekresikan endotoksin D. autotrof E. menghasilkan endospora 129. Seorang ilmuwan melakukan percobaan untuk memisahkan membran sel dalam mitokondria dari mitokondria. Setelah membran sel dalam terpisah, membran dalam tersebut, kemudian diberikan perlakuan tertentu sehinga F1 dari ATP sintetasenya rusak. Dari proses berikut ; 1. Oksidasi NADH 2. Produksi H2O dan O2
  24. 24. 3. Terbentuknya gradient proton 4. Fosforilasi ADP Manakah yang tidak akan terjadi akibat perlakuan tersebut? A. 1,2,3,4 B. 2,4 C. 1,2,3 D. 4 saja E. 3 saja 130. Sel di dalam tubuh yang tidak memanfaatkan senyawa keton sebagai sumber energinya adalah … A. Sel darah putih B. Sel-sel penyusun hati C. Sel-sel di otak D. Sel darah merah E. Sel penyusun otot 131. Polisistronik adalah suatu istilah yang dipergunakan untuk menyatakan hasil dari suatu proses transkripsinya terdiri atas beberpa gen. Sebagian besar transkripsi yang bersifat polisistronik.Berikut yang merupakan hasil transkripsi yang bersifat polisistronik. Berikut yang merupakan hasil transkripsi yang bersifat polisistronik pada eukariot adalah …. A. Hasil transkripsi dari gen-gen yang mengkode protein ribososm B. Hasil transkripsi dari gen-gen yang mengkode protein hison C. Hasil transkripsi dari gen-gen yang mengkode rRNA D. Hasil transkripsi dari gen-gen yang mengkode protein integral E. Hasil transkripsi dari gen-gen yang mengkode haemoglobin 132. Suatu cara yang mudah untuk mengisolasi spesies Bacillus dan Clostridium secara spesifik dari tanah adalah dengan: A. Menumbuhkannya secara aerobik pada medium yang mengandung glukosa B. Menumbuhkannya pada suhu tinggi C. Memanaskan tanah untuk membunuh semua sel vegetatif dan kemudian memungkinkan semua spora dari organisme ini untuk “berkecambah” dan tumbuh D. Menumbuhkannya pada suhu sangat rendah E. Menumbuhkannya secara anaerobik pada medium yang mengandung glukosa 133. Pada gambar permukaan virus flu burung terlihat A. Struktur primer suatu protein B. Struktur sekunder suatu protein C. Struktur tersier saja dari suatu protein D. Struktur tersier dan kwaterner dari suatu protein 134. Perbedaan antara virus flu burung H5N1 hasil replikasi pada anak yang kurus dengan H N hasil replikasi pada ayam di peternakan terletak di: A. Komposisi lipid virus B. Macam-macam molekul RNA C. Komposisi protein kapsid D. tipe hemaglutinin 135. Orang sakit flu diberi antibiotik untuk : A. menghambat perkembangbiakan virus flu
  25. 25. B. menghambat infeksi sekunder oleh bakteri C. meningkatkan fungsi sistem imun pasien D. menghambat pertumbuhan sel yang diserang virus 136. Bahan di bawah ini dapat dijadikan vaksin terhadap flu, kecuali : A. virus yang dimatikan B. protein hemaglutinin C. Peptida yang merupakan bagian dari neuroaminidase. D. RNA virus 137. Virus flu menyerang sel-sel saluran pernafasan atas dan tidak menyerang sel-sel yang lain karena: A. sel lain tidak mempunyai reseptor untuk virus flu B. virus lebih mudah untuk masuk ke dalam tubuh melalui saluran pernaasan C. hanya saluran pernafasan yang mempunyai komponen-komponen yang diperlukan untuk replikasi virus D. virus lebih mudah untuk keluar tubuh lewat saluran pernafasan 138. Berikut ini yang merupakan komponen yang tidak diperlukan dalam proses replikasi DNA secara adalah.... A. DNA polimerase B. dAMP, dTMP, dCMP, dGMP C. RNA polimerase (primase) D. DNA templat E. Protein yang mencegah bergabungnya dua rantai induk pada saat replikasi 139. Diketahui bahwa suatu mRNA memiliki urutan basa sebagai berikut 5'AACGGUUUUAUGGAUAAACAA... (45 basa) ... GGGAUGCGGAGAUAAGAAUUU3'. Dari keterangan di atas, hasil translasi dari mRNA tersebut adalah.... A. Rantai polipeptida dengan 29 asam amino B. Rantai polipeptida dengan 28 ikatan peptida C. Rantai polipeptida dengan 23 asam amino D. Rantai polipeptida dengan 23 ikatan peptida E. Oligopeptida dengan 3 asam amino 140. Semua fenomena sel di bawah ini melibatkan aktivitas dari filamen aktin, kecuali ... A. Pergerakan amuba B. Aliran sitoplasma C. Sitokinesis D. Kontraksi otot E. Pergerakan flagel pada bakteri 141. Pernyataan manakah dibawah ini yang TIDAK berhubungan dengan kolenkim ? A. Merupakan jaringan yang ditemukan pada organ yang sedang tumbuh B. Hanya terbentuk pada akar karena pengaruh cahaya C. Terdapat pada bagian perifer dari petiola D. Terdapat pada bagian perifer dari batang tumbuhan berkayu E. Terdapat pada bagian perifer dari lamina
