Acidos nucleicos

599 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
599
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
15
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Acidos nucleicos

  1. 1. TEMA 5 LOS ÁCIDOS NUCLEICOS. LOS NUCLEÓTIDOS SON LAS UNIDADES ELEMENTALES DE LOS ÁCIDOS NUCLEICOS. NUCLEÓTIDOS DE INTERÉS BIOLÓGICO. EL ADN Y EL ARN. NIVELES ESTRUCTURALES DEL ADN. FUNCIONES DE LOS ÁCIDOS NUCLEICOS.INTRODUCCIÓN A LOS ÁCIDOS NUCLEICOSTodos los organismos poseen unas moléculas que dirigen y controlan la síntesis deproteínas, proporcionando la información que determina su especificidad y característicasbiológicas. Estas moléculas, que reciben el nombre de ácidos nucleicos, contienen lasinstrucciones necesarias para realizar los procesos vitales y son las responsables de todaslas funciones básicas de los seres vivos. Podría decirse que lo que un organismo es, o puedellegar a ser, en términos biológicos, aparece “programado” en estas moléculas.1 Composición de los ácidos nucleicos 1.1 Los nucleótidosLos ácidos nucleicos son polímeros cuyas piezas elementales reciben el nombre denucleótidos, los cuales, a su vez, están formados por la unión química de sustanciasheterogeneas entre sí, que se enlazan siempre según una disposición determinada.Los nucleótidos, además de su función estructural, pueden desempeñar importantesfunciones como coenzimas y como intermediarios en el metabolismo energético.Los nucleótidos están formados por la unión de tres unidades moleculares diferentes:a) Una pentosa, que puede ser la D-ribosa en el ARN; o la D- desoxirribosa en elADNb) Una base nitrogenada. Son compuestos orgánicos cíclicos con grupos nitrogenados. Sedistinguen dos grupos:  Púrica: Derivadas de la purina. En los ácidos nucleicos las bases púricas mas abundantes son la adenina (A) y la guanina (G)  Pirimidínica: Derivan de la pirimidina siendo las más frecuentes la timina (T), citosina (C) y uracilo (U)
  2. 2. A la unión de una pentosa con una base nitrogenada se le llama nucleósido. Esta unión sehace mediante un enlace N-glucosídico.c) Ácido fosfórico, en la cadena de ácido nucleico une dos pentosas a través de una uniónfosfoéster. Esta unión se hace entre el C-3´de una pentosa, con el C-5´de la siguiente.Los nucleótidos son por tanto compuestos resultantes de la unión entre un nucleósido ymoléculas de ácido fosfórico. Esta unión se realiza por esterificación de uno de los gruposalcohol de la pentosa, formándose un enlace éster (fosfoéster) entre la pentosa y el ácidofosfórico.Un nucleótido puede tener, una, dos o tres moléculas de ácido fosfórico enlazadas alcarbono 5´ de la pentosa; por eso, al nombrar los nucleótidos se hace referencia al númerode grupos fosfato que contiene.
  3. 3. Nucleótidos de interés biológico 1.1 Los nucleótidos no nucleicosAlgunos nucleótidos cumplen funciones por sí mismos. Así, por ejemplo:a) Nucleótidos que intervienen en las transferencias de energía: EL ADP, ATP, AMP, Y GTPb) Nucleótidos que intervienen en los procesos de óxido-reducción: NAD+/NADH,NADP+/NADPH FAD/FADH2 FADH2c) Nucleótidos reguladores de procesos metabólicos: AMPc (adenosina-3,5-monofosfato) o AMP cíclico.AMP cíclico 1.2 Los polinucleótidos
  4. 4. La unión de varios nucleótidos da lugar a un polinucleótido. Por tanto es un polímero lineal denucleótidos unidos por enlaces fosfodiester.Si las pentosas que los constituyen son desoxirribosas, tenemos un desoxirribonucleótido.Estos tienen como bases nitrogenadas la adenina, citosina, guanina y timina. Ej. ADNSi las pentosas que se unen son ribosas, tenemos un ribonucleótido. Estos tienen comobases nitrogenadas la adenina, guanina, citosina y uracilo. Ej. ARNPolinucleótidos de interés biológicoEl ADNSe encuentra en el núcleo de las células eucariotas asociado a proteínas (histonas y otras)formando la cromatina, sustancia que constituye los cromosomas y a partir de la cual setranscribe la información genética. También hay ADN en ciertos orgánulos celulares (porejemplo: plastos y mitocondrias). Según su forma puede ser lineal (eucariotas y algunosvirus) o circular (mitocondrias, cloroplastos, bacterias y algunos virus), y según el número decadenas puede ser bicatenario (algunos virus, bacterias y eucariotas) o monocatenario (restode los virus).  La estructura del ADNSe pueden distinguir 3 niveles estructurales:- Estructura primaria: La secuencia de los nucleótidos.- Estructura secundaria: La doble hélice.- Estructura terciaria: Collar de perlas, estructura cristalina, ADN superenrollado. En las células eucariotas, a partir de la estructura 3ª, se dan otros niveles deempaquetamiento de orden superior. 1. Estructura primariaEs la secuencia de nucleótidos de una cadena o hebra. Es decir, la estructura primaria delADN viene determinada por el orden de los nucleótidos en la hebra o cadena de la molécula.
  5. 5. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las basesnitrogenadas o su inicial (A, T, C, G) en su orden correcto y los extremos 5 y 3 de lacadena nucleotídica. Así, por ejemplo:5ACGTTTAACGACAAGTATTAAGACAAGTATTAA3La posibilidad de combinar cuatro nucleótidos diferentes y la gran longitud que pueden tenerlas cadenas polinucleotídicas, hacen que pueda haber un elevado número de polinucleótidosposibles, lo que determina que el ADN pueda contener el mensaje biológico o informacióngenética y explica la diversidad del mensaje genético de todos los seres vivos. 2. Estructura secundariaWATSON y CRICK postularon en 1953 un modelo tridimensional para la estructura del ADNque estaba de acuerdo con todos los datos disponibles anteriores: el modelo de doblehélice. Este modelo, además de explicar cómo era el ADN, sugería los mecanismos queexplicaban su función biológica y la forma como se replicaba.Según el modelo de la doble hélice de WATSON y CRICK:1º) El ADN estaría constituido por dos cadenas o hebras de polinucleótidos enrolladashelicoidalmente en sentido dextrógiro sobre un mismo eje formando una doble hélice.2º) Ambas cadenas serían antiparalelas, una iría en sentido 3-5 y la otra en sentidoinverso, 5-3.3º) Los grupos fosfato estarían hacia el exterior y de este modo sus cargas negativasinteraccionarían con los cationes presentes en el nucleoplasma dando más estabilidad a lamolécula.4º) Las bases nitrogenadas estarían hacia el interior de la hélice con sus planos paralelosentre sí y las bases de cada una de las hélices estarían apareadas con las de la otraasociándose mediante puentes de hidrógeno.5º) El apareamiento se realizaría únicamente entre la adenina y la timina, por una parte, y laguanina y la citosina, por la otra[1]. Por lo tanto, la estructura primaria de una cadena estaríadeterminada por la de la otra, ambas cadenas serían complementarias.La complementariedad de las cadenas sugiere el mecanismo por el cual el ADN se copia -sereplica- para ser trasferido a las células hijas. Ambas cadenas o hebras se pueden separarparcialmente y servir de molde para la síntesis de una nueva cadena complementaria (síntesissemiconservativa).
  6. 6. 3. Estructura terciaria Las grandes moléculas de ADN de las células eucariotas están muy empaquetadas ocupandoasí menos espacio en el núcleo celular y además como mecanismo para preservar sutranscripción. Como hemos visto, en las células eucariotas el ADN se encuentra en el núcleo asociado aciertas proteínas: nucleoproteínas, formando la cromatina. En la cromatina, la doble hélice deADN se enrolla alrededor de unas moléculas proteicas globulares, las histonas, formando losnucleosomas. Cada nucleosoma contiene 8 histonas y la doble hélice de ADN da dos vueltas asu alrededor (200 pares de bases). El conjunto, si no está más empaquetado aún, forma unaestructura arrosariada llamada collar de perlas. Ahora bien, los nucleosomas puedenempaquetarse formando fibras de un grosor de 30 nm (fibra de 30 nm). Según el modelo delsolenoide las fibras se forman al enrollarse seis nucleosomas por vuelta alrededor de un ejeformado por las histonas H1. 4. Niveles superiores de empaquetamiento • El número 1 corresponde a la doble hélice de ADN • En el número 2 , vemos el ADN unido a proteínas globulares, formando una estructura denominada "collar de perlas", formado por la repetición de unas unidades que son los "nucleosomas", que corresponderían a cada perla del collar. • En el número 3 se pasa a una estructura de orden superior formando un "solenoide" (o fibra de cromatina) • En el número 4, se consigue aumentar el empaquetamiento que origina nuevos bucles, denominados bucles radiales • En el número 5, llegamos al grado de mayor espiralización y compactación, formando un denso paquete de cromatina, que es en realidad, un cromosoma.En los espermatozoides el ADN se encuentra aún mucho más empaquetado, se dice que tiene"estructura cristalina".Los ADN de las bacterias, virus, mitocondrias y plastos no presentan estructuras tancomplejas y no están asociados a histonas, aunque sí están asociados a otras proteínas.  Pérdida de las estructura del ADN : La desnaturalización Si una disolución de ADN se calienta suficientemente ambas cadenas se separan, pues serompen los enlaces de hidrógeno que unen las bases, y el ADN se desnaturaliza. Latemperatura de desnaturalización depende de la proporción de bases. A mayor proporción deC-G, mayor temperatura de desnaturalización, pues la citosina y la guanina establecen trespuentes de hidrógeno, mientras que la adenina y la timina sólo dos y, por lo tanto, a mayorproporción de C-G, más puentes de hidrógeno unirán ambas cadenas. La desnaturalización seproduce también variando el pH o a concentraciones salinas elevadas. Si se restablecen lascondiciones, el ADN se renaturaliza y ambas cadenas se unen de nuevo.
  7. 7. Los RibonucleósidosEl ARNEl ARN, ácido ribonucleico, es un polirribonucleótido que, a diferencia del ADN, no contieneni desoxirribosa ni timina, pero sí ribosa y uracilo. El ARN no forma dobles cadenas, salvo enciertos virus (por ej. los reovirus), lo que no quita que su estructura espacial pueda ser enciertos casos muy compleja.Los nucleótidos se unen formando una cadena con una ordenación en la que el primernucleótido tiene libre el carbono 5’ de la pentosa. El último nucleótido tiene libre el carbono3’. Por ello, se dice que la ordenación de la secuencia de nucleótidos va desde 5’ a 3’. Tipos de ARNEn la célula aparecen cuatro tipos de ARN, con distintas funciones, que son el ARNmensajero, el ARN ribosómico y el ARN transferente. ⇒ ARN mensajero (ARNm)ARN lineal, que contiene la información, copiada del ADN, para sintetizar una proteína. Seforma en el núcleo celular, a partir de una secuencia de ADN. Sale del núcleo y se asocia aribosomas, donde se construye la proteína. A cada tres nucleótidos (codon) corresponde unaminoácido distinto. Así, la secuencia de aminoácidos de la proteína está configurada apartir de la secuencia de los nucleótidos del ARNm. ⇒ ARN ribosómico (ARNr)El ARN ribosómico, o ribosomal, unido a proteínas de carácter básico, forma los ribosomas.Los ribosomas son las estructuras celulares donde se ensamblan aminoácidos para formarproteínas, a partir de la información que transmite el ARN mensajero. Hay dos tipos deribosomas, el que se encuentra en células procariotas y en el interior de mitocondrias ycloroplastos, y el que se encuentra en el citoplasma o en el retículo endoplásmico de célulaseucariotas.  RNA heterogéno nuclear (ARNhn)Es un RNA de alto peso molecular, también conocido como transcrito primario del RNA, yaque es el RNA recién sintetizado por la RNA polimerasa en el proceso de transcripción.  ARN transferente (ARNt)Se encarga de transportar los aminoácidos presentes en el citoplasma celular hasta losribosomas, donde se unirán para constituir las proteínas.Cada molécula de ARNt transporta un aminoácido especifico. Estas diferencias son debidas,fundamentalmente, a una secuencia de tres bases nitrogenadas, denominada anticodón, quevaría entre los distintos ARNt.Los ARNt están formados por cadenas cortas (entre 70 y 90 nucleótidos) que contienen un10% de bases nitrogenadas diferentes a las cuatro mayoritarias.
  8. 8. Las moléculas de ARNt poseen una estructura secundaria muy característica, en la queexisten tramos de doble cadena, por emparejamiento intracatenario (algunas basesnitrogenadas son ligeramente a A, G, C y U). Estos tramos se denominan brazos y haycuatro en cada molécula, aunque también puede aparecer un quinto brazo más corto que losotros. En los extremos de tres de los brazos existen zonas sin emparejar que componen losdenominados bucles. ARNtEl extremo 3´ de la cadena tiene siempre la secuencia de bases CCA. A éste nucleótidoterminal de adenina se une el aminoácido que va a ser transportado.En el extremo 5´ siempre existe un nucleótido de guanina con su grupo fosfato.El bucle 1 o brazo D, cuya secuencia es reconocida de manera específica por uno de los 20enzimas, llamados aminoacil-ARNt sintetasas, encargados de unir cada aminoácido con sucorrespondiente molécula de ARNt.El bucle 3 o brazo TψC, que actúa como lugar de reconocimiento del ribosoma.El bucle 2 situado en el extremo del brazo largo que contiene una secuencia de tres basesllamada anticodón. Cada ARNt “cargado” con su correspondiente aminoácido se une,mediante la región del anticodón, con tripletes de bases del ARNm (cada tres bases deARNm definen un triplete o códón) en el proceso de la traducción del código genético queconduce a la síntesis de proteínas.3 Funciones de los ácidos nucleicosSe consideran las moléculas de la herencia y por lo tanto van a participar en losmecanismos mediante los cuales la información genética se almacena, replica y transcribe.Ésta no va a ser su única función, ya que determinados derivados de estas sustancias: losnucleótidos, van a tener otras funciones biológicas, entre las que pueden destacarse, comoejemplo, la de servir de intermediarios en las transferencias de energía en las células (ATP,ADP y otros) o en las transferencias de electrones (NAD+, NADP+, FAD, etc.).

×