Chelonian diagnostics, pathology and treatment

442 views

Published on

2013 International Symposium on Ranaviruses
by Matthew Allender

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