  26. 26. 142. Beberapa proses fisiologis yang terjadi pada suatu tanaman hanya terjadi setelah adanya pencahayaan dengan spektrum penuh dari warna cahaya putih atau komponen warna cahaya merah; warna cahaya lainnya, monokromatik tidak dapat menyebabkan pengaruh tersebut, proses tersebut disebabkan karena adanya pengaturan melalui .... A. Klorofil B. Auksin dan Giberelin C. Fitokrom D. Pigmen flavonoid E. Informasi diatas tidak cukup untuk menjawab pertanyaan 143. Jalur metabolisme yang digambarkan pada bagan di atas adalah .... A. Siklus asam trikarboksilat B. Siklus asam sitrat C. Siklus Krebs D. Siklus Calvin E. Siklus PEP karboksilase 144. Energi dalam bentuk ATP digunakan pada tahap .... A. 1 dan 2 B. 2 dan 3 C. 2 dan 4 D. 3 dan 4 E. 1, 2, dan 3 145. Unsur/nutrien yang berperan penting dalam pengikatan dengan cincin porfirin pada klorofil a adalah ... A. Besi (Fe) B. Kalium (K) C. Magnesium (Mg) D. Tembaga (Cu) E. Seng (Zn) 146. Hormon tumbuhan yang berperan dalam proses dormansi biji adalah... A. Auksin B. Giberelin C. Sitokinin D. Sitokinin E. Etilen 147. Vitamin yang larut dalam air, berperan sebagai koenzim dalam metabolisme asam nukleat serta ditemukan pada sayur-sayuran dan biji-bijian adalah.... A. Vitamin B B. Niasin C. Asam folat D. Vitamin A E. Asam askorbat 148. Pernyataan yang manakah yang tidak benar dalam menggambarkan fotosintesis yang terjadi pada tanaman C4 ? A. Hasil pertama dari fiksasi CO adalah senyawa dengan 4 atom karbon
  27. 27. B. Fotosintesis untuk tanaman C4 teradaptasi untuk tumbuh pada tempat yang panas dan iklim yang kering C. CO difiksasi di sel mesofil, akan tetapi siklus Calvin terjadi pada seludang pembuluh D. ATP yang digunakan untuk sintesis gula lebih sedikit dibandingkan dengan tanaman C3 E. Fotorespirasi pada tanaman C4 lebih sedikit dibandingkan dengan tanaman C3 149. Fungsi dari lentisel dan pneumatofor pada tanaman adalah .... A. Absorpsi nutrisi terutama dalam bentuik senyawa nitrat dan fosfat B. Menancapkan tanaman ke tanah (pengokoh) C. Untuk pertukaran gas, seringkali pada tanaman dengan akar yang terendam air D. Berperan dalam menjaga tekanan hidrostatik akar untuk menciptakan kondisi yang tepat untuk konduksi gula dalam floem E. Berperan dalam membentuk asosiasi mikoriza dengan bakteri dan jamur 150. Pada batang tumbuhan dikotil, jaringan yang berbatasan langsung dengan korteks adalah .... A. Floem primer B. Xilem primer C. Floem sekunder D. Xilem sekunder E. Kambium pembuluh 151. Jaringan yang mempunyai karakteristik berupa sel mati pada keadaan dewasa serta memiliki dinding sekuder yang kaku adalah ... A. parenkim B. kolenkim C. sklerenkim D. parenkim dan kolenkim E. skelerenkim dan kolenkim 152. Pernyataan tentang vakoula yang benar di bawah ini adalah i. Hanya ditemukan pada sel tumbuhan, dan tidak pada sel hewan ii. Pada sel tumbuhan, vakuola dikelilingi oleh membran yang disebut tonoplas iii. Merupakan tempat penyimpanan asam amino, terutama untuk sel yang sedang tumbuh iv. Air masuk ke vakuola berdasarkan gradien potensial air untuk membantu mempertahankan turgiditas v. Pada sel tanaman, vakuola mempunyai proporsi dan ukuran yang konstan di dalam sel A. i & iii B. ii & v C. iii & iv D. i & iv E. ii & iv 153. Pada lapisan manakah serangga dari famili Aphididae mendapat makanan dari batang pohon tanaman muda? A. Kambium B. Lapisan sebelah luar dari kambium C. Lapisan sebelah dalam dari kambium D. Lapisan berbeda yang tergantung dari umur tanamannya E. Lapisan berbeda tergantung umur dan tahap perkembangan serangga
