Human pulp cells response to portland cement in vitro

296 views

Published on

Published in: Science, Technology, Business
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
296
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
7
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Human pulp cells response to portland cement in vitro

  1. 1. Human Pulp Cells Response to Portland Cement In Vitro Kyung-San Min, DDS, MS,* Hyun-Il Kim, DDS,* Hyo-Jin Park, DDS,* Sung-Hee Pi, DDS, MS,† Chan-Ui Hong, DDS, PhD,§ and Eun-Cheol Kim, DDS, PhD‡ Abstract The aim of this study was to investigate the cellular effects of Portland cement on cultured human pulp cells. Using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphe- nyltetrazolium bromide (MTT) assay, no cytotoxicity was observed in the Portland cement group in compar- ison with the negative control group, whereas the glass ionomer cement, intermediate restorative material, and Dycal groups showed a survival rate of less than 40% at 12 hours. Scanning electron microscopy revealed that human pulp cells attached to the Portland cement were flat and had numerous cytoplasmic extensions. In the groups in which other materials were used, a few rounded cells were observed on the material but no living cells were observed. The expression of both osteonectin and dentin sialophosphoprotein mRNAs was induced in the Portland cement–treated group. These results suggest that Portland cement is bio- compatible, allows the expression of mineralization- related genes on cultured human pulp cells, and has the potential to be used as a proper pulp-capping material. (J Endod 2007;33:163–166) Key Words Dentin sialophosphoprotein, human pulp cells, MTT, osteonectin, Portland cement Pulp capping is defined as the treatment of exposed vital pulp by sealing the pulpal wound with a dental material to facilitate the formation of reparative dentin. A final goal of the application of capping materials is to induce the dentinogenic potential of pulp cells (1, 2). Mineral trioxide aggregate (MTA) has been studied as a pulp-capping agent. Several studies have shown that MTA is biocompatible and induces less pulp inflamma- tionandmoredentinbridgeformationthancalciumhydroxide–basedmaterials(3,4). The base material of MTA is Portland cement, and bismuth oxide has been added to render the mixture radiopaque (5, 6). Recently, there has been great interest in the evaluation of Portland cement as an alternative to MTA, because Portland cement costs less and is widely available. The biocompatibility of Portland cement has been previously investigated in vitro using a number of cell lines, including mouse lymphoma cells (7), human endothelial cells (8), Chinese hamster ovary cells (9), SaOS-2 osteosarcoma cells (10), and human osteosarcoma cells (11). However, these cell lines have an aneuploid chromosome pattern, and the cells multiply rapidly with an unlimited life span. Therefore, the results obtained from these cells might differ from those obtained in real human tissue. How- ever, the focus of these studies was limited to the cytotoxicity or genotoxicity of Portland cement, and there is little information regarding the detailed biologic response that occurs in human pulp cells. Dental pulp cells are capable of differentiating into odontoblasts and producing a mineralizing matrix, particularly during reparative dentinogenesis associated with in- jury and disease (12, 13). Similar phenotypes of dental pulp cells have also been reported (14). They are characterized by the expression of proteins, which are com- mon in mineralized tissues (15), and tooth-specific proteins such as dentin sialophos- phoprotein (DSPP) gene products (16). Osteonectin (ON) is a major noncollagenous protein of bone and dentin, which is responsible for the mineralization properties of these tissues (17). Although the biocompatibility of Portland cement has been previously reported (7–11), its effect on cultured human pulp cells is not completely understood to date. Furthermore, no in vitro study has been conducted to investigate the effect of Portland cement on the expression of mineralization markers in dental pulp cells. Therefore, in this study we investigated the response of cultured human pulp cells to Portland cement in terms of biocompatibility. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide(MTT)assayandscanningelectronmicroscopy(SEM)wereusedinthisstudy. In addition, the expression of ON and DSPP mRNAs was evaluated by reverse transcrip- tion–polymerase chain reaction (RT-PCR) in cultured human pulp cells. Materials and Methods Cell Culture The pulp tissues obtained from sectioned teeth were removed aseptically, rinsed with Hanks’ buffered saline solution, and placed in a 100-mm petri dish. The pulp tissues were minced into small fragments using a blade and cultured in Dulbecco’s modified Eagle’s medium (DMEM; Biofluid) containing 10% fetal bovine serum (FBS; Gibco) with 100 U/ml penicillin and 100 U/ml streptomycin (Life Technologies). Cul- tures were maintained at 37°C in a humidified atmosphere of 5% CO2 and 95% air. Cell cultures between the fifth and seventh passages were used in this study. From the *Department of Conservative Dentistry, † Depart- ment of Periodontics, and ‡ Department of Oral and Maxillo- facial Pathology, College of Dentistry, Wonkwang University, Iksan, South Korea; and the § Department of Conservative Dentistry, Dankook University, Cheonan, South Korea. Address requests for reprints to Dr. Eun-Cheol Kim, Asso- ciated Professor, Department of Oral and Maxillofacial Pathol- ogy, College of Dentistry, Wonkwang University, 344-2 Shinyong, Iksan, Cheonbuk, South Korea. E-mail address: eckwkop@ wonkwang.ac.kr. 0099-2399/$0 - see front matter Copyright © 2007 by the American Association of Endodontists. doi:10.1016/j.joen.2006.07.022 Basic Research—Technology JOE — Volume 33, Number 2, February 2007 Human Pulp Cells Response to Portland Cement In Vitro 163
  2. 2. Cell Inoculation As determined by hemocytometry, single cell suspensions of hu- man pulp cells were seeded in 24-well tissue culture plates at 5 ϫ 104 cells per well in complete DMEM and incubated in a humidified atmo- sphere of air and 5% CO2 at 37°C for 24 hours. Preparation of Test Materials Four materials listed in Table 1 were tested. Portland cement (0.5 g) was mixed with sterile distilled water (0.2 ml) on a glass slab, and the other materials were mixed according to the manufacturers’ recommendations. Subsequently, all materials were placed at the bot- tom of an insert well, which had a membrane pore diameter of 0.4 ␮m. After setting for 24 hours, the insert wells were exposed to ultraviolet (UV) light, placed inside the culture wells, and incubated for 12, 24, 48, and 72 hours. MTT Assay After exposure to the materials for 12, 24, 48, and 72 hours, viable cells were detected using the MTT dye, which forms blue formazan crystals that are reduced by the mitochondrial dehydrogenase present in living cells. Briefly, 200 ␮l of MTT solution [2 mg/ml in phosphate- buffered saline (PBS)] was added to each well, and the wells were incubated for 4 hours. Subsequently, 200 ␮l of DMSO was added to each well. The plates were then shaken until the crystals had dissolved, and the solution in each well was transferred to a 96-well tissue culture plate. Reduced MTT was then measured spectrophotometrically at 540 nm in a dual-beam microtiter plate reader. One-way ANOVA (p ϭ 0.05) and Duncan’s multiple range tests were used for statistical analysis. SEM Analysis Under aseptic conditions materials were condensed into 2- ϫ 20-mm round acrylic molds. Materials were allowed to set for 24 hours in a humidified incubator at 37°C. The disks were all placed at the bottom of 12-well tissue culture plates. Human pulp cells were seeded at 1.0 ϫ 105 cells per well on the prepared materials. After a 24-hour incubation period, the dishes were fixed with 2.5% glutaraldehyde for 2 hours. Samples were then dehy- drated in increasing concentrations of ethanol (70%, 80%, 90%, 95%, and 100%) for 20 minutes at each concentration, immersed in tert- butanol for 20 minutes, and freeze-dried for 24 hours. SEM was per- formed using a JSM-6360 (JEOL) system operated at 10 kV. RT-PCR Gene Expression Analysis Cells (1 ϫ 105 ) in DMEM containing 10% serum were seeded in 6-well tissue culture plates and incubated for 24 hours. After an initial