SlideShare a Scribd company logo
1 of 96
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],CONTENIDO
El propósito del tratamiento dental ortodóntico es desplazar los dientes lo mas eficientemente posible con los mínimos efectos adversos posibles para el diente y los tejidos de soporte Introducción Martina von Bohl y Anne Marie Kuijpers-Jagtman  (2008) . European  Journal of Otrthodontics. 31: 30 - 36 Krishnan and Davidovitch, 2006; Masella and Meister, 2006; Meikle, 2006; Wise and King, 2008 Durante los últimos 100 años se han publicado muchos estudios relacionados con el movimiento dental ortodóntico y las reacciones celulares, tisulares y moleculares.
[object Object],[object Object],[object Object],El movimiento dental fisiológico  es el desplazamiento realizado por el diente para mantener su posición funcional;  asociado a  erupción, crecimiento dental y movimientos por fuerzas externas. Krishnan V, Davidovitch Z (2006) Am J Orthod Dentofacial Orthop 129, 469 e.1 – 469 e.26 GENERALIDADES El ligamento periodontal y el hueso alveolar  resisten el movimiento dental.
El movimiento dental fisiológico es un proceso lento que ocurre  principalmente en dirección vestibular gracias a regiones de tensión – presión en el periodonto El movimiento ortodóntico puede ocurrir rápida o lentamente según las características físicas de la fuerza aplicada y la respuesta biológica del ligamento periodontal (PDL): ,[object Object],[object Object],[object Object],Reitan K. (1960) Am J Ortho. 46 881 - 890 . Neuropéptidos, citocinas, factores de crecimiento y metabolitos del ácido araquidónico
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Movimiento ortodóntico / Movimiento ortopédico
[object Object],[object Object],[object Object],[object Object],Fuerza ortodóntica óptima Carga mecánica que permite el máximo movimiento dental con mínimo daño irreversible a la raíz, PDL y hueso alveolar  (150 – 200 G. Oppenheim & Reitan; Storey & Smith)
Principales mecanismos propuestos: ,[object Object],[object Object],[object Object],Masella R, Meister M. (2006) American Journal Of Orthodontics and Dentofacial Orthopedics 129: 458 –  468. Mecanismos de movimiento dental
[object Object],[object Object],[object Object],[object Object],Sandstet (1904); Oppenheim (1911); Schwarz (1932) TEORIA PRESION TENSION ,[object Object]
HIALINIZACION ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],HISTOLOGIA Las fuerzas ortodónticas no deben exceder la presión del lecho vascular capilar   (20 -25 g/cm2 de superficie radicular)
HIALINIZACION Se asume que un sistema de fuerzas óptimo es importante para producir una respuesta biológica adecuada en el periodonto ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
BONE BENDING El PDL es un sistema hidrostático continuo  Farrar J N, 1888; Baumrind S, 1969. El flexionamiento del hueso alveolar  juega un papel importante en el movimiento ortodóntico. Farrar J N, 1888. New York, De Vinne Press. 658 ,[object Object],[object Object],Baumrind S (1969) American Journal Of Orthodontics. 55: 12 –  22
SEÑALES BIOELECTRICAS La aplicación de fuerzas mecánicas genera potenciales eléctricos en los tejidos implicados Basset CAL & Becker RO, Science. 1962 ,[object Object],[object Object],[object Object],Zengo AN, Basset CA et al (1974) American Journal Of Orthodontics.  In  vivo bioelectric potentials in the dentoalveolar complex. 66: 130 –  139
REMODELADO OSEO
MATRIZ EXTRACELULAR  Fernández-Tresguerres I. (2006) Med Oral, Patol Oral, Cir Buc.11; 47 – 51. Fracción inorgánica: 65%. Cristales de Hidroxiapatita (Ca 10  (PO4) 6  (OH) 2 .  Calcio, Fosfato y Carbonato. Proporción de 10:6:1 SIBLINGS Small Integrin Binding Ligand, N-Linked Glycoprotein
CELULAS IMPLICADAS ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
REMODELADO OSEO Renovación  continu a  de la matriz org á nica y mineral del hueso que involucra  en primer lugar un aumento en la resorción   y mas tarde reactiva la formación  ósea  que se  efectúa en sitios especificos de actividad celular ciclica  (BMU) .  P ermite la renovación de un 5% del hueso cortical y un 20 % del trabecular al año.  L a  tasa de  renovación es de un 5-10% del hueso total al año. El  remodelado óseo   existe toda   la vida, pero sólo hasta la tercera década el balance es positivo.  Frost, H.M., 1963. Bone Remodeling Dynamics, Charles C. Thomas, Springfield,
Fernández-Tresguerres I. (2006) Med Oral, Patol Oral, Cir Buc.11; 151 – 57.
E l proceso de  modelado óseo  (los huesos aumentan de longitud y diametro)  carece  de actividades ciclicas localizadas de acoplamiento entre resorción y  formación sobre  la superficie ósea en modelado. La resorción y la aposición óseas en el  modelado óseo   ocurren en superficies  separadas; por lo tanto la activación en el  modelado óseo  puede   efectuarse   por resorción o formación óseas  (Frost, 1973; Burr and Martin, 1989)   MODELADO OSEO
HORMONAS CALCIOTROPAS HORMONAS INESPECIFICAS PTH VIT. D 3 (Calcitriol) CALCITONINA ESTROGENOS GLUCOCORTICOIDES ,[object Object],[object Object],TIROXINA ,[object Object],[object Object],[object Object],[object Object],REGULACION  ENDOCRINA
PROCESOS CELULARES Y MOLECULARES
PROCESO INFLAMATORIO Mediadores bioquímicos  3 FASES DEL MOVIMIENTO DENTAL: Inicial, estacionaria, post estacionaria ,[object Object],[object Object],[object Object],[object Object]
La respuesta inflamatoria causa destrucción tisular Activación de linfocitos B, Linfocitos T, síntesis y liberación de  mediadores químicos de la inflamación. Citocinas pro inflamatorias y factores de crecimiento  asociados con  la reabsorción ósea : IL-1 TNF- α Teng YT. (2003) Crit Rev Oral Biolo Med. 14: 237 - 252 REMODELADO OSEO - Depósito Resorción
[object Object],[object Object],[object Object],Pérdida del tejido conectivo Bloqueo de mecanismos que controlan la destrucción tisular:   Inhibidores Tisulares de las Metaloproteinasas de la Matriz
Factores solubles moduladores del remodelado óseo
OPG c-Fms- RANK- c-Fms+ RANK- c-Fms+ RANK+ TNF  , IL-1, IL-6, IL-7, otras IL’s OPG, RANKL, M-CSF HSC GCs Prostaglandinas, citocinas, IL’s y vitamina D M-CSF Estroma/osteoblastos RANKL TNF  T T E 2 T M-CSF RANKL + TGF  IFN  Dentina Hueso
Osteoclastos ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],FENOTIPO M.E.C
RANK RANK Borde rugoso Zona clara Zona clara Osteoclastos C-Fms C-Fms M.E.C HCO 3 - Cl - H + HCO 3 - Cl - Cat K  v  3 H + Cl - M.E.C
............................. HCO 3 - Cl - H + HCO 3 - Cl - Cat K  v  3 H + Cl - M.E.C xxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxx :: :: Estímulos Borde en cepillo :: . . . .  . . . .  . . . .  M.E.C. Núcleo Microtúbulos  v  3 :: :: :: :: :: :: :: . . . .  . . . .
Diferenciación y destino Apoptosis Adhesión Polarización Resorción Célula Stem Proliferación Diferenciación CSF-GM Fusión PTH, IL1, Vit. D
© American Society for Bone and Mineral Research. Primer, F. Patrick Ross, Ph.D.
Resorción ósea.
RANK  = PRECURSORES DE OSTEOCLASTOS, OSTEOCLASTOS OPG  = CELULAS DEL ESTROMA DE MEDULA OSEA, OSTEOBLASTOS, FIBROBLASTOS DEL LIGAMENTO PERIODONTAL RANK-L   = OSTEOBLASTOS, CELULAS ESTROMALES  DE LA MEDULA ÓSEA, FIBROBLASTOS RECEPTORES FAMILIA TNF Inhibidor de la activación y la diferenciación osteoclástica ,[object Object],[object Object],[object Object]
REGULACION DEL SISTEMA RANKL/OPG/RANK.
RANK (Receptor of Nuclear Factor Kappa) y su ligando RANK-L: Diferenciación  de preosteoclastos Activación y mantenimiento de osteoclastos. REMODELADO OSEO ALTERADO Goldring S R. (2003) inflammatory mediators as essential elements  in bone remodeling. Calcif Tissue Int 73: 97-100
OSTEOCLASTOGENESIS
 
TRANSDUCCION DE SEÑALES
Juan Carlos Munévar N Definición Mecanismo por el cual una célula responde a los estímulos que recibe del medio ambiente mediante  difusión de esas señales  hacia  sus compartimentos internos.
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],ETAPAS DE LA COMUNICACIÓN  CELULAR POR SEÑALES EXTRACELULARES
 
 
 
 
Señalización RANK RANK / RANKL ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],RANK
 v  3 c-Fms RANK TNFR1 IL1-R1 ERKs ERKs Mitf P c-src PI3K AKT C S D JNK AP1 NFATc1 D p38 Ca ++ CaM c-src PI3K AKT C S NF  B D JNK AP1 D NF  B D NFATc1 IKK  IRAK E2F = Cinasa = Factor de Transcripción P = Proliferación C = Reorganización del citoesqueleto S = Supervivencia D = Diferenciación CN
Papel de la transdución de señales en la regulación de la expresión de genes
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],REGULACION DE LA EXPRESION DE GENES.
Heterodímero inactivo en el citosol:  2 subunidades p50 / p65 asociado con un inhibidor I  B Expresión génica p50 / p65 Poseen dominios que reconocen motivos específicos de  ADN.   Análogos de AMPc NF-  B k Factor de Transcripción activado por: Citocinas Factores de crecimiento Esteres de forbol Lipopolisacáridos TNF Ácido Okadaico
Factor de Transcripción con dominios que reconocen motivos específicos de  ADN. NFkB se transloque al núcleo Motivo   B en el ADN Secuencias promotoras / enhancers La disociación del complejo p50 / p65 /  IkB : NF-  B k I  B Inactivado por PKC / PKA   Fosforilación / Desfosforilación 5’-GGGPuNNPiPiCC-3’
Genes con motivo   B ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Linfocitos T y B Actividad antiviral / antiproliferativa Activación de neutrófilos, macrófagos Sensible a estímulos que señalan un proceso inflamatorio NF-  B k
La transcripción de genes  activados por el  AMPc   está regulada por FACTORES DE  TRANSCRIPCION que se unen al elemento de  respuesta CRE en el ADN. CRE:  AMPc response element. CREB Expresión génica
GENES CON MOTIVO C.R.E. 1. Enzimas metabolismo intermedio 2. Péptidos Bioactivos. 3. Fibronectina plasmática. 4. Proto oncogen c-fos 1. Tiroxina hidroxilasa 2. Somatostatina
MOTIVO  C.R.E. Motivos  octaméricos Secuencia CONSENSUS:  5’-TGACGTCA - 3’ Elementos de respuesta al AMPc  del ADN CREB :  CRE BINDING PROTEINS . Factores de transcripción de genes  que poseen el motivo C.R.E.  Localización: 1. Núcleo celular. 2. Fosforilados por PKA
MECANISMO  DE  ACCION. 1. La P.K. A  fosforila las proteínas CREB. 2. Factores de Transcripción se une a C.R.E. 3. TRANSCRIPCION  DE  GEN ESPECIFICO > [cAMP]° inducen la translocación de la  subunidad catalítica P.K. A
EXPRESION  DE  GENES. Los factores de transcripción C.R.E.B pueden ser  fosforilados por: 1. P.K.A   (Células  mesenquimatosas.) 2. Quinasas I y II Ca2/Calmodulina   (Neuronas.) Transcripción de genes distintos.
FACTOR MOTIVO INFORMACION C-Myc / Max CACGTG C-Myc: oncogen retroviral, se asocia con Max. c-Fos / c-Jun TGAC/GTC/AA Oncogenes retrovirales Factor AP-1 CREB TGACGC/7C/AG/A Une a CRE, familia de al menos 10 factores, dímeros con c-Jun C-ErbA; (TR: Receptor de la hormona Tiroidea) G/CA/CGGAA/TGT/C Oncogen retroviral, miembro de la superfamilia de receptores hormonales esteroides/tiroides C-Ets G/CA/CGGAA/TGT7C Oncogen retroviral predominante en células B y T GATA T/AGATA Familia de factores específicos de líneas eritroides C-Myb T/CAACG/TG Oncogen retroviral, factor especifico de células hematopoyéticas NFkB & c-Rel GGGAA/CTNT/CCC c-Rel: Oncogen retroviral, predominan en células B y T RAR ACGTCATGACCT Une elementos RARES, así como sitios c-Jun / c-Fos SRF (Serum response factor) GGATGTTCCATATTAGGACATCT Presente en genes inducibles por factores de crecimiento presentes en suero ISGF3  (Interferon    stimulated gene factor 3) A/GGAAAA/GNGAAACT Activación por proteínas quinasa. El motivo ISRE presente en genes de respuesta antiviral y antitumoral
 
FORMACION  OSEA
OSTEOBLASTOS ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],http://depts.washington.edu/bonebio/ASBMRed/cells.html#oclasts FENOTIPO
Osteoblasto Mesenquima Alberts et al. Mol Bio. Cell, 4th Ed. Osteoblastos Producción MEC Mineralización/Osteoide maduración ~10días Osteocito Apoptosis
Factores solubles Endocrina Paracrina Autocrina Hormona Paratiroidea (PTH) (   resorción ósea*) Proteína relacionada PTH TGF β 1, 2, 3 Vitamina D (   resorción ósea*) Factores de crecimiento transformante (TGF)  β 1,2,3 FGF 1, 2 Calcitonina  (   resorción ósea*) Factor de crecimiento fibroblástico (FGF) 1, 2 IGF´s Glucocorticoides IGF’s PDGF’s Esteroides (E, T) Proteínas óseas morfogéneticas (BMP) 2-7 BMP 2-7 Insulina (PDGF’s) OTROS Interleucina-6
BIOMINERALIZACION
DEFINICIÓN   Precipitación de sales insolubles de fosfato de Calcio inducida por los productos de metabolismo celular. ,[object Object],[object Object],[object Object],[object Object],ETAPAS: 1 .Nucleación  2. Crecimiento Cristalino BIOMINERALIZACION Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca
Mecanismos Controlados ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
NUCLEACION En todo sistema biológico  encontramos dos fases químicas diferentes (Fase Orgánica y una Fase Inorgánica).  EQUILIBRIO Ruptura de equilibrio Transformación de masas Sobresaturación La concentración de las dos fases  Tejidos Conectivos, epitelio, Etc. Las partículas neoformadas crecen hasta un tamaño critico en donde los núcleos no podrán disolverse
FASES MINERALES ,[object Object],[object Object],TEJIDOS DUROS Minerales en forma cristalina Calcita Aragonita Ácido sílico coelestina apatita witlockite
Los fosfatos de calcio poco solubles (apatita) son de gran interes por ser componentes del esqueleto y la dentina FASES MINERALES Calcita Aragonita Ácido silico coelestina apatita witlockite Fosfato octacálcico CaC03, Moluscos, artrópodos, Diatomeas. Radiolares Dientes, esqueleto Calcificaciones patológicas.
TEORIAS ,[object Object],[object Object],Ej:  PRECIPTACION DENSA,  cristales HA alrededor de la trama colágena del hueso compacto ,[object Object],[object Object],[object Object],¿Las interacciones moleculares y los procesos físico-químicos...?
[object Object],[object Object],[object Object],Posición del problema b). Los hechos: ,[object Object],[object Object],a). Tipo de mineral: MECANISMOS
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Exigencias biológicas
DEFINICIONES ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
La sobresaturación del medio y el aumento de la energía dominan la biomineralización. En los sistemas biológicos la nucleación se efectúa a  temperaturas moderadas en interfases heterogéneas Matriz inducida   Sistema biológicos primitivos NUCLEACION Matriz Mediada Tejidos Calcificados M.E.C  sirve de sitio de nucleación  y dirige la orientación de los cristales ,[object Object],[object Object],[object Object],[object Object]
NUCLEACIÓN HOMOGÉNEA Aumento local de iones orgánicos, para permitir la precipitación espontánea del los cristales. NUCLEACION Ca Ca Ca La presencia de sustancias  de nucleacion (sustancias que disminuyen el aporte de energía necesario para la mineralización) también puede llevar a la formación de cristales en ausencia de un incremento local  de la concentración de iones. Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca NUCLEACIÓN HETEROGENEA
INICIO DE LA MINERALIZACION ¿Como a partir de una solución iónica por debajo del producto de solubilidad se puede constituir una fase sólida? MECANISMO BOOSTER Por  medio del cual se produce un aumento del producto iónico por encima del nivel de precipitación espontánea. ,[object Object],[object Object],1. COMPARTIMENTOS  VERDADEROS 2. ZONAS  ASIMILABLES  A  COMPARTIMENTOS A. VESICULAS MATRICIALES B. MITOCONDRIAS (DRIENSSENS  1982)
1. VERDADEROS ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],COMPARTIMENTOS (sitios donde aumenta la concentración de iones) B. MITOCONDRIAS ,[object Object]
+  El inicio de la nucleación se podría hacer a partir de pequeños nódulos cristalinos desprendidos de los cristales HA existentes.  +  Esos nódulos quedan atrapados en los espacios colágenos para permitir el crecimiento del cristal. 2. ZONAS  ASIMILABLES  A  COMPARTIMENTOS COMPARTIMENTOS ,[object Object],[object Object],LAS  FIBRILLAS SE CONSIDERAN  INDUCTORES  Y  REGULADORES DE LA MINERALIZACION. GLIMCHER, 1976
INICIO DE LA MINERALIZACION ¿Como a partir de una solución iónica por debajo del producto de solubilidad se puede constituir una fase sólida? INTERVENCION DE INICIADORES MOLECULAS ORGÁNICAS A. FOSFOPROTEINAS B. PROTEINAS ACIDAS C. FOSFOLIPIDOS ACIDOS D. COLAGENO ,[object Object],[object Object],[object Object],[object Object]
INICIO DE LA MINERALIZACION ¿Por qué los tejidos que contienen nucleadores potenciales  NO  se mineralizan o bien por qué la mineralización se produce en momentos específicos? ,[object Object],[object Object],[object Object],INTERVENCION DE INHIBIDORES A. PIROFOSFATOS B. MAGNESIO & CITRATO ,[object Object],[object Object],C. PROTEOGLICANOS ,[object Object]
CRECIMIENTO CRISTALINO 6 Etapas: ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Predominio de la interfase sólida a la liquida EPITAXIA Formación de una nueva fase cristalina en la superficie de un cristal Fenómeno que facilita la formación de un 2do cristal
CRECIMIENTO DEL CRISTAL Aumento de la masa mineral  que determina la NATURALEZA, NUMERO, TALLA Y FORMA de los cristales. Los procesos de regulación involucran: ,[object Object],[object Object],[object Object],FASES: Fosfato octocálcico. HIDROXIAPATITA (Ca 2+ ) + (Pi) Brushita Fosfato de calcio amorfo
CRECIMIENTO DEL CRISTAL 1. Control de la velocidad y repartición del crecimiento en cuanto a la talla y número de cristales. Diferencia en el crecimiento en longitud y espesor de  un cristal  (ESMALTE DENTAL) 2. Control del cese de crecimiento; cuando se define la talla y forma de los cristales se observa la detención  del crecimiento. TEORIAS Los parámetros físico-químicos no son los únicos que controlan el crecimiento del cristal. CONTROL PROTEICO In vitro # In vivo
BIOMINERALIZACION  DENTAL TEJIDOS  DENTALES  MINERALIZADOS : ,[object Object],[object Object],ESTRUCTURA  DENTAL MINERALIZADA : ,[object Object],[object Object],PULPA DENTAL ,[object Object],[object Object],[object Object],Colágeno, Proteínas no colágenas Proteínas específicas ,[object Object]
CEMENTO ,[object Object],[object Object],[object Object],[object Object],DENTINA ,[object Object],[object Object],[object Object],[object Object],[object Object],El PO 4  y Ca 2+   se acumulan, se combinan y estabilizan para formar  HIDROXIAPATITA BIOMINERALIZACION
Estructura derivada de la célula o la matriz Tejido dental Componentes implicados Microestructuras  celulares Mineralización inducida por la M.E.C. Vesículas matriciales Mineralizaciones intracelulares Débris celulares Manto dentina Cemento acelular Pulpolitos Fosfolípidos mb. Proteoglicanos. Anexina I. Fosfolípidos mb. Proteoglicanos. M.E.C. Proteínas colagenas no colagenas Dentina Intertubular Cemento celular acelular Colágenos I,V,VI P. Fosforiladas DSP no fosforilada Proteoglicanos Proteína GLA fosfolípidos Proteínas séricas Factores de crecimiento proteínas no colagenas M.E.C. Dentina Peritubular Esmalte Amelogeninas Enamelinas Lípidos Proteoglicanos Glicoproteínas
MICROESTRUCTURAS DERIVADAS DE LA CELULA 1. Vesículas matriciales 2. Débris celulares ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
[object Object],[object Object],[object Object],[object Object]
¿Porque los fluidos tisulares sobresaturados en iones de  Fosfato y de calcio no se mineralizan? ,[object Object],[object Object],[object Object],[object Object],BIOMINERALIZACION
Este es un proceso altamente controlado. Esta mineralización no solo envuelve el colágeno como sustrato sino que también proteínas no colágenas  ( son iniciadoras  de la mineralización)  de la matriz secretadas al frente de mineralización . En los tejidos conectivos calcificados existen dos mecanismos para la mineralización Vesículas Matriciales Nucleacion Heterogénea Pequeño organelo intracelular membranoso donde se observa la primera evidencia morfológica de un cristal  BIOMINERALIZACION
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],BIOMINERALIZACION
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],BIOMINERALIZACION FOSFATASA ALCALINA Asociada  con la formación de tejidos mineralizados
COMO LLEGA EL MINERAL AL SITIO DE MINERALIZACIÓN 1.  Papel de proteoglicanos 2.  Síntesis de colágeno 3.   Vía de iones inorgánicos entre células. Presumiblemente unidas a macromoléculas 4.   Vía iones inorgánicos dentro de la  célula.  5.   Participación mitocondrial
CONCLUSIONES  ,[object Object],[object Object]
Dr. Juan Carlos Munévar N. INSTITUTO U.I.B.O. FACULTAD DE ODONTOLOGIA

More Related Content

What's hot

análisis de modelos en ortodoncia
análisis de modelos en ortodonciaanálisis de modelos en ortodoncia
análisis de modelos en ortodoncia C.D. Paquito
 
Fisiología de la oclusión
Fisiología de la oclusiónFisiología de la oclusión
Fisiología de la oclusiónCat Lunac
 
Análisis de modelos en dentición mixta
Análisis de modelos en dentición mixtaAnálisis de modelos en dentición mixta
Análisis de modelos en dentición mixtaEva Portillo Nava
 
Influencias Genéticas en el Movimiento Dental
Influencias Genéticas en el Movimiento DentalInfluencias Genéticas en el Movimiento Dental
Influencias Genéticas en el Movimiento DentalJuan Carlos Munévar
 
clasificacion-de-lisher.docx
clasificacion-de-lisher.docxclasificacion-de-lisher.docx
clasificacion-de-lisher.docxDanielaBolvar4
 
Principios de fisica en ortodoncia biomecanica. uribe
Principios de fisica en ortodoncia  biomecanica. uribePrincipios de fisica en ortodoncia  biomecanica. uribe
Principios de fisica en ortodoncia biomecanica. uribeDavid Gamboa
 
ANALISIS DE MODELOS
ANALISIS DE MODELOSANALISIS DE MODELOS
ANALISIS DE MODELOSEdlyn Martz
 
Oclusión 1 2 Vertientes filosóficas, anatomía y contactos a-b-c
Oclusión 1 2 Vertientes  filosóficas, anatomía y contactos a-b-cOclusión 1 2 Vertientes  filosóficas, anatomía y contactos a-b-c
Oclusión 1 2 Vertientes filosóficas, anatomía y contactos a-b-cedomarino
 
Fisiologia de oclusion
Fisiologia de oclusionFisiologia de oclusion
Fisiologia de oclusionCat Lunac
 
ANALISIS DE MODELOS DE ESTUDIO
ANALISIS  DE MODELOS DE ESTUDIOANALISIS  DE MODELOS DE ESTUDIO
ANALISIS DE MODELOS DE ESTUDIOyanixebjimenez
 
Posiciones y Movimientos Mandibulares
Posiciones y Movimientos MandibularesPosiciones y Movimientos Mandibulares
Posiciones y Movimientos MandibularesOliver Feng
 
METALES Y ALAMBRES DE ORTODONCIA
METALES Y ALAMBRES DE ORTODONCIAMETALES Y ALAMBRES DE ORTODONCIA
METALES Y ALAMBRES DE ORTODONCIAelipamruiz
 
Terminologia ortodontica
Terminologia ortodonticaTerminologia ortodontica
Terminologia ortodonticaTatiana Ortiz
 
Relaciones intermaxilares y relación molar y canina [recuperado]
Relaciones intermaxilares y relación molar y canina [recuperado]Relaciones intermaxilares y relación molar y canina [recuperado]
Relaciones intermaxilares y relación molar y canina [recuperado]angie bernedo
 

What's hot (20)

análisis de modelos en ortodoncia
análisis de modelos en ortodonciaanálisis de modelos en ortodoncia
análisis de modelos en ortodoncia
 
Fisiología de la oclusión
Fisiología de la oclusiónFisiología de la oclusión
Fisiología de la oclusión
 
Análisis de modelos en dentición mixta
Análisis de modelos en dentición mixtaAnálisis de modelos en dentición mixta
Análisis de modelos en dentición mixta
 
Teorias de scott
Teorias de scottTeorias de scott
Teorias de scott
 
Influencias Genéticas en el Movimiento Dental
Influencias Genéticas en el Movimiento DentalInfluencias Genéticas en el Movimiento Dental
Influencias Genéticas en el Movimiento Dental
 
clasificacion-de-lisher.docx
clasificacion-de-lisher.docxclasificacion-de-lisher.docx
clasificacion-de-lisher.docx
 
Diagnóstico -Tipos de Mordida
Diagnóstico -Tipos de MordidaDiagnóstico -Tipos de Mordida
Diagnóstico -Tipos de Mordida
 
Principios de fisica en ortodoncia biomecanica. uribe
Principios de fisica en ortodoncia  biomecanica. uribePrincipios de fisica en ortodoncia  biomecanica. uribe
Principios de fisica en ortodoncia biomecanica. uribe
 
ANALISIS DE MODELOS
ANALISIS DE MODELOSANALISIS DE MODELOS
ANALISIS DE MODELOS
 
Biomecanica Ansas
Biomecanica AnsasBiomecanica Ansas
Biomecanica Ansas
 
Oclusión 1 2 Vertientes filosóficas, anatomía y contactos a-b-c
Oclusión 1 2 Vertientes  filosóficas, anatomía y contactos a-b-cOclusión 1 2 Vertientes  filosóficas, anatomía y contactos a-b-c
Oclusión 1 2 Vertientes filosóficas, anatomía y contactos a-b-c
 
Fisiologia de oclusion
Fisiologia de oclusionFisiologia de oclusion
Fisiologia de oclusion
 
ANALISIS DE MODELOS DE ESTUDIO
ANALISIS  DE MODELOS DE ESTUDIOANALISIS  DE MODELOS DE ESTUDIO
ANALISIS DE MODELOS DE ESTUDIO
 
Posiciones y Movimientos Mandibulares
Posiciones y Movimientos MandibularesPosiciones y Movimientos Mandibulares
Posiciones y Movimientos Mandibulares
 
METALES Y ALAMBRES DE ORTODONCIA
METALES Y ALAMBRES DE ORTODONCIAMETALES Y ALAMBRES DE ORTODONCIA
METALES Y ALAMBRES DE ORTODONCIA
 
Angulo de bennet
Angulo de bennetAngulo de bennet
Angulo de bennet
 
Oclusionnnnnn
OclusionnnnnnOclusionnnnnn
Oclusionnnnnn
 
Movimientos dentales
Movimientos dentalesMovimientos dentales
Movimientos dentales
 
Terminologia ortodontica
Terminologia ortodonticaTerminologia ortodontica
Terminologia ortodontica
 
Relaciones intermaxilares y relación molar y canina [recuperado]
Relaciones intermaxilares y relación molar y canina [recuperado]Relaciones intermaxilares y relación molar y canina [recuperado]
Relaciones intermaxilares y relación molar y canina [recuperado]
 

Viewers also liked

Reabsorcion radicular en ortodoncia
Reabsorcion radicular en ortodonciaReabsorcion radicular en ortodoncia
Reabsorcion radicular en ortodonciaAlan Ibarra
 
ESTUDIO RADIOGRÁFICO DE LOS PROCESOS REABSORTIVOS
ESTUDIO RADIOGRÁFICO DE LOS PROCESOS REABSORTIVOSESTUDIO RADIOGRÁFICO DE LOS PROCESOS REABSORTIVOS
ESTUDIO RADIOGRÁFICO DE LOS PROCESOS REABSORTIVOSUniversidad de Los Andes
 
BIOLOGIA OSEA EN LA ENFERMEDAD PERIODONTAL
BIOLOGIA OSEA EN LA ENFERMEDAD PERIODONTALBIOLOGIA OSEA EN LA ENFERMEDAD PERIODONTAL
BIOLOGIA OSEA EN LA ENFERMEDAD PERIODONTALJuan Carlos Munévar
 
PRINCIPIOS MOLECULARES Y CELULARES EN BIOLOGIA OSEA
PRINCIPIOS MOLECULARES Y CELULARES EN BIOLOGIA OSEAPRINCIPIOS MOLECULARES Y CELULARES EN BIOLOGIA OSEA
PRINCIPIOS MOLECULARES Y CELULARES EN BIOLOGIA OSEAJuan Carlos Munévar
 
Biologia de la radiación y proteccion contra la radiación
Biologia de la radiación y proteccion contra la radiaciónBiologia de la radiación y proteccion contra la radiación
Biologia de la radiación y proteccion contra la radiaciónJoyce Roca
 
Biologia molecular y celular del hueso alveolar
Biologia molecular y celular del hueso alveolarBiologia molecular y celular del hueso alveolar
Biologia molecular y celular del hueso alveolarJuan Carlos Munévar
 
Biologia en reparacion de fracturas
Biologia en reparacion de fracturas Biologia en reparacion de fracturas
Biologia en reparacion de fracturas allman
 
Cicatrizacion y regeneracion tisular guiada
Cicatrizacion y regeneracion tisular guiadaCicatrizacion y regeneracion tisular guiada
Cicatrizacion y regeneracion tisular guiadaCarlos González
 

Viewers also liked (9)

Reabsorcion radicular en ortodoncia
Reabsorcion radicular en ortodonciaReabsorcion radicular en ortodoncia
Reabsorcion radicular en ortodoncia
 
ESTUDIO RADIOGRÁFICO DE LOS PROCESOS REABSORTIVOS
ESTUDIO RADIOGRÁFICO DE LOS PROCESOS REABSORTIVOSESTUDIO RADIOGRÁFICO DE LOS PROCESOS REABSORTIVOS
ESTUDIO RADIOGRÁFICO DE LOS PROCESOS REABSORTIVOS
 
Reabsorcion dental
Reabsorcion dentalReabsorcion dental
Reabsorcion dental
 
BIOLOGIA OSEA EN LA ENFERMEDAD PERIODONTAL
BIOLOGIA OSEA EN LA ENFERMEDAD PERIODONTALBIOLOGIA OSEA EN LA ENFERMEDAD PERIODONTAL
BIOLOGIA OSEA EN LA ENFERMEDAD PERIODONTAL
 
PRINCIPIOS MOLECULARES Y CELULARES EN BIOLOGIA OSEA
PRINCIPIOS MOLECULARES Y CELULARES EN BIOLOGIA OSEAPRINCIPIOS MOLECULARES Y CELULARES EN BIOLOGIA OSEA
PRINCIPIOS MOLECULARES Y CELULARES EN BIOLOGIA OSEA
 
Biologia de la radiación y proteccion contra la radiación
Biologia de la radiación y proteccion contra la radiaciónBiologia de la radiación y proteccion contra la radiación
Biologia de la radiación y proteccion contra la radiación
 
Biologia molecular y celular del hueso alveolar
Biologia molecular y celular del hueso alveolarBiologia molecular y celular del hueso alveolar
Biologia molecular y celular del hueso alveolar
 
Biologia en reparacion de fracturas
Biologia en reparacion de fracturas Biologia en reparacion de fracturas
Biologia en reparacion de fracturas
 
Cicatrizacion y regeneracion tisular guiada
Cicatrizacion y regeneracion tisular guiadaCicatrizacion y regeneracion tisular guiada
Cicatrizacion y regeneracion tisular guiada
 

Similar to Biología del Movimiento Dental

biomecanica y mecanica del tratamiento ortodontico
biomecanica y mecanica del tratamiento ortodonticobiomecanica y mecanica del tratamiento ortodontico
biomecanica y mecanica del tratamiento ortodonticoclaudia cano
 
Efectos de ortodoncia en la pulpa dental
Efectos de ortodoncia en la pulpa dentalEfectos de ortodoncia en la pulpa dental
Efectos de ortodoncia en la pulpa dentalKattyrv
 
Remodelación Ösea UBA.pdf
Remodelación Ösea UBA.pdfRemodelación Ösea UBA.pdf
Remodelación Ösea UBA.pdfDianaLopez437550
 
Sesión 2,Osteointegración en Implantología.
Sesión 2,Osteointegración en Implantología.Sesión 2,Osteointegración en Implantología.
Sesión 2,Osteointegración en Implantología.JoaoEstrella1
 
RESPUESTA CELULAR A LA APLICACIÓN DE FUERZAS EN LAS SUTURAS CRANEOFACIALES
RESPUESTA CELULAR A LA APLICACIÓN DE FUERZAS EN LAS SUTURAS CRANEOFACIALESRESPUESTA CELULAR A LA APLICACIÓN DE FUERZAS EN LAS SUTURAS CRANEOFACIALES
RESPUESTA CELULAR A LA APLICACIÓN DE FUERZAS EN LAS SUTURAS CRANEOFACIALESJuan Carlos Munévar
 
Profundización en Biologia Osea para postgrados en el área de la salud
Profundización en Biologia Osea para postgrados en el área de la saludProfundización en Biologia Osea para postgrados en el área de la salud
Profundización en Biologia Osea para postgrados en el área de la saludJuan Carlos Munévar
 
MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...
MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...
MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...Juan Carlos Munévar
 
BIOLOGIA DEL MOVIMIENTO DENTAL.pptx
BIOLOGIA DEL MOVIMIENTO DENTAL.pptxBIOLOGIA DEL MOVIMIENTO DENTAL.pptx
BIOLOGIA DEL MOVIMIENTO DENTAL.pptxJENNYPAOLAVALENCIAVA
 
MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...
MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...
MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...Juan Carlos Munévar
 
Farmacología del hueso y las articulaciones
Farmacología del hueso y las articulacionesFarmacología del hueso y las articulaciones
Farmacología del hueso y las articulacionesEduardo Palmeño
 
Ligamento periodontal
Ligamento periodontal Ligamento periodontal
Ligamento periodontal Ricardo Benza
 
Artritis, artrosis, osteoporosis
Artritis, artrosis, osteoporosisArtritis, artrosis, osteoporosis
Artritis, artrosis, osteoporosisJimena Garrido
 

Similar to Biología del Movimiento Dental (20)

Mediadores-en-Ortodoncia.pdf
Mediadores-en-Ortodoncia.pdfMediadores-en-Ortodoncia.pdf
Mediadores-en-Ortodoncia.pdf
 
biomecanica y mecanica del tratamiento ortodontico
biomecanica y mecanica del tratamiento ortodonticobiomecanica y mecanica del tratamiento ortodontico
biomecanica y mecanica del tratamiento ortodontico
 
Efectos de ortodoncia en la pulpa dental
Efectos de ortodoncia en la pulpa dentalEfectos de ortodoncia en la pulpa dental
Efectos de ortodoncia en la pulpa dental
 
Regeneración Osea Guiada con R.T.R (Septodont).
Regeneración Osea Guiada con R.T.R (Septodont).Regeneración Osea Guiada con R.T.R (Septodont).
Regeneración Osea Guiada con R.T.R (Septodont).
 
Remodelación Ösea UBA.pdf
Remodelación Ösea UBA.pdfRemodelación Ösea UBA.pdf
Remodelación Ösea UBA.pdf
 
Sesión 2,Osteointegración en Implantología.
Sesión 2,Osteointegración en Implantología.Sesión 2,Osteointegración en Implantología.
Sesión 2,Osteointegración en Implantología.
 
RESPUESTA CELULAR A LA APLICACIÓN DE FUERZAS EN LAS SUTURAS CRANEOFACIALES
RESPUESTA CELULAR A LA APLICACIÓN DE FUERZAS EN LAS SUTURAS CRANEOFACIALESRESPUESTA CELULAR A LA APLICACIÓN DE FUERZAS EN LAS SUTURAS CRANEOFACIALES
RESPUESTA CELULAR A LA APLICACIÓN DE FUERZAS EN LAS SUTURAS CRANEOFACIALES
 
Profundización en Biologia Osea para postgrados en el área de la salud
Profundización en Biologia Osea para postgrados en el área de la saludProfundización en Biologia Osea para postgrados en el área de la salud
Profundización en Biologia Osea para postgrados en el área de la salud
 
Osteoporosis.pptx
Osteoporosis.pptxOsteoporosis.pptx
Osteoporosis.pptx
 
MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...
MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...
MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...
 
Osteoporosis
OsteoporosisOsteoporosis
Osteoporosis
 
BIOLOGIA DEL MOVIMIENTO DENTAL.pptx
BIOLOGIA DEL MOVIMIENTO DENTAL.pptxBIOLOGIA DEL MOVIMIENTO DENTAL.pptx
BIOLOGIA DEL MOVIMIENTO DENTAL.pptx
 
Osteoporosis
OsteoporosisOsteoporosis
Osteoporosis
 
MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...
MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...
MECANISMO DE ACCIÓN DE ANTIINFLAMATORIOS NO ESTEROIDEOS (AINEs) Y EL MOVIMIEN...
 
Farmacología del hueso y las articulaciones
Farmacología del hueso y las articulacionesFarmacología del hueso y las articulaciones
Farmacología del hueso y las articulaciones
 
Ligamento periodontal
Ligamento periodontal Ligamento periodontal
Ligamento periodontal
 
Craneosinostosis
CraneosinostosisCraneosinostosis
Craneosinostosis
 
Craneosinostosis
CraneosinostosisCraneosinostosis
Craneosinostosis
 
Osteoporosis
Osteoporosis Osteoporosis
Osteoporosis
 
Artritis, artrosis, osteoporosis
Artritis, artrosis, osteoporosisArtritis, artrosis, osteoporosis
Artritis, artrosis, osteoporosis
 

More from Juan Carlos Munévar

Biología de los Tejidos de la cavidad oral, cabeza y cuello
Biología de los Tejidos de la cavidad oral, cabeza y cuelloBiología de los Tejidos de la cavidad oral, cabeza y cuello
Biología de los Tejidos de la cavidad oral, cabeza y cuelloJuan Carlos Munévar
 
Secretoma congreso institucional 2017
Secretoma congreso institucional 2017Secretoma congreso institucional 2017
Secretoma congreso institucional 2017Juan Carlos Munévar
 
Células Madre “Bombo Publicitario o Esperanza Médica”
Células Madre “Bombo Publicitario o Esperanza Médica”Células Madre “Bombo Publicitario o Esperanza Médica”
Células Madre “Bombo Publicitario o Esperanza Médica”Juan Carlos Munévar
 
Stem Cell clinical grade Biology for human therapies
Stem Cell clinical grade Biology for human therapiesStem Cell clinical grade Biology for human therapies
Stem Cell clinical grade Biology for human therapiesJuan Carlos Munévar
 
Regeneracion y reparacion periodontal
Regeneracion y reparacion periodontalRegeneracion y reparacion periodontal
Regeneracion y reparacion periodontalJuan Carlos Munévar
 
¿Cómo publicar en revistas académicas indexadas peer review?
¿Cómo publicar en revistas académicas  indexadas peer review?¿Cómo publicar en revistas académicas  indexadas peer review?
¿Cómo publicar en revistas académicas indexadas peer review?Juan Carlos Munévar
 
Fisiopatologia y Biologia de la inflamación
Fisiopatologia y Biologia de la inflamaciónFisiopatologia y Biologia de la inflamación
Fisiopatologia y Biologia de la inflamaciónJuan Carlos Munévar
 
OSTEOINMUNOLOGÍA: Biología de osteoclasto
OSTEOINMUNOLOGÍA: Biología de osteoclasto OSTEOINMUNOLOGÍA: Biología de osteoclasto
OSTEOINMUNOLOGÍA: Biología de osteoclasto Juan Carlos Munévar
 
Big data o datos masivos en investigación en odontología
Big data o datos masivos en investigación en odontologíaBig data o datos masivos en investigación en odontología
Big data o datos masivos en investigación en odontologíaJuan Carlos Munévar
 
Lectura crítica de la literatura biomédica
Lectura crítica de la literatura biomédicaLectura crítica de la literatura biomédica
Lectura crítica de la literatura biomédicaJuan Carlos Munévar
 
Indicadores produccióncientífica
Indicadores produccióncientíficaIndicadores produccióncientífica
Indicadores produccióncientíficaJuan Carlos Munévar
 
Mecanismos de señalización en osteoclastogenesis y enfermedad òsea
Mecanismos de señalización en osteoclastogenesis y enfermedad òseaMecanismos de señalización en osteoclastogenesis y enfermedad òsea
Mecanismos de señalización en osteoclastogenesis y enfermedad òseaJuan Carlos Munévar
 
INDICADORES DE PRODUCCION CIENTIFICA
INDICADORES DE  PRODUCCION CIENTIFICAINDICADORES DE  PRODUCCION CIENTIFICA
INDICADORES DE PRODUCCION CIENTIFICAJuan Carlos Munévar
 
INTERACCIONES MOLECULARES Y ENLACES ATÓMICOS
INTERACCIONES MOLECULARES Y ENLACES ATÓMICOSINTERACCIONES MOLECULARES Y ENLACES ATÓMICOS
INTERACCIONES MOLECULARES Y ENLACES ATÓMICOSJuan Carlos Munévar
 
¿Escribir artículo de revisión?
¿Escribir artículo de revisión?¿Escribir artículo de revisión?
¿Escribir artículo de revisión?Juan Carlos Munévar
 
Lectura critica de la literatura biomédica
Lectura critica de la literatura biomédicaLectura critica de la literatura biomédica
Lectura critica de la literatura biomédicaJuan Carlos Munévar
 

More from Juan Carlos Munévar (20)

Biología de los Tejidos de la cavidad oral, cabeza y cuello
Biología de los Tejidos de la cavidad oral, cabeza y cuelloBiología de los Tejidos de la cavidad oral, cabeza y cuello
Biología de los Tejidos de la cavidad oral, cabeza y cuello
 
Proyecto Decreto Minsalud 2021
Proyecto Decreto Minsalud 2021Proyecto Decreto Minsalud 2021
Proyecto Decreto Minsalud 2021
 
Tablero demo postgrados
Tablero demo postgradosTablero demo postgrados
Tablero demo postgrados
 
Secretoma congreso institucional 2017
Secretoma congreso institucional 2017Secretoma congreso institucional 2017
Secretoma congreso institucional 2017
 
Células Madre “Bombo Publicitario o Esperanza Médica”
Células Madre “Bombo Publicitario o Esperanza Médica”Células Madre “Bombo Publicitario o Esperanza Médica”
Células Madre “Bombo Publicitario o Esperanza Médica”
 
Stem Cell clinical grade Biology for human therapies
Stem Cell clinical grade Biology for human therapiesStem Cell clinical grade Biology for human therapies
Stem Cell clinical grade Biology for human therapies
 
Regeneracion y reparacion periodontal
Regeneracion y reparacion periodontalRegeneracion y reparacion periodontal
Regeneracion y reparacion periodontal
 
¿Cómo publicar en revistas académicas indexadas peer review?
¿Cómo publicar en revistas académicas  indexadas peer review?¿Cómo publicar en revistas académicas  indexadas peer review?
¿Cómo publicar en revistas académicas indexadas peer review?
 
Fisiopatologia y Biologia de la inflamación
Fisiopatologia y Biologia de la inflamaciónFisiopatologia y Biologia de la inflamación
Fisiopatologia y Biologia de la inflamación
 
OSTEOINMUNOLOGÍA: Biología de osteoclasto
OSTEOINMUNOLOGÍA: Biología de osteoclasto OSTEOINMUNOLOGÍA: Biología de osteoclasto
OSTEOINMUNOLOGÍA: Biología de osteoclasto
 
Big data o datos masivos en investigación en odontología
Big data o datos masivos en investigación en odontologíaBig data o datos masivos en investigación en odontología
Big data o datos masivos en investigación en odontología
 
Lectura crítica de la literatura biomédica
Lectura crítica de la literatura biomédicaLectura crítica de la literatura biomédica
Lectura crítica de la literatura biomédica
 
Indicadores produccióncientífica
Indicadores produccióncientíficaIndicadores produccióncientífica
Indicadores produccióncientífica
 
Mecanismos de señalización en osteoclastogenesis y enfermedad òsea
Mecanismos de señalización en osteoclastogenesis y enfermedad òseaMecanismos de señalización en osteoclastogenesis y enfermedad òsea
Mecanismos de señalización en osteoclastogenesis y enfermedad òsea
 
INDICADORES DE PRODUCCION CIENTIFICA
INDICADORES DE  PRODUCCION CIENTIFICAINDICADORES DE  PRODUCCION CIENTIFICA
INDICADORES DE PRODUCCION CIENTIFICA
 
INTERACCIONES MOLECULARES Y ENLACES ATÓMICOS
INTERACCIONES MOLECULARES Y ENLACES ATÓMICOSINTERACCIONES MOLECULARES Y ENLACES ATÓMICOS
INTERACCIONES MOLECULARES Y ENLACES ATÓMICOS
 
¿Escribir artículo de revisión?
¿Escribir artículo de revisión?¿Escribir artículo de revisión?
¿Escribir artículo de revisión?
 
Lectura critica de la literatura biomédica
Lectura critica de la literatura biomédicaLectura critica de la literatura biomédica
Lectura critica de la literatura biomédica
 
Seminario Manejo de diabetes
Seminario Manejo de diabetesSeminario Manejo de diabetes
Seminario Manejo de diabetes
 
Bifosfonatos EN ODONTOLOGÍA
Bifosfonatos EN ODONTOLOGÍABifosfonatos EN ODONTOLOGÍA
Bifosfonatos EN ODONTOLOGÍA
 

Recently uploaded

BIOGRAFIA DE representante de enfermería VIRGINIA HENDERSON.pdf
BIOGRAFIA DE representante de enfermería  VIRGINIA HENDERSON.pdfBIOGRAFIA DE representante de enfermería  VIRGINIA HENDERSON.pdf
BIOGRAFIA DE representante de enfermería VIRGINIA HENDERSON.pdfCristhianAAguirreMag
 
PRESENTACION DE LA ENTAMOEBA GINGIVALIS.pdf
PRESENTACION DE LA  ENTAMOEBA GINGIVALIS.pdfPRESENTACION DE LA  ENTAMOEBA GINGIVALIS.pdf
PRESENTACION DE LA ENTAMOEBA GINGIVALIS.pdfblankitaecheverry5
 
Neoplasias benignas del ovario y funcionales
Neoplasias benignas del ovario y funcionalesNeoplasias benignas del ovario y funcionales
Neoplasias benignas del ovario y funcionalesLuisArturoMercadoEsc
 
DICTAMEN PERITAJE SICOLOGICO PERITO..pdf
DICTAMEN PERITAJE SICOLOGICO PERITO..pdfDICTAMEN PERITAJE SICOLOGICO PERITO..pdf
DICTAMEN PERITAJE SICOLOGICO PERITO..pdfkixasam181
 
REGISTRO DEL HIS MINSA DE LA ATENCION MATERNA
REGISTRO DEL HIS MINSA DE LA ATENCION MATERNAREGISTRO DEL HIS MINSA DE LA ATENCION MATERNA
REGISTRO DEL HIS MINSA DE LA ATENCION MATERNAmelvinmarcelinorudy2
 
PLANIMETRIA y cavidades del cuerpo humano.pdf
PLANIMETRIA y cavidades del cuerpo humano.pdfPLANIMETRIA y cavidades del cuerpo humano.pdf
PLANIMETRIA y cavidades del cuerpo humano.pdfHinUzumaki
 
Paludismo o Malaria- Medicina tropical.pptx
Paludismo o Malaria- Medicina tropical.pptxPaludismo o Malaria- Medicina tropical.pptx
Paludismo o Malaria- Medicina tropical.pptx Estefania Recalde Mejia
 
Exposición de tobillo y pie de anatomia.
Exposición de tobillo y pie de anatomia.Exposición de tobillo y pie de anatomia.
Exposición de tobillo y pie de anatomia.milagrodejesusmartin1
 
Clase 8 Miembro Superior Osteologia 2024.pdf
Clase 8 Miembro Superior Osteologia 2024.pdfClase 8 Miembro Superior Osteologia 2024.pdf
Clase 8 Miembro Superior Osteologia 2024.pdfgarrotamara01
 
PS09_ET_Asistencia_basica_hospitalaria.pptx
PS09_ET_Asistencia_basica_hospitalaria.pptxPS09_ET_Asistencia_basica_hospitalaria.pptx
PS09_ET_Asistencia_basica_hospitalaria.pptxHuroKastillo
 
(2024-11-04) Actuacion frente a quemaduras (ptt).pptx
(2024-11-04) Actuacion frente a quemaduras (ptt).pptx(2024-11-04) Actuacion frente a quemaduras (ptt).pptx
(2024-11-04) Actuacion frente a quemaduras (ptt).pptxUDMAFyC SECTOR ZARAGOZA II
 

Recently uploaded (20)

Estudio REDUCE-AMI
Estudio REDUCE-AMIEstudio REDUCE-AMI
Estudio REDUCE-AMI
 
Estudio ORBITA-COSMIC
Estudio ORBITA-COSMICEstudio ORBITA-COSMIC
Estudio ORBITA-COSMIC
 
(2024-11-04) Patologia anorectal (doc).docx
(2024-11-04) Patologia anorectal (doc).docx(2024-11-04) Patologia anorectal (doc).docx
(2024-11-04) Patologia anorectal (doc).docx
 
Estudio KARDIA-2
Estudio KARDIA-2Estudio KARDIA-2
Estudio KARDIA-2
 
Estudio TACTiC
Estudio TACTiCEstudio TACTiC
Estudio TACTiC
 
Estudio ARISE-HF
Estudio ARISE-HFEstudio ARISE-HF
Estudio ARISE-HF
 
BIOGRAFIA DE representante de enfermería VIRGINIA HENDERSON.pdf
BIOGRAFIA DE representante de enfermería  VIRGINIA HENDERSON.pdfBIOGRAFIA DE representante de enfermería  VIRGINIA HENDERSON.pdf
BIOGRAFIA DE representante de enfermería VIRGINIA HENDERSON.pdf
 
Estudio MINT
Estudio MINTEstudio MINT
Estudio MINT
 
Estudio SMART
Estudio SMARTEstudio SMART
Estudio SMART
 
PRESENTACION DE LA ENTAMOEBA GINGIVALIS.pdf
PRESENTACION DE LA  ENTAMOEBA GINGIVALIS.pdfPRESENTACION DE LA  ENTAMOEBA GINGIVALIS.pdf
PRESENTACION DE LA ENTAMOEBA GINGIVALIS.pdf
 
Neoplasias benignas del ovario y funcionales
Neoplasias benignas del ovario y funcionalesNeoplasias benignas del ovario y funcionales
Neoplasias benignas del ovario y funcionales
 
DICTAMEN PERITAJE SICOLOGICO PERITO..pdf
DICTAMEN PERITAJE SICOLOGICO PERITO..pdfDICTAMEN PERITAJE SICOLOGICO PERITO..pdf
DICTAMEN PERITAJE SICOLOGICO PERITO..pdf
 
REGISTRO DEL HIS MINSA DE LA ATENCION MATERNA
REGISTRO DEL HIS MINSA DE LA ATENCION MATERNAREGISTRO DEL HIS MINSA DE LA ATENCION MATERNA
REGISTRO DEL HIS MINSA DE LA ATENCION MATERNA
 
PLANIMETRIA y cavidades del cuerpo humano.pdf
PLANIMETRIA y cavidades del cuerpo humano.pdfPLANIMETRIA y cavidades del cuerpo humano.pdf
PLANIMETRIA y cavidades del cuerpo humano.pdf
 
Paludismo o Malaria- Medicina tropical.pptx
Paludismo o Malaria- Medicina tropical.pptxPaludismo o Malaria- Medicina tropical.pptx
Paludismo o Malaria- Medicina tropical.pptx
 
Estudio PREVENT
Estudio PREVENTEstudio PREVENT
Estudio PREVENT
 
Exposición de tobillo y pie de anatomia.
Exposición de tobillo y pie de anatomia.Exposición de tobillo y pie de anatomia.
Exposición de tobillo y pie de anatomia.
 
Clase 8 Miembro Superior Osteologia 2024.pdf
Clase 8 Miembro Superior Osteologia 2024.pdfClase 8 Miembro Superior Osteologia 2024.pdf
Clase 8 Miembro Superior Osteologia 2024.pdf
 
PS09_ET_Asistencia_basica_hospitalaria.pptx
PS09_ET_Asistencia_basica_hospitalaria.pptxPS09_ET_Asistencia_basica_hospitalaria.pptx
PS09_ET_Asistencia_basica_hospitalaria.pptx
 
(2024-11-04) Actuacion frente a quemaduras (ptt).pptx
(2024-11-04) Actuacion frente a quemaduras (ptt).pptx(2024-11-04) Actuacion frente a quemaduras (ptt).pptx
(2024-11-04) Actuacion frente a quemaduras (ptt).pptx
 

Biología del Movimiento Dental

  • 1.  
  • 2.
  • 3. El propósito del tratamiento dental ortodóntico es desplazar los dientes lo mas eficientemente posible con los mínimos efectos adversos posibles para el diente y los tejidos de soporte Introducción Martina von Bohl y Anne Marie Kuijpers-Jagtman (2008) . European Journal of Otrthodontics. 31: 30 - 36 Krishnan and Davidovitch, 2006; Masella and Meister, 2006; Meikle, 2006; Wise and King, 2008 Durante los últimos 100 años se han publicado muchos estudios relacionados con el movimiento dental ortodóntico y las reacciones celulares, tisulares y moleculares.
  • 4.
  • 5.
  • 6.
  • 7.
  • 8.
  • 9.
  • 10.
  • 11.
  • 12.
  • 13.
  • 15. MATRIZ EXTRACELULAR Fernández-Tresguerres I. (2006) Med Oral, Patol Oral, Cir Buc.11; 47 – 51. Fracción inorgánica: 65%. Cristales de Hidroxiapatita (Ca 10 (PO4) 6 (OH) 2 . Calcio, Fosfato y Carbonato. Proporción de 10:6:1 SIBLINGS Small Integrin Binding Ligand, N-Linked Glycoprotein
  • 16.
  • 17. REMODELADO OSEO Renovación continu a de la matriz org á nica y mineral del hueso que involucra en primer lugar un aumento en la resorción y mas tarde reactiva la formación ósea que se efectúa en sitios especificos de actividad celular ciclica (BMU) . P ermite la renovación de un 5% del hueso cortical y un 20 % del trabecular al año. L a tasa de renovación es de un 5-10% del hueso total al año. El remodelado óseo existe toda la vida, pero sólo hasta la tercera década el balance es positivo. Frost, H.M., 1963. Bone Remodeling Dynamics, Charles C. Thomas, Springfield,
  • 18. Fernández-Tresguerres I. (2006) Med Oral, Patol Oral, Cir Buc.11; 151 – 57.
  • 19. E l proceso de modelado óseo (los huesos aumentan de longitud y diametro) carece de actividades ciclicas localizadas de acoplamiento entre resorción y formación sobre la superficie ósea en modelado. La resorción y la aposición óseas en el modelado óseo ocurren en superficies separadas; por lo tanto la activación en el modelado óseo puede efectuarse por resorción o formación óseas (Frost, 1973; Burr and Martin, 1989) MODELADO OSEO
  • 20.
  • 21. PROCESOS CELULARES Y MOLECULARES
  • 22.
  • 23. La respuesta inflamatoria causa destrucción tisular Activación de linfocitos B, Linfocitos T, síntesis y liberación de mediadores químicos de la inflamación. Citocinas pro inflamatorias y factores de crecimiento asociados con la reabsorción ósea : IL-1 TNF- α Teng YT. (2003) Crit Rev Oral Biolo Med. 14: 237 - 252 REMODELADO OSEO - Depósito Resorción
  • 24.
  • 25. Factores solubles moduladores del remodelado óseo
  • 26. OPG c-Fms- RANK- c-Fms+ RANK- c-Fms+ RANK+ TNF  , IL-1, IL-6, IL-7, otras IL’s OPG, RANKL, M-CSF HSC GCs Prostaglandinas, citocinas, IL’s y vitamina D M-CSF Estroma/osteoblastos RANKL TNF  T T E 2 T M-CSF RANKL + TGF  IFN  Dentina Hueso
  • 27.
  • 28. RANK RANK Borde rugoso Zona clara Zona clara Osteoclastos C-Fms C-Fms M.E.C HCO 3 - Cl - H + HCO 3 - Cl - Cat K  v  3 H + Cl - M.E.C
  • 29. ............................. HCO 3 - Cl - H + HCO 3 - Cl - Cat K  v  3 H + Cl - M.E.C xxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxx :: :: Estímulos Borde en cepillo :: . . . . . . . . . . . . M.E.C. Núcleo Microtúbulos  v  3 :: :: :: :: :: :: :: . . . . . . . .
  • 30. Diferenciación y destino Apoptosis Adhesión Polarización Resorción Célula Stem Proliferación Diferenciación CSF-GM Fusión PTH, IL1, Vit. D
  • 31. © American Society for Bone and Mineral Research. Primer, F. Patrick Ross, Ph.D.
  • 33.
  • 34. REGULACION DEL SISTEMA RANKL/OPG/RANK.
  • 35. RANK (Receptor of Nuclear Factor Kappa) y su ligando RANK-L: Diferenciación de preosteoclastos Activación y mantenimiento de osteoclastos. REMODELADO OSEO ALTERADO Goldring S R. (2003) inflammatory mediators as essential elements in bone remodeling. Calcif Tissue Int 73: 97-100
  • 37.  
  • 39. Juan Carlos Munévar N Definición Mecanismo por el cual una célula responde a los estímulos que recibe del medio ambiente mediante difusión de esas señales hacia sus compartimentos internos.
  • 40.
  • 41.  
  • 42.  
  • 43.  
  • 44.  
  • 45.
  • 46.  v  3 c-Fms RANK TNFR1 IL1-R1 ERKs ERKs Mitf P c-src PI3K AKT C S D JNK AP1 NFATc1 D p38 Ca ++ CaM c-src PI3K AKT C S NF  B D JNK AP1 D NF  B D NFATc1 IKK  IRAK E2F = Cinasa = Factor de Transcripción P = Proliferación C = Reorganización del citoesqueleto S = Supervivencia D = Diferenciación CN
  • 47. Papel de la transdución de señales en la regulación de la expresión de genes
  • 48.  
  • 49.
  • 50. Heterodímero inactivo en el citosol: 2 subunidades p50 / p65 asociado con un inhibidor I  B Expresión génica p50 / p65 Poseen dominios que reconocen motivos específicos de ADN. Análogos de AMPc NF- B k Factor de Transcripción activado por: Citocinas Factores de crecimiento Esteres de forbol Lipopolisacáridos TNF Ácido Okadaico
  • 51. Factor de Transcripción con dominios que reconocen motivos específicos de ADN. NFkB se transloque al núcleo Motivo  B en el ADN Secuencias promotoras / enhancers La disociación del complejo p50 / p65 / IkB : NF- B k I  B Inactivado por PKC / PKA Fosforilación / Desfosforilación 5’-GGGPuNNPiPiCC-3’
  • 52.
  • 53. La transcripción de genes activados por el AMPc está regulada por FACTORES DE TRANSCRIPCION que se unen al elemento de respuesta CRE en el ADN. CRE: AMPc response element. CREB Expresión génica
  • 54. GENES CON MOTIVO C.R.E. 1. Enzimas metabolismo intermedio 2. Péptidos Bioactivos. 3. Fibronectina plasmática. 4. Proto oncogen c-fos 1. Tiroxina hidroxilasa 2. Somatostatina
  • 55. MOTIVO C.R.E. Motivos octaméricos Secuencia CONSENSUS: 5’-TGACGTCA - 3’ Elementos de respuesta al AMPc del ADN CREB : CRE BINDING PROTEINS . Factores de transcripción de genes que poseen el motivo C.R.E. Localización: 1. Núcleo celular. 2. Fosforilados por PKA
  • 56. MECANISMO DE ACCION. 1. La P.K. A fosforila las proteínas CREB. 2. Factores de Transcripción se une a C.R.E. 3. TRANSCRIPCION DE GEN ESPECIFICO > [cAMP]° inducen la translocación de la subunidad catalítica P.K. A
  • 57. EXPRESION DE GENES. Los factores de transcripción C.R.E.B pueden ser fosforilados por: 1. P.K.A (Células mesenquimatosas.) 2. Quinasas I y II Ca2/Calmodulina (Neuronas.) Transcripción de genes distintos.
  • 58. FACTOR MOTIVO INFORMACION C-Myc / Max CACGTG C-Myc: oncogen retroviral, se asocia con Max. c-Fos / c-Jun TGAC/GTC/AA Oncogenes retrovirales Factor AP-1 CREB TGACGC/7C/AG/A Une a CRE, familia de al menos 10 factores, dímeros con c-Jun C-ErbA; (TR: Receptor de la hormona Tiroidea) G/CA/CGGAA/TGT/C Oncogen retroviral, miembro de la superfamilia de receptores hormonales esteroides/tiroides C-Ets G/CA/CGGAA/TGT7C Oncogen retroviral predominante en células B y T GATA T/AGATA Familia de factores específicos de líneas eritroides C-Myb T/CAACG/TG Oncogen retroviral, factor especifico de células hematopoyéticas NFkB & c-Rel GGGAA/CTNT/CCC c-Rel: Oncogen retroviral, predominan en células B y T RAR ACGTCATGACCT Une elementos RARES, así como sitios c-Jun / c-Fos SRF (Serum response factor) GGATGTTCCATATTAGGACATCT Presente en genes inducibles por factores de crecimiento presentes en suero ISGF3 (Interferon  stimulated gene factor 3) A/GGAAAA/GNGAAACT Activación por proteínas quinasa. El motivo ISRE presente en genes de respuesta antiviral y antitumoral
  • 59.  
  • 61.
  • 62. Osteoblasto Mesenquima Alberts et al. Mol Bio. Cell, 4th Ed. Osteoblastos Producción MEC Mineralización/Osteoide maduración ~10días Osteocito Apoptosis
  • 63. Factores solubles Endocrina Paracrina Autocrina Hormona Paratiroidea (PTH) (  resorción ósea*) Proteína relacionada PTH TGF β 1, 2, 3 Vitamina D (  resorción ósea*) Factores de crecimiento transformante (TGF) β 1,2,3 FGF 1, 2 Calcitonina (  resorción ósea*) Factor de crecimiento fibroblástico (FGF) 1, 2 IGF´s Glucocorticoides IGF’s PDGF’s Esteroides (E, T) Proteínas óseas morfogéneticas (BMP) 2-7 BMP 2-7 Insulina (PDGF’s) OTROS Interleucina-6
  • 65.
  • 66.
  • 67. NUCLEACION En todo sistema biológico encontramos dos fases químicas diferentes (Fase Orgánica y una Fase Inorgánica). EQUILIBRIO Ruptura de equilibrio Transformación de masas Sobresaturación La concentración de las dos fases Tejidos Conectivos, epitelio, Etc. Las partículas neoformadas crecen hasta un tamaño critico en donde los núcleos no podrán disolverse
  • 68.
  • 69. Los fosfatos de calcio poco solubles (apatita) son de gran interes por ser componentes del esqueleto y la dentina FASES MINERALES Calcita Aragonita Ácido silico coelestina apatita witlockite Fosfato octacálcico CaC03, Moluscos, artrópodos, Diatomeas. Radiolares Dientes, esqueleto Calcificaciones patológicas.
  • 70.
  • 71.
  • 72.
  • 73.
  • 74.
  • 75. NUCLEACIÓN HOMOGÉNEA Aumento local de iones orgánicos, para permitir la precipitación espontánea del los cristales. NUCLEACION Ca Ca Ca La presencia de sustancias de nucleacion (sustancias que disminuyen el aporte de energía necesario para la mineralización) también puede llevar a la formación de cristales en ausencia de un incremento local de la concentración de iones. Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca NUCLEACIÓN HETEROGENEA
  • 76.
  • 77.
  • 78.
  • 79.
  • 80.
  • 81.
  • 82.
  • 83. CRECIMIENTO DEL CRISTAL 1. Control de la velocidad y repartición del crecimiento en cuanto a la talla y número de cristales. Diferencia en el crecimiento en longitud y espesor de un cristal (ESMALTE DENTAL) 2. Control del cese de crecimiento; cuando se define la talla y forma de los cristales se observa la detención del crecimiento. TEORIAS Los parámetros físico-químicos no son los únicos que controlan el crecimiento del cristal. CONTROL PROTEICO In vitro # In vivo
  • 84.
  • 85.
  • 86. Estructura derivada de la célula o la matriz Tejido dental Componentes implicados Microestructuras celulares Mineralización inducida por la M.E.C. Vesículas matriciales Mineralizaciones intracelulares Débris celulares Manto dentina Cemento acelular Pulpolitos Fosfolípidos mb. Proteoglicanos. Anexina I. Fosfolípidos mb. Proteoglicanos. M.E.C. Proteínas colagenas no colagenas Dentina Intertubular Cemento celular acelular Colágenos I,V,VI P. Fosforiladas DSP no fosforilada Proteoglicanos Proteína GLA fosfolípidos Proteínas séricas Factores de crecimiento proteínas no colagenas M.E.C. Dentina Peritubular Esmalte Amelogeninas Enamelinas Lípidos Proteoglicanos Glicoproteínas
  • 87.
  • 88.
  • 89.
  • 90.
  • 91. Este es un proceso altamente controlado. Esta mineralización no solo envuelve el colágeno como sustrato sino que también proteínas no colágenas ( son iniciadoras de la mineralización) de la matriz secretadas al frente de mineralización . En los tejidos conectivos calcificados existen dos mecanismos para la mineralización Vesículas Matriciales Nucleacion Heterogénea Pequeño organelo intracelular membranoso donde se observa la primera evidencia morfológica de un cristal BIOMINERALIZACION
  • 92.
  • 93.
  • 94. COMO LLEGA EL MINERAL AL SITIO DE MINERALIZACIÓN 1. Papel de proteoglicanos 2. Síntesis de colágeno 3. Vía de iones inorgánicos entre células. Presumiblemente unidas a macromoléculas 4. Vía iones inorgánicos dentro de la célula. 5. Participación mitocondrial
  • 95.
  • 96. Dr. Juan Carlos Munévar N. INSTITUTO U.I.B.O. FACULTAD DE ODONTOLOGIA