  28. 28. 154. Sel hidup dari tanaman yang tidak dapat ditumbuhkan di medium kultur jaringan adalah ... A. Sel pengantar B. Parenkim C. Pembuluh tapis D. Polen E. Sel sklereid 155. Generasi yang dominan dalam siklus hidup lumut, paku, Gymnospermae dan Angiospermae adalah ... A. Gametofit, gametofit, sporofit, sporofit B. Gametofit, sporofit, sporofit, sporofit C. Gametofit, gametofit, gametofit, sporofit D. Gametofit merupakan generasi yang dominan untuk semuanya E. Sporofit merupakan generasi yang dominan untuk semuanya 156. Perhatikan gambar berikut ini. Pernyataan yang paling tepat untuk menggambarkan jaringan tersebut adalah A. Sel-selnya hidup dengan dinding sel yang tipis B. Sel-selnya hidup, dinding sel mengalami penebalan primer C. Sel-selnya mati, dinding sel mengalami penebalan primer D. Sel-selnya mati dinding sel mengalami penebalan sekunder E. Semua jawaban salah 157. Perhatikan struktur organ berikut. Semua pernyataan berikut ini menggambarkan organ tersebut, kecuali ... A. Berasal dari tumbuhan Gymnospermae B. Mempunyai struktur sekresi yang terbentuk secara schizogen C. Teradaptasi pada lingkungan yang xerofit D. Mempunyai suatu struktur yang juga dapat ditemukan pada akar E. Mempunyai struktur sekresi yang terbentuk secara lisigen 158. Seorang anak mengalami urinasi yang tidak normal, yaitu sangat jarang meskipun banyak minum air. Pemeriksaan terhadap parameter darah menunjukan bahwa anak ini memiliki tekanan darah yang tinggi, tekanan osmotik darah yang normal dan hematokrit yang rendah. Dari data tersebut maka kemungkinan kelainan pada anak tersebut terjadi pada........ A. Neurohipofisis B. Pankreas C. Medula adrenal D. Korteks adrenal E. Kelenjar tiroid. 159. Apabila kedua jenis tikus memiliki HLA (MHC) yang berbeda, dan apabila dilakukan penyambungan pembuluh darah, maka pernyataan berikut yang benar adalah...... A. Tikus Nu akan mati atau sakit karena diserang oleh sel limfosit T yang mengalami pendewasaan pada tikus scid B. Tikus scid akan mati atau sakit karena diserang oleh sel limfosit T yang mengalami pendewasaan pada tikus Nu C. Tikus Nu akan mati atau sakit karena sel-selnya diserang oleh sel limfosit T yang berasal
  29. 29. dari sumsum tulangnya sendiri. D. Kedua tikus akan tetap hidup secara normal dan dapat menerima limfosit T yang diproduksi dari hasil penggambungan pembuluh darah tersebut. E. Jawaban Adan C benar 160. Kembar identik merupakan kembar yang berasal dari satu sel telur yang dibuahi oleh satu sperma. Akibat hal tertentu maka hasil pembelahan dari zigot kemudian akan memisah dan membentuk embrio sendiri-sendiri. Apabila pemisahan terjadi pada saat blastokista maka pernyataan yang tepat adalah..... A. Masing-masing bayi akan memiliki plasenta dan kantung amnion sendiri. B. Bayi akan memiliki plasenta yang sama, namun tiap bayi akan memiliki amnion sendiri C. Kedua bayi akan memiliki plasenta dan amnion yang sama D. Masing-masing bayi akan memiliki umbilikalnya sendiri tetapi berada pada kantung amnion yang sama E. Jawaban C dan D benar 161. Sel otot rangka dapat dibagi menjadi berapa jenis antara lain: A. Serabut otot tonik: kontraksinya perlahan, tidak memproduksi AP, beberapa serabut otot mendapat multisinaps dari satu neuron motoris, turn overmiosin ATP-asenya rendah. B. Serabut fasik lambat: kontraksi lambat, kelelahan (fatique) lambat, memproduksi AP, memiliki banyak mitokondria dan turn over miosin ATP-asenya rendah. C. Serabut fasik cepat glikolitik: Kontraksi cepat, kelelahan cepat, turn overATP-ase tinggi, Jumlah mitokondria didalam sel rendah. D. Serabut fasik cepat oksidasi: kontraksi cepat, kelelahan lambat, jumlah mitokondria banyak. Berdasarkan keterangan diatas cocokkanlah pernyataan dibawah ini dengan jenis otot yang ada pada keterangan diatas. a. Otot yang berperan dalam menjaga postur tubuh ...... b. Otot yang dominan pada seorang pelari maraton ...... c. Serabut otot yang paling cepat memproduksi asam laktat ........ 162. Berdasarkan cara memperoleh makanannya mamalia digolongkan menjadi herbivor, karnivor dan omnivor. Hewan karnivor adalah hewan yang memperoleh sebagian besar makanannya dari daging. Daging mengandung banyak glikogen dan protein. Hewan herbivor adalah hewan yang memperoleh energinya dari tanaman yang dimakan. Tanaman mengandung banyak serat dan sedikit polisakarida pada sitoplasma selnya. Untuk mengetahui pengaruh kedua tipe makanan tersebut terhadap kadar glukosa darah dari masing-masing kelompok hewan, Dr. Riganata van Puyeng melakukan pangukuran kadar glukosa darah pada vena porta hepatika dan vena hepatika. Hasilnya dapat dilihat sebagai berikut: Pernyataan yang tepat berdasarkan hasil pengamatan diatas, kecuali ... a. Ketika makan, kadar glukosa darah pada vena porta dari karnivor dan herbivor meningkat. b. Pada karnivor dan herbivor, glukosa diserap di hati ketika hewan tersebut makan, dan peristiwa sebaliknya terjadi ketika hewan tersebut puasa. c. Pada herbivor, pelepasan glukosa dari hati terjadi pada saat makan dan puasa.
  30. 30. d. Ketika makan, sumber glukosa dari metabolisme sel hewan karnivora berasal dari glukosa yang diserap di usus. e. Ketika makan, sumber glukosa dari metabolime sel herbivora berasal dari glukosa yang diserap di usus dan glukosa yang dilepaskan di hati. 163. Hasil percobaan lanjutan pada hewan herbivore menunjukan dari 100 persen glukosa yang terkandung dalam tanaman yang dimakannya (sebagian besar dalam bentuk selulosa), 33% dirubah menjadi asam lemak dan hanya 18% yang diserap dalam bentuk glukosa di usus. Berdasarkan keterangan tambahan tersebut manakah pernyataan berikut yang tidak benar? a. Hewan herbivora selalu memiliki kadar glukosa yang lebih rendah pada vena porta hepatika jika dibandingkan dengan kadar glukosa pada vena hepatika. b. Sumber glukosa darah pada hewan herbivora pada saat kelaparan adalah hasil dari glukoneogenesis di hati dengan bahan baku asam lemak. c. Sumber glukosa darah pada hewan herbivor pada saat kelaparan adalah hidrolisis glikogen di hati. 164. Berikut merupakan peranan antibodi dalam mengeliminasi partikel atau sel asing yang masuk kedalam tubuh, kecuali..... a. Menempel pada sisi aktif dari partikel atau sel yang masuk ke dalam tubuh. b. Mempermudah makrofag dalam memfagositosis partikel atau sel asing yang masuk kedalam tubuh. c. Mengendapkan partikel asing yang terlarut di dalam cairan tubuh. d. Menginisiasi kerja dari sistem komplemen. e. Mengeliminasi bakteri yang tumbuh pada endosom dari makrofag 165. Pasteur merupakan orang yang pertama kali melakukan pengamatan mengenai sistem kekebalan adaptif. Pasteur mengamati bahwa pemerah susu yang memerah susu dari sapi yang terkena cow fox akan terhindar dari penyakit sejenis yang mematikan yaitu small fox. Setelah dilakukan pengamatan ternyata dua penyakit ini disebabkan oleh 2 organisme yang berbeda. Di masa sekarang diketahui sesuatu yang menyebabkan kekebalan pada pemerah susu tersebut adalah antibodi. Berdasarkan keterangan di atas, pernyataan berikut yang benar adalah...... a. Dua organisme yang menyebabkan small fox dan cow fox, memiliki antigen yang sama. b. Dua organisme yang menyebabkan small fox dan cow fox, memiliki epitop yang sama. c. Dua organisme tersebut adalah bakteri d. Antibodi yang menyerang cow fox dan smal fox diproduksi oleh dua klon sel B yang berbeda e. Jawaban A dan B benar. 166. Berikut merupakan pernyataan yang tepat mengenai peredaran darah pada vertebrata, kecuali…… a. Darah selalu mengalir dalam pembuluh darah b. Ketika darah dipompa dari jantung maka volume total darah yang mengalir ke arteri, kapiler dan vena tidak berubah. c. Selama darah beredar di dalam pembuluh maka untuk sementara waktu sebagaian dari cairan darah akan keluar dari pembuluh darah. d. Selama darah beredar pada pembuluh darah maka tekanan darah akan terus menurun dari arteri ke kapiler dan kemudian ke vena. e. Hematokrit darah pada venula lebih besar dari pada arterial.
  31. 31. 167. Pernyataan yang benar mengenai gambar di bawah ini adalah...... a. Cahaya lampu merangsang membukanya gerbang ion Na pada sel A sehingga dikeluarkan neurotransmiter yang mengaktivasi sel B sehingga rangsangan dapat dialirkan oleh sel D ke saraf pusat. b. Cahaya lampu merangsang membukanya gerbang ion Na pada sel D sehingga dikeluarkan neurotransmiter yang mengaktivasi sel B sehingga rangsangan dapat dialirkan oleh sel D ke saraf pusat. c. Cahaya lampu merangsang terbukanya ion K+ pada sel A sehingga dikeluarkan neurotransmiter yang mengaktivasi sel B sehingga rangsangan dapat dialirkan oleh sel D ke saraf pusat. d. Cahaya lampu merangsang menutupnya ion Na+ pada sel A sehingga dikeluarkan neurotrnsmiter yang mengaktivasi sel B sehingga rangsangan dapat dialirkan oleh sel D ke saraf pusat. 168. Apabila cahaya jatuh pada daerah C maka seseorang tidak dapat melihat benda-benda di sekitarnya. Penjelasan yang dapat menjelaskan peristiwa tersebut adalah.... a. Pada C tidak terdapat sel saraf sehingga rangsang cahaya tidak dapat diterima. b. Masuknya cahaya pada daerah C dapat mengakibatkan kerusakan pada fotoreseptor sehingga respon cahaya tidak dapat disalurkan ke sistem saraf pusat. c. Pada daerah C tidak terdapat sel batang maupun konus sehingga respon cahaya tidak dapat dihantarkan ke otak. d. Neuron pada daerah C berfungsi menghambat kerja dari sistem saraf mata. 169. Manakah pernyataan yang tidak benar dari sistem sensoris? a. Aliran rangsang pada sistem sensoris melibatkan perubahan stimulus kimia atau fisik ke dalam bentuk potensial aksi b. Secara umum, rangsangan mengakibatkan terjadinya perubahan aliran ion yang menembus membran plasma sel sensoris. c. Sensori adaptasi berperan penting dalam kemampuan organisma untuk mebedakan antara stimulus yang penting dan tidak penting d. Semakin besar rangsang, maka potensial aksi pada reseptor akan meningkat. 170. Berikut ini yang merupakan pernyataan yang benar mengenai sistem saraf adalah... a. Membran mielin dari sel saraf tepi dan pusat dibuat oleh sel Schwann Semua sel saraf memiliki membran mielin b. Pada sel saraf yang bermielin, depolarisasi membran sel hanya terjadi pada nodus Ranvier. c. Sel saraf berukuran kecil mampu menghantarkan rangsang lebih cepat daripada sel saraf berukuran besar d. Beda potensial sel saraf ketika sel saraf tidak menghantarkan atau menerima rangsang ditentukan oleh permeabilitas membran sel terhadap ion K. 171. Baygon merupakan racun jenis organofosfat. Racun ini dapat menghambat kerja dari enzim asetilkolinesterase yaitu enzim yang memecah neurotransmiter asetilkolin. Salah satu sinaps yang menggunakan neurotransmiter asetilkolin adalah sinaps yang menghubungkan neuron motorik dengan otot rangka. Apakah yang akan terjadi pada seseorang yang memakan baygon? a. Kejang otot karena membran sel otot terdepolarisasi terus-menerus Kejang otot karena membran sel otot mengalami hiperpolarisasi secara terus-menerus.
  32. 32. b. Otot mengalami paralisis karena sel otot tidak mendapat rangsangan dari sel saraf. c. Otot mengalami atropi karena tidak mendapat rangsang dari sel saraf d. Otot tetap berkontraksi secara normal.

×