SlideShare a Scribd company logo
1 of 30
Biochip Biosensor or bioprocessor that utilizes  technologies of modern Biology and  Electronics in a micro scale.
Types of Biochip DNA chip Protein chip Enzyme chip Lab-on-a-chip Biomolecular machine Biocomputer
Physical methods are the keys for many biological problems ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
 
Bio-physical methods ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
 
Structure Determination
An ideal biochip Size-portable Save energy-long term usage Low cost-mass production High sensitivity-integration Low sample requirement Microarray-high thru put Decreased invasiveness
ASI Atomic Scale Integration LSI Large Scale Integration GSI Giga Scale Integration MSI Medium Scale Integration Time evolution in computer technology from zero to atomic scale integration (Ciabrera et al., 1991; Nicolini, 1993). ULSI Ultra Large Scale Integration SSI Small Scale Integration VLSI Very Large Scale Integration ZSI Zero Scale Integration
 
Features and factors of size reduction in microchip-based analysis  TIBTECH  DECEMBER 1999 (VOL 17)
The size matter
 
Biomolecular Machine ,[object Object],[object Object],[object Object]
 
 
DNA as Molecular Machine   Construction and operation of the molecular tweezers. A DNA-fuelled molecular machinemade of DNA Bernard Yurk e *, Andrew J. Turber®el d* ², Allen P. Mills J r *, Friedrich C. Simme l*  & Jennifer L. Neuman n* NATURE | VOL 406 | 10 AUGUST 2000  Name Sequence Domain 1 Domain 2 A  5’ TGCCTTGTAAGAGCGACCAT CAACCTGGAATGCTTCGGAT 3’ B  5’ GGTCGCTCTTACAAGGCA  CTGGTAACAATCACGGTCTATGCG  3’ C  5’  GGAGTCCTACTGTCTGAACTAACG  ATCCGAAGCATTCCAGGT 3’ F  5’  CGCATAGACCGTGATTGTTACCAG  CGTTAGTTCAGACAGTAGGACTCC  TGCTACGA  3’  5’ GGTCGCTCTTACAAGGCA CAGCTAGTTTCACAGTGGCAAGTC 3’  5’ GCAGGCTTCTACATATCTGACGAG ATCCGAAGCATTCCAGGT 3’ F  5’ CGCATAGACCGTGATTGTTACCAG CTCGTCAGATATGTAGAAGCCTGC ACGTCGAT 3’ F  5’ GACTTGCCACTGTGAAACTAGCTG CGTTAGTTCAGACAGTAGGACTCC TGTCCAGA 3’
 
Biocomputer ,[object Object],[object Object],[object Object],[object Object]
Applications of DNA chip and microarray technology Pharmacogenomics (2000) 1(3):289-307
Companies involved in developing microarray DNA-chip technology for pharmacogenomics (from A to V)  Pharmacogenomics (2000) 1(3):289-307
Components of a DNA microchip . Pharmacogenomics (2000) 1(3):289-307
Types of transducer ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Electrochemical Sensors ,[object Object],[object Object],[object Object],[object Object]
Biofuel Cell   (J.A.C.S. 2001, 123, 8630)
Electronic Nose (Biosen. & Bioele. 14, 1999 9-18)
Surface Plasma Resonance (SPR)
 
Nanowire FET  (Sience 293, 17, August, 2001)
Semiconductor Devices as Sensors of Biological Reactions Mass Electron Heat Charge Light Modified Electrode Thermometer EnzymeFET Photodiodes SAW Enzymatic Reaction

More Related Content

Similar to Biochip 1

Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...
Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...
Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...Robert (Rob) Salomon
 
IRJET- Biochips Technology
IRJET-  	  Biochips TechnologyIRJET-  	  Biochips Technology
IRJET- Biochips TechnologyIRJET Journal
 
Supercharging MD Simulations with GPUs
Supercharging MD Simulations with GPUsSupercharging MD Simulations with GPUs
Supercharging MD Simulations with GPUsCan Ozdoruk
 
Bio Chip Project Report
Bio Chip Project ReportBio Chip Project Report
Bio Chip Project Reportpiyu k
 
Bioprocess Equipment Design and Economics
Bioprocess Equipment Design and EconomicsBioprocess Equipment Design and Economics
Bioprocess Equipment Design and EconomicsIlika Kaushik
 
Bioengineering: making life from scratch
Bioengineering: making life from scratchBioengineering: making life from scratch
Bioengineering: making life from scratchMelanie Swan
 
DNA sequencing: rapid improvements and their implications
DNA sequencing: rapid improvements and their implicationsDNA sequencing: rapid improvements and their implications
DNA sequencing: rapid improvements and their implicationsJeffrey Funk
 
DReAMS: High Performance Reconfigurable Computing at NECSTLab
DReAMS: High Performance Reconfigurable Computing at NECSTLabDReAMS: High Performance Reconfigurable Computing at NECSTLab
DReAMS: High Performance Reconfigurable Computing at NECSTLabNECST Lab @ Politecnico di Milano
 
Machine Learning for Molecules
Machine Learning for MoleculesMachine Learning for Molecules
Machine Learning for MoleculesIchigaku Takigawa
 
Novel In Vivo Concentration Detector
Novel In Vivo Concentration DetectorNovel In Vivo Concentration Detector
Novel In Vivo Concentration DetectorGerard Trimberger
 
⭐⭐⭐⭐⭐ #BCI System using a Novel Processing Technique Based on Electrodes Sele...
⭐⭐⭐⭐⭐ #BCI System using a Novel Processing Technique Based on Electrodes Sele...⭐⭐⭐⭐⭐ #BCI System using a Novel Processing Technique Based on Electrodes Sele...
⭐⭐⭐⭐⭐ #BCI System using a Novel Processing Technique Based on Electrodes Sele...Victor Asanza
 
3 d printed prosthetics
3 d printed prosthetics3 d printed prosthetics
3 d printed prostheticsLovnish Thakur
 
Masters_Thesis_ver.1.02
Masters_Thesis_ver.1.02Masters_Thesis_ver.1.02
Masters_Thesis_ver.1.02Thomas Balle
 

Similar to Biochip 1 (20)

Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...
Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...
Genomic Cytometry: Using Multi-Omic Approaches to Increase Dimensionality in ...
 
IRJET- Biochips Technology
IRJET-  	  Biochips TechnologyIRJET-  	  Biochips Technology
IRJET- Biochips Technology
 
Bio Chip Presentation
Bio Chip PresentationBio Chip Presentation
Bio Chip Presentation
 
Supercharging MD Simulations with GPUs
Supercharging MD Simulations with GPUsSupercharging MD Simulations with GPUs
Supercharging MD Simulations with GPUs
 
Bio Chip Project Report
Bio Chip Project ReportBio Chip Project Report
Bio Chip Project Report
 
14A81A05A3
14A81A05A314A81A05A3
14A81A05A3
 
Bioprocess Equipment Design and Economics
Bioprocess Equipment Design and EconomicsBioprocess Equipment Design and Economics
Bioprocess Equipment Design and Economics
 
Bioengineering: making life from scratch
Bioengineering: making life from scratchBioengineering: making life from scratch
Bioengineering: making life from scratch
 
Mauricio carrillo tripp
Mauricio carrillo trippMauricio carrillo tripp
Mauricio carrillo tripp
 
DNA sequencing: rapid improvements and their implications
DNA sequencing: rapid improvements and their implicationsDNA sequencing: rapid improvements and their implications
DNA sequencing: rapid improvements and their implications
 
BIOMED_presentation.ppt
BIOMED_presentation.pptBIOMED_presentation.ppt
BIOMED_presentation.ppt
 
DReAMS: High Performance Reconfigurable Computing at NECSTLab
DReAMS: High Performance Reconfigurable Computing at NECSTLabDReAMS: High Performance Reconfigurable Computing at NECSTLab
DReAMS: High Performance Reconfigurable Computing at NECSTLab
 
High Performance Reconfigurable Computing at NECSTLab
High Performance Reconfigurable Computing at NECSTLabHigh Performance Reconfigurable Computing at NECSTLab
High Performance Reconfigurable Computing at NECSTLab
 
Machine Learning for Molecules
Machine Learning for MoleculesMachine Learning for Molecules
Machine Learning for Molecules
 
Protein Nanotube based Probes for Cancer Cell Imaging
Protein Nanotube based Probes for Cancer Cell ImagingProtein Nanotube based Probes for Cancer Cell Imaging
Protein Nanotube based Probes for Cancer Cell Imaging
 
Novel In Vivo Concentration Detector
Novel In Vivo Concentration DetectorNovel In Vivo Concentration Detector
Novel In Vivo Concentration Detector
 
⭐⭐⭐⭐⭐ #BCI System using a Novel Processing Technique Based on Electrodes Sele...
⭐⭐⭐⭐⭐ #BCI System using a Novel Processing Technique Based on Electrodes Sele...⭐⭐⭐⭐⭐ #BCI System using a Novel Processing Technique Based on Electrodes Sele...
⭐⭐⭐⭐⭐ #BCI System using a Novel Processing Technique Based on Electrodes Sele...
 
HUGenomics: a support to genomics research.
HUGenomics: a support to genomics research.HUGenomics: a support to genomics research.
HUGenomics: a support to genomics research.
 
3 d printed prosthetics
3 d printed prosthetics3 d printed prosthetics
3 d printed prosthetics
 
Masters_Thesis_ver.1.02
Masters_Thesis_ver.1.02Masters_Thesis_ver.1.02
Masters_Thesis_ver.1.02
 

More from nayakslideshare (20)

Mips 64
Mips 64Mips 64
Mips 64
 
Digital Signature
Digital SignatureDigital Signature
Digital Signature
 
Spyware
SpywareSpyware
Spyware
 
Digital Signature
Digital SignatureDigital Signature
Digital Signature
 
Gis
GisGis
Gis
 
Lcd
LcdLcd
Lcd
 
Hyper Threading Technology
Hyper Threading TechnologyHyper Threading Technology
Hyper Threading Technology
 
Intro To Hacking
Intro To HackingIntro To Hacking
Intro To Hacking
 
Quantum Teleportation
Quantum TeleportationQuantum Teleportation
Quantum Teleportation
 
Biochip
BiochipBiochip
Biochip
 
Satellite Networks
Satellite NetworksSatellite Networks
Satellite Networks
 
Cybercrime
CybercrimeCybercrime
Cybercrime
 
Cybercrime 1
Cybercrime 1Cybercrime 1
Cybercrime 1
 
Touch Screens
Touch ScreensTouch Screens
Touch Screens
 
Linux Security
Linux SecurityLinux Security
Linux Security
 
Dna Fingerprinting
Dna FingerprintingDna Fingerprinting
Dna Fingerprinting
 
Thinking Critically About WWW
Thinking Critically About WWWThinking Critically About WWW
Thinking Critically About WWW
 
Remote Sensing
Remote SensingRemote Sensing
Remote Sensing
 
Teleportation
TeleportationTeleportation
Teleportation
 
Mobile Internet Connectivity
Mobile Internet ConnectivityMobile Internet Connectivity
Mobile Internet Connectivity
 

Recently uploaded

Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptxPasskey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptxLoriGlavin3
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 3652toLead Limited
 
Time Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directionsTime Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directionsNathaniel Shimoni
 
Dev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebDev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebUiPathCommunity
 
Gen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdfGen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdfAddepto
 
DevoxxFR 2024 Reproducible Builds with Apache Maven
DevoxxFR 2024 Reproducible Builds with Apache MavenDevoxxFR 2024 Reproducible Builds with Apache Maven
DevoxxFR 2024 Reproducible Builds with Apache MavenHervé Boutemy
 
Scale your database traffic with Read & Write split using MySQL Router
Scale your database traffic with Read & Write split using MySQL RouterScale your database traffic with Read & Write split using MySQL Router
Scale your database traffic with Read & Write split using MySQL RouterMydbops
 
SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024Lorenzo Miniero
 
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc
 
Generative AI for Technical Writer or Information Developers
Generative AI for Technical Writer or Information DevelopersGenerative AI for Technical Writer or Information Developers
Generative AI for Technical Writer or Information DevelopersRaghuram Pandurangan
 
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...AliaaTarek5
 
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxDigital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxLoriGlavin3
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity PlanDatabarracks
 
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)Mark Simos
 
SALESFORCE EDUCATION CLOUD | FEXLE SERVICES
SALESFORCE EDUCATION CLOUD | FEXLE SERVICESSALESFORCE EDUCATION CLOUD | FEXLE SERVICES
SALESFORCE EDUCATION CLOUD | FEXLE SERVICESmohitsingh558521
 
unit 4 immunoblotting technique complete.pptx
unit 4 immunoblotting technique complete.pptxunit 4 immunoblotting technique complete.pptx
unit 4 immunoblotting technique complete.pptxBkGupta21
 
The State of Passkeys with FIDO Alliance.pptx
The State of Passkeys with FIDO Alliance.pptxThe State of Passkeys with FIDO Alliance.pptx
The State of Passkeys with FIDO Alliance.pptxLoriGlavin3
 
Take control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test SuiteTake control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test SuiteDianaGray10
 
What is DBT - The Ultimate Data Build Tool.pdf
What is DBT - The Ultimate Data Build Tool.pdfWhat is DBT - The Ultimate Data Build Tool.pdf
What is DBT - The Ultimate Data Build Tool.pdfMounikaPolabathina
 
Rise of the Machines: Known As Drones...
Rise of the Machines: Known As Drones...Rise of the Machines: Known As Drones...
Rise of the Machines: Known As Drones...Rick Flair
 

Recently uploaded (20)

Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptxPasskey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptx
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365
 
Time Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directionsTime Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directions
 
Dev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebDev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio Web
 
Gen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdfGen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdf
 
DevoxxFR 2024 Reproducible Builds with Apache Maven
DevoxxFR 2024 Reproducible Builds with Apache MavenDevoxxFR 2024 Reproducible Builds with Apache Maven
DevoxxFR 2024 Reproducible Builds with Apache Maven
 
Scale your database traffic with Read & Write split using MySQL Router
Scale your database traffic with Read & Write split using MySQL RouterScale your database traffic with Read & Write split using MySQL Router
Scale your database traffic with Read & Write split using MySQL Router
 
SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024
 
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
 
Generative AI for Technical Writer or Information Developers
Generative AI for Technical Writer or Information DevelopersGenerative AI for Technical Writer or Information Developers
Generative AI for Technical Writer or Information Developers
 
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
 
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxDigital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity Plan
 
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
 
SALESFORCE EDUCATION CLOUD | FEXLE SERVICES
SALESFORCE EDUCATION CLOUD | FEXLE SERVICESSALESFORCE EDUCATION CLOUD | FEXLE SERVICES
SALESFORCE EDUCATION CLOUD | FEXLE SERVICES
 
unit 4 immunoblotting technique complete.pptx
unit 4 immunoblotting technique complete.pptxunit 4 immunoblotting technique complete.pptx
unit 4 immunoblotting technique complete.pptx
 
The State of Passkeys with FIDO Alliance.pptx
The State of Passkeys with FIDO Alliance.pptxThe State of Passkeys with FIDO Alliance.pptx
The State of Passkeys with FIDO Alliance.pptx
 
Take control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test SuiteTake control of your SAP testing with UiPath Test Suite
Take control of your SAP testing with UiPath Test Suite
 
What is DBT - The Ultimate Data Build Tool.pdf
What is DBT - The Ultimate Data Build Tool.pdfWhat is DBT - The Ultimate Data Build Tool.pdf
What is DBT - The Ultimate Data Build Tool.pdf
 
Rise of the Machines: Known As Drones...
Rise of the Machines: Known As Drones...Rise of the Machines: Known As Drones...
Rise of the Machines: Known As Drones...
 

Biochip 1

  • 1. Biochip Biosensor or bioprocessor that utilizes technologies of modern Biology and Electronics in a micro scale.
  • 2. Types of Biochip DNA chip Protein chip Enzyme chip Lab-on-a-chip Biomolecular machine Biocomputer
  • 3.
  • 4.  
  • 5.
  • 6.  
  • 8. An ideal biochip Size-portable Save energy-long term usage Low cost-mass production High sensitivity-integration Low sample requirement Microarray-high thru put Decreased invasiveness
  • 9. ASI Atomic Scale Integration LSI Large Scale Integration GSI Giga Scale Integration MSI Medium Scale Integration Time evolution in computer technology from zero to atomic scale integration (Ciabrera et al., 1991; Nicolini, 1993). ULSI Ultra Large Scale Integration SSI Small Scale Integration VLSI Very Large Scale Integration ZSI Zero Scale Integration
  • 10.  
  • 11. Features and factors of size reduction in microchip-based analysis TIBTECH DECEMBER 1999 (VOL 17)
  • 13.  
  • 14.
  • 15.  
  • 16.  
  • 17. DNA as Molecular Machine Construction and operation of the molecular tweezers. A DNA-fuelled molecular machinemade of DNA Bernard Yurk e *, Andrew J. Turber®el d* ², Allen P. Mills J r *, Friedrich C. Simme l* & Jennifer L. Neuman n* NATURE | VOL 406 | 10 AUGUST 2000 Name Sequence Domain 1 Domain 2 A 5’ TGCCTTGTAAGAGCGACCAT CAACCTGGAATGCTTCGGAT 3’ B 5’ GGTCGCTCTTACAAGGCA CTGGTAACAATCACGGTCTATGCG 3’ C 5’ GGAGTCCTACTGTCTGAACTAACG ATCCGAAGCATTCCAGGT 3’ F 5’ CGCATAGACCGTGATTGTTACCAG CGTTAGTTCAGACAGTAGGACTCC TGCTACGA 3’  5’ GGTCGCTCTTACAAGGCA CAGCTAGTTTCACAGTGGCAAGTC 3’  5’ GCAGGCTTCTACATATCTGACGAG ATCCGAAGCATTCCAGGT 3’ F  5’ CGCATAGACCGTGATTGTTACCAG CTCGTCAGATATGTAGAAGCCTGC ACGTCGAT 3’ F  5’ GACTTGCCACTGTGAAACTAGCTG CGTTAGTTCAGACAGTAGGACTCC TGTCCAGA 3’
  • 18.  
  • 19.
  • 20. Applications of DNA chip and microarray technology Pharmacogenomics (2000) 1(3):289-307
  • 21. Companies involved in developing microarray DNA-chip technology for pharmacogenomics (from A to V) Pharmacogenomics (2000) 1(3):289-307
  • 22. Components of a DNA microchip . Pharmacogenomics (2000) 1(3):289-307
  • 23.
  • 24.
  • 25. Biofuel Cell (J.A.C.S. 2001, 123, 8630)
  • 26. Electronic Nose (Biosen. & Bioele. 14, 1999 9-18)
  • 28.  
  • 29. Nanowire FET (Sience 293, 17, August, 2001)
  • 30. Semiconductor Devices as Sensors of Biological Reactions Mass Electron Heat Charge Light Modified Electrode Thermometer EnzymeFET Photodiodes SAW Enzymatic Reaction