attachment period of 24 hours, the medium was switched to mineral- izing medium for the duration of the experiment. Portland cement was mixed and placed at the bottom of an insert well having a membrane pore diameter of 0.4 ␮m. After setting for 6 hours, insert wells were placed inside the culture wells and incubated for 7 days. After 7 days of culture, the media were removed, and total RNA was extracted using the Trizol reagent (Life Technologies) according to the manufacturer’s instructions. Reverse transcription of RNA was per- formed using AccuPower RT PreMix (Bioneer). Thereafter, the RT- generated DNA (2–5 ␮l) was amplified using AccuPower PCR PreMix (Bioneer). Amplification was carried out for 30 cycles in a DNA thermal cycler. Primer sequences for ON, DSPP, and GAPDH are detailed in Table 2. The PCR products were resolved on a 1.5% agarose gel and stained with ethidium bromide. Results MTT Assay With the exception of Portland cement, all the other materials (including GIC, IRM, and Dycal) showed a marked decrease in cell viability within 12 hours (as shown in Fig. 1). The Portland cement group showed statistically higher cell viability than the other groups at 12, 24, 48, and 72 hours. Moreover, the Portland cement group exhib- ited cell viability similar to that of the control group until 72 hours. Therefore, in comparison with the other groups, the Portland cement group showed no cytotoxicity. TABLE 2. Primer sets and PCR conditions Protein Sequence (5=-3=) Size (bp) Tm (°C) ON Forward: ACATGGGTGGACACGG Reverse: CCAACAGCCTAATGTGAA 405 52 DSPP Forward: AATGGGACTAAGGAAGCTG Reverse: AAGAAGCATCTCCTCGGC 814 54 GAPDH Forward: CGGAGTCAACGGATTTGGTCGTAT Reverse: AGCCTTCTCCATGGTGGTGAAGAC 306 54 TABLE 1. Composition of the materials tested in this study Name (Manufacturer) Components Composition Portland Cement (Ssangyong, Korea) Powder Tricalcium silicate, dicalcium silicate, tricalcium aluminate, tetracalcium aluminoferrite, hydrated calcium sulphate Fuji II LC (GC, Japan) Powder Aluminosilicate glass Liquid Polyacrylic acid. HEMA IRM (Dentsply-Caulk) Powder Zinc oxide, polymethylmethacrylate Liquid Eugenol, acetic acid Dycal (Dentsply-Caulk) Base Disalicylate ester, calcium-phosphate, calcium tungstate, zinc oxide, iron oxide Catalyst Calcium hydroxide, ethyl toluenesulfonamide, zinc state, titanium dioxide, zinc oxide, iron oxide Figure 1. Effects of Portland cement, GIC, IRM, and Dycal on cultured human pulp cells measured by the MTT assay. Each point and bar represents the mean Ϯ SD; *p Ͻ 0.05. Basic Research—Technology 164 Min et al. JOE — Volume 33, Number 2, February 2007
  3. 3. SEM Analysis In the GIC, IRM, and Dycal groups, a few rounded cells were observed on the materials, but no living cells were seen (Fig. 2B, C, D). In contrast, the Portland cement group showed flattened cells in close proximity to one another, and these were seen to be spreading across the substrate. Numerous thin cytoplasmic extensions were also ob- served, and these projected from the cell to the surrounding surface or adjacent cells (Fig. 2A). RT-PCR Gene Expression Analysis We examined the Portland cement–induced expression of ON and DSPP mRNAs in human pulp cells. As shown in Fig. 3, the expression of ON and DSPP mRNAs was induced in human pulp cells. Furthermore, the expression of the ON mRNA in the Portland cement group was similar to that of the dexamethasone-treated group (Fig. 3). These RT- PCR results suggested that Portland cement has an inductive effect on mineralization. Discussion Ideally, pulp-capping materials should be biocompatible, of low toxicity, and capable of facilitating mineralization. Over the past decade, a new material (MTA) was developed as an endodontic material. Many in vivo and in vitro studies have reported that this material is biocompatible (18–20). Recently, findings of studies where MTA was compared with Portland cement have shown that these two materials appear to be almost identical (21, 22). Although Portland cement is considered to be a less-expensive biocompatible pulp-capping material, its mechanism of action in human pulp cells is still not completely clear (21, 23). In this study, we attempted to evaluate the biologic effects of Portland cement on cultured human pulp cells by means of a cell viability test, SEM observation, and RT-PCR analysis. Thecytotoxicityofmaterialsusedinthepulp-cappingprocedureis of great concern, because damage or irritation could cause degenera- tion of the pulp tissue and delayed wound healing. In this study, GIC, IRM, and Dycal induced a strong cytotoxic effect; however, Portland cement did not interfere with the proliferation of human pulp cells. This biocompatibility of Portland cement is in agreement with the results obtained from studies using Chinese hamster ovary cells and human osteosarcoma cells (9, 11). Cell adhesion is a complex and dynamic process that plays a critical role in wound healing and has implications in cell growth, proliferation, and differentiation (24). In this study, human pulp cells cultured on Portland cement for 24 hours appeared to be flat and exhibited well-defined cytoplasmic extensions that projected from the cells to the surrounding surface or adjacent cells. The preservation of cytoplasmic extensions is important, because these extensions form a three-dimensional network within hard tissue and materials (10). In this odontoblast differentiation study, we analyzed mineraliza- tion markers such as ON and DSPP by using cultured human pulp cells grown on Portland cement. ON, which is a 43-kDa phosphoglycopro- tein, is a noncollagenous protein synthesized by human osteoblasts. It represents 2 to 3% of the total protein present in developing bone tissue Figure 2. SEM observation of cells incubated for 24 hours on (A) Portland cement (ϫ300), (B) GIC (ϫ500), (C) IRM (ϫ500), and (D) Dycal (ϫ500). Figure 3. Effects of Portland cement on the expression of ON and DSPP mRNAs in human pulp cells. Total RNA was extracted from the cells and the expression levels of the mRNAs were determined by RT-PCR as described in Materials and Methods. Basic Research—Technology JOE — Volume 33, Number 2, February 2007 Human Pulp Cells Response to Portland Cement In Vitro 165
  4. 4. (25, 26). ON has also been observed in bovine odontoblasts (27, 28) and cultured human pulp cells (29). In this study, the expression of ON mRNA on Portland cement was similar to that of the dexamethasone- treated positive control. This result indicated that Portland cement plays an important role in the mineralization of tooth structure. DSPP has been considered to play a regulatory role in the miner- alization of reparative dentin and can serve as a specific marker for the odontoblast phenotype. Iohara et al. (30) reported that the expression of DSPP mRNA confirmed the differentiation of pulp cells into odonto- blasts. As shown in Fig. 3, DSPP gene expression was observed on Portland cement and controls. This result suggested that dentin forma- tion during the pulp-capping procedure might be facilitated in the pres- ence of Portland cement. Collectively, our results indicate that Portland cement is not cyto- toxic and permits cellular attachment and growth. Furthermore, this study demonstrated that Portland cement allows the expression of mRNAs of a dentin-specific protein and a noncollagenous protein in- volved in mineralization in cultured human pulp cells. Acknowledgments This paper was supported by Wonkwang University in 2006. References 1. Schröder U. Effects of calcium hydroxide-containing pulp-capping agents on pulp cell migration, proliferation, and differentiation. J Dent Res 1985;64:541–8. 2. Mjör IA, Dahl E, Cox CF. Healing of pulp exposures: an ultrastructural study. J Oral Pathol Med 1991;20:496–501. 3. Dominguez MS, Witherspoon DE, Gutmann JL, Opperman LA. Histological and scan- ningelectronmicroscopyassessmentofvariousvitalpulp-therapymaterials.JEndod 2003;29:324–33. 4. Faraco IM Jr., Holland R. Response of the pulp of dogs to capping with mineral trioxide aggregate or a calcium hydroxide cement. Dent Traumatol 2001;17:163–6. 5. Torabinejad M, Hong CU, Pitt Ford TR, Kettering JD. Cytotoxicity of four root end filling materials. J Endod 1995;21:489–92. 6. Torabinejad M, Smith PW, Kettering JD, Pitt Ford TR. Comparative investigation of marginal adaptation of mineral trioxide aggregate and other commonly used root- end filling materials. J Endod 1995;21:295–9. 7. Ribeiro DA, Duarte MA, Matsumoto MA, Marques ME, Salvadori DM. Biocompatibil- ityinvitrotestsofmineraltrioxideaggregateandregularandwhitePortlandcements. J Endod 2005;31:605–7. 8. De Deus G, Ximenes R, Gurgel-Filho ED, Plotkowski MC, Coutinho-Filho T. Cytotox- icity of MTA and Portland cement on human ECV 304 endothelial cells. Int Endod J 2005;38:604–9. 9. Ribeiro DA, Sugui MM, Matsumoto MA, Duarte MA, Marques ME, Salvadori DM. Genotoxicity and cytotoxicity of mineral trioxide aggregate and regular and white Portland cements on Chinese hamster ovary (CHO) cells in vitro. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;101:258–61. 10. Abdullah D, Ford TR, Papaioannou S, Nicholson J, McDonald F. An evaluation of accelerated Portland cement as a restorative material. Biomaterials 2002;23: 4001–10. 11. Camilleri J, Montesin FE, di Silvio L, Pitt Ford TR. The chemical constitution and biocompatibility of accelerated Portland cement for endodontic use. Int Endod J 2005;38:834–42. 12. Goldberg M, Lasfargues JJ. Pulpo-dentinal complex revisited. J Dent 1995;23:15–20. 13. Couble ML, Farges JC, Bleicher F, Perrat-Mabillon B, Boudeulle M, Magloire H. Odontoblast differentiation of human dental pulp cells in explant cultures. Calcif Tissue Int 2000;66:129–38. 14. Butler WT. Sialoproteins of bone and dentin. J Biol Buccale 1991;19:83–9. 15. Reichert T, Storkel S, Becker K, Fisher LW. The role of osteonectin in human tooth development: an immunohistological study. Calcif Tissue Int 1992;50:468–72. 16. Chen S, Rani S, Wu Y, et al. Differential regulation of dentin sialophosphoprotein expression by Runx2 during odontoblast cytodifferentiation. J Biol Chem 2005; 280:29717–27. 17. Papagerakis P, Berdal A, Mesbah M, et al. Investigation of osteocalcin, osteonectin, and dentin sialophosphoprotein in developing human teeth. Bone 2002;30:377–85. 18. Masuda YM, Wang X, Hossain M, et al. Evaluation of biocompatibility of mineral trioxide aggregate with an improved rabbit ear chamber. J Oral Rehabil 2005; 32:145–50. 19. Osorio RM, Hefti A, Vertucci F, Shawley AL. Cytotoxicity of endodontic materials. J Endod 1998;24:91–6. 20. Thomson TS, Berry JE, Somerman MJ, Kirkwood KL. Cementoblasts maintain expres- sion of osteocalcin in the presence of mineral trioxide aggregate. J Endod 2003;29:407–12. 21. Menezes R, Bramante CM, Letra A, Carvalho VG, Garcia RB. Histologic evaluation of pulpotomies in dog using two types of mineral trioxide aggregate and regular and white Portland cements as wound dressings. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;98:376–9. 22. Saidon J, He J, Zhu Q, Safavi K, Spangberg LSW. Cell and tissue reactions to mineral trioxide aggregate and Portland cement. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2003;95:483–9. 23. Holland R, de Souza V, Murata SS, et al. Healing process of dog dental pulp after pulpotomy and pulp covering with mineral trioxide aggregate or Portland cement. Braz Dent J 2001;12:109–13. 24. PérezAL,SpearsR,GutmannJL,OppermanLA.OsteoblastsandMG-63osteosarcoma cells behave differently when in contact with ProRoot™ MTA and white MTA. Int Endod J 2003;36:564–70. 25. Termine JD, Kleinman HK, Whitson SW, Conn KM, McGarvey ML, Martin GR. Os- teonectin, a bone-specific protein linking mineral to collagen. Cell 1981;26:99–105. 26. Romberg RW, Werness PG, Lollar P, Riggs BL, Mann KG. Isolation and characteriza- tion of native adult osteonectin. J Biol Chem 1985;260:2728–36. 27. Fujisawa R, Kuboki Y. Changes in levels of ON in bovine dentin during tooth devel- opment. Arch Oral Biol 1989;34:89–92. 28. Jontell M, Linde A. Non-collagenous proteins of predentin from dentinogenically active bovine teeth. Biochem J 1983;214:769–76. 29. Alliot-Licht B, Bluteau G, Magne D, et al. Dexamethasone stimulates differentiation of odontoblast-like cells in human dental pulp cultures. Cell Tissue Res 2005; 321:390–400. 30. Iohara K, Nakashima M, Ito M, Ishikawa M, Nakasima A, Akamine A. Dentin regen- eration by dental pulp stem cell therapy with recombinant human bone morphoge- netic protein 2. J Dent Res 2004;83:590–5. Basic Research—Technology 166 Min et al. JOE — Volume 33, Number 2, February 2007

×