Distribution of Hepatitis B Virus
genotypes in Libya using PCRbased diagnostics
Presented By:
Milud.A.Salem
Introduction to Hepatitis B
Virus
 350 million people are infected with HBV
worldwide¹.
 HBV infection develop to CHB, c...
≥8% - high
2-7% - intermediate
< 2 - low
Terrault and Wright 1998. Sleisenger and fordtran's gastrointestinal and liver Di...
 Hepadnaviridae family.
 Partially double-stranded, circular DNA.
 4 partially overlapping ORFs.
 Genome size: 3.2 kb....
Regmi S, 2004. PhD thesis, Tribuwan University, Nepal.
Genotypes of HBV
 Classified into 9 genotypes to date (A-I) based
on 8% or more of DNA sequence differences.
 HBV genoty...
 HBV genotypes have clinical significance:
1) Disease severity:

genotypes C and D are more associated with
sever liver d...
3) Prevalence of seroconversion:

genotypes A and B have a higher seroconversion
rate than genotypes D and C, respectively...
5) Viraemia levels:
high DNA levels in HBV genotype D patients with
HBeAg negative, and in HBV genotype C patients
with HB...
Objective of this study
 To determine genotypes of HBV among
Libyan patients who were referred to the
St.James clinical L...
Materials and Methods
HBV-DNA quantification
clinical plasma specimens

DNA purification
RoboGene® HBV quantification kit...
BV
H
e ® kit
Gen tion
ob o i fi c a
R nt
qua

H
RC
SEA
RE 0
T
ET e 300
B
OR -Gen
C or
Rot
Materials and Methods
HBV Genotyping
clinical plasma isolates
DNA purification
Wizard® SV genomic DNA purification system...
mic m,
eno yste
g
S V i on s
®
ard rificat
Wiz pu
t
NA ega ki
D
m
Pro

r
TT l Cycle
RBE rma
CO The
RBE RCH
CO EA
RES
s
e si
hor )
p
tro Plus
c
el e X L
g el el
ini
M em (G
t
sys

O
NN
I

iP A
-L

VG
HB

ot y
en

kit
ing
p
Materials and Methods
INNO-LiPA major steps
Denaturation

5 min
Denaturation of amplified
Biotinylated DNA

Hybridization...
Results and discussion
HBV-DNA quantification
121 clinical plasma isolates

DNA purification
RoboGene® HBV quantification...
Results and discussion
HBV-DNA purification and amplification
clinical plasma isolates
DNA quantity > 1000 IU/ml (85/121 ...
456
411 415
1
3
5´
CATC CTGCTGCTATGCCTCATC TTCTTG TTGGTTCTTCTGGATTA TCAAGGTATGTTGCCCG TTTGTCCTCTAATTCC AGGATCAACAACAACCAGT...
te r
Ou

t
Nes

pli
d am
e

n
atio
f ic

nds
ba

pli
am

atio
fic

nds
ba
n
Results and discussion
HBV genotypes
Denaturation

5 min
Denaturation of amplified
Biotinylated DNA

Hybridization

60 mi...
HBPr 216 (F)
411
CAGGATCCACGACCACCAG
5´ CATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGATTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGA...
G

A
pe
oty
en

G en

pe E
oty
e
typ
eno
G

D
eno
G

D
pe
ty
d
Mixe D/E
e
otyp
Ge n

G

ixed /E
M
ype D
enot
Results and discussion
HBV genotypes
(60 samples) Genotypable using INNO- LiPA assay

Genotype A
1 patient

Genotype E
1 ...
Conclusion
These results showed that HBV genotype D is
the most prevalent genotype in Libya.
This study agree with other...
Author

Study
place

Detection
method

Samples
.No

%Genotypes

A

B

C

D

E

109
91

84.6

Italy

LiPA

272

Sharara et ...
Recommendation
Further studies are needed to explore the
nucleotide sequences of HBV genotype D
isolates in Libya.
*This ...
Hbv genotypes in libya
Upcoming SlideShare
Loading in …5
×

Hbv genotypes in libya

704 views

Published on

Published in: Health & Medicine, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
704
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
21
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Hbv genotypes in libya

  1. 1. Distribution of Hepatitis B Virus genotypes in Libya using PCRbased diagnostics Presented By: Milud.A.Salem
  2. 2. Introduction to Hepatitis B Virus  350 million people are infected with HBV worldwide¹.  HBV infection develop to CHB, cirrhosis or HCC¹.  Libya has an intermediate prevalence of the HBV infection reaching around 2.2%². ¹Hu and Hirshfield, 2006. Advanced techniques in diagnostic microbiology, pp. 342-343 ²Elzouki et al. Journal of Gastroenterology. 2006; 21 (2):114
  3. 3. ≥8% - high 2-7% - intermediate < 2 - low Terrault and Wright 1998. Sleisenger and fordtran's gastrointestinal and liver Disease, pp.1123-1170
  4. 4.  Hepadnaviridae family.  Partially double-stranded, circular DNA.  4 partially overlapping ORFs.  Genome size: 3.2 kb. Norder et al. Intervirology. 2004; 47:289–309.
  5. 5. Regmi S, 2004. PhD thesis, Tribuwan University, Nepal.
  6. 6. Genotypes of HBV  Classified into 9 genotypes to date (A-I) based on 8% or more of DNA sequence differences.  HBV genotypes were found to have varied geographic distributions. Schaefer S. World Journal of Gastroenterology. 2007, 13(1):14-21.
  7. 7.  HBV genotypes have clinical significance: 1) Disease severity: genotypes C and D are more associated with sever liver disease than genotypes B and A¹. genotype D has a high rate of developing HCC². 2) Induction of chronicity: CHB is more often induced in patients with genotype A than with genotypes B and C³ ¹Chan et al. Journal of Clinical Microbiology. 2003; 41:1277–1279 ²Thakur et al. Journal of Gastroenterology and Hepatology. 2002; 17:165–170 ³Schaefer. Journal of Viral Hepatitis. 2005; 12:111-124.
  8. 8. 3) Prevalence of seroconversion: genotypes A and B have a higher seroconversion rate than genotypes D and C, respectively¹. 4) Mutations variants: precore variant is common with genotypes D and B in comparison with genotypes A and C, respectively. the core promoter mutation is more frequent in individuals with genotype C than genotype B ² ¹Mahtab et al. Hepatobiliary and Pancreatic Diseases International. 2008; 7(2): 457-464. ²Lindh et al. Journal of Infection Disease. 1999; 179:775–782.
  9. 9. 5) Viraemia levels: high DNA levels in HBV genotype D patients with HBeAg negative, and in HBV genotype C patients with HBeAg positive.¹ 6) Response to anti-viral drugs and vaccines: The response to IFN is higher with genotypes A and B than genotypes D and C, respectively², while the response don’t vary between genotypes A and D with lamivudine³ but higher with genotype C than B³. The immune escape after vaccination occurred in region with genotype D prevalence . 4 ¹Westland et al.Gastroenterology. 2003; 125:107-116. ²Zhang et al.Journal of Medical Virology. 1996; 48:8–16. ³Buti et al. Journal of Hepatology. 2002; 36:445-446. 4Carman et al. Lancet. 1990; 336 (8711): 325–329
  10. 10. Objective of this study  To determine genotypes of HBV among Libyan patients who were referred to the St.James clinical Laboratory, Tripoli, using INNO-LiPA HBV genotyping assay
  11. 11. Materials and Methods HBV-DNA quantification clinical plasma specimens DNA purification RoboGene® HBV quantification kit DNA Quantification Rotor-Gene 3000™
  12. 12. BV H e ® kit Gen tion ob o i fi c a R nt qua H RC SEA RE 0 T ET e 300 B OR -Gen C or Rot
  13. 13. Materials and Methods HBV Genotyping clinical plasma isolates DNA purification Wizard® SV genomic DNA purification system, Promega Outer amplification INNO-LiPA primer Gel electrophoresis 2% agarose gel + Genotyping using INNO- LiPA assay - Nested amplification INNO-LiPA primer
  14. 14. mic m, eno yste g S V i on s ® ard rificat Wiz pu t NA ega ki D m Pro r TT l Cycle RBE rma CO The RBE RCH CO EA RES
  15. 15. s e si hor ) p tro Plus c el e X L g el el ini M em (G t sys O NN I iP A -L VG HB ot y en kit ing p
  16. 16. Materials and Methods INNO-LiPA major steps Denaturation 5 min Denaturation of amplified Biotinylated DNA Hybridization 60 min Hybridization with specific oligonucleotide probes immobilized on membrane-based strips Stringent wash 30 min Remove unbound DNA Color development 60 min Incubate with conjugate and substrate resulting in purple brown precipitate
  17. 17. Results and discussion HBV-DNA quantification 121 clinical plasma isolates DNA purification RoboGene® HBV quantification kit DNA Quantification Rotor-Gene 3000™ DNA quantity in samples ranged from 50 IU/ ml and 3.6x10ˉ IU/ml
  18. 18. Results and discussion HBV-DNA purification and amplification clinical plasma isolates DNA quantity > 1000 IU/ml (85/121 samples) DNA purification Wizard® SV genomic DNA purification system, Promega Outer amplification INNO-LiPA primer 54 samples - Gel electrophoresis Nested amplification 2% agarose gel INNO-LiPA primer 31 samples + + 33 samples Genotyping using INNO- LiPA assay
  19. 19. 456 411 415 1 3 5´ CATC CTGCTGCTATGCCTCATC TTCTTG TTGGTTCTTCTGGATTA TCAAGGTATGTTGCCCG TTTGTCCTCTAATTCC AGGATCAACAACAACCAGTACG GTAG GACGACGATACGGAGTAGAAGAACAACCAAGAAGACCTAAT AGTTCCATACAACGGGCAAACAGGAGATTAAGGTCCTAGTTGTTGTTGGT CATGC GGACCATGCAAAACCTGCACGACTCCTGCTCAAGGCA ACTCTATGTTTCCCTCATGTTGCTG TACAAAACCTACGGATGGAAATTGCACCTGTATTCCCAT CCTGGTACGTTTTGGACGTGCTGAGGACGAGTTCCGTTGAGATACAAAGGGAGTACAACGACATGTTTTGGATGCCTACCTTTAACGTGGACATAAGGGTA CCCATCGT CCTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCTCT TGGCTCAGTTTACTAGTGCCATT TGTTCAGTGGTTCGTAGGG GGGTAGCAGGACCCGAAAGCGTTTTATGGATACCCTCACCCGGAGTCAGGCAAAGAGAACCGAGTCAAATGATCACGGTAAACAAGTCACCAAGCATCCC 798 CTTTCCC CCACTGTTTGGCTTTCAGCTATATGGATGATGTGGTATTGGGGGCCAAGACTGTACAGCATCGTGAGTCCCTTTATACCG CTGTTACCAATTTT GAAAGGGGGTGACAAACCGAAAGTCGATATACCTACTACACCATAACCCCCGGTTCTGACATGTCGTAGCACTCAGGGAAATATGGC GACAATGGTTAAAA 4 824 2 3´ 837 CTTTTGT CTCTG GGTATACATTTAA END OF HbsAg GAAAACAGAGAC CCATATGTAAATT Outer amplification fragment Nested amplification fragment Osiowy and Giles. Journal of clinical Virology; 2003: 5473-5477. 1= sense outer primer sequence 2= anti-sense outer primer sequence 3= sense nested primer sequence 4= anti-sense nested primer sequence
  20. 20. te r Ou t Nes pli d am e n atio f ic nds ba pli am atio fic nds ba n
  21. 21. Results and discussion HBV genotypes Denaturation 5 min Denaturation of amplified Biotinylated DNA Hybridization 60 min Hybridization with specific oligonucleotide probes immobilized on membrane-based strips Stringent wash 30 min Remove unbound DNA Color development 60 min Incubate with conjugate and substrate resulting in purple brown precipitate
  22. 22. HBPr 216 (F) 411 CAGGATCCACGACCACCAG 5´ CATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGATTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATCAACAACA ACCAGTACG CTCTACTTCCAGGAACAT HBPr 193 (A) HBPr 153 (C) HBPr 77 (A) HBPr 140 (A) GGACCATGCAA AACCTGCACGACTCCTGCTCAAGGCAACTCTATGTTTCCCTCATGTTGCTGTACAAAACCTACGGATGGAAATTGCACCTGTATTCCCATC CTGCACGATTCCTGCT TACGGACGGAAACTGC ACTCTATGTATCCCTCCT HBPr 154 (C) HBPr 165 (D) GCTGTACCAAACCTTCGGAC HBPr 78 (B) GGACCCTGCCGAAC HBPr 208 (D) HBPr 172 (E) CCATCGTCCTGGGCTTTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCTCTTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCT AGTGGTTCGCCGGGCT HBPr 213 (E) HBPr 101 (G) TTTCAGCTATGTGGATGA TTCCC CCACTGTTTGGCTTTCAGCTATATGGATGATGTGGTATTGGGGGCCAAGACTGTACAGCATCGTGAGTCCCTTTATACCG CTGTTACCAATTTTCT TCAGTTATATGGATGAT GGCCAAATCTGTGCAGC HBPr 98 (B) HBPr 186 (F) TTTGT CTCTG GGTATACATTTAA 3´ END OF HbsAg 837 Osiowy and Giles. Journal of clinical Virology; 2003: 5473-5477.
  23. 23. G A pe oty en G en pe E oty
  24. 24. e typ eno G D eno G D pe ty
  25. 25. d Mixe D/E e otyp Ge n G ixed /E M ype D enot
  26. 26. Results and discussion HBV genotypes (60 samples) Genotypable using INNO- LiPA assay Genotype A 1 patient Genotype E 1 patient Genotype D 54 patients 1.7% 1.7% 90% Mixed genotype D/E 4 patients 6.6%
  27. 27. Conclusion These results showed that HBV genotype D is the most prevalent genotype in Libya. This study agree with other studies in Mediterranean and Middle East countries where HBV genotype D is predominates. HBV D/E hybrid may represent CHB patients or IDUs.¹ ¹ Chen et al.Journal of Medical Virology. 2004; 74: 536-542.
  28. 28. Author Study place Detection method Samples .No %Genotypes A B C D E 109 91 84.6 Italy LiPA 272 Sharara et al. ((2004 Lebanon / 67 Zekri et al. ((2007 Egypt Type-specific primers 70 10 Al ashgar et al. ((2008 Saudi Arabia INNO-LiPA 54 5.6 85.2 Basaras et al. ((2007 Spain INNO-LiPA 14 28.6 64.3 Bahri et al. ((2006 Tunisia RFLP 138 8 80 9 Khelifa and ( Thibault (2009 Algeria sequencing 75 5 93 2 This study )(2009 Libya INNO-LiPA 60 1.7 90 1.7 D/E 100 RFLP A/E Alavian et al. ((2006 Iran Ezzikouri, et al. ((2008 Morocco Dal Molin et al, ((2006 INNO-LiPA 26 73 98 25.7 8.6 2 15.7 37.1 5.6 3.6 7.1 6.6
  29. 29. Recommendation Further studies are needed to explore the nucleotide sequences of HBV genotype D isolates in Libya. *This work may open new avenues for further studying the molecular virology of HBV. *HBV genotype D may need to be broken down into sub-genotype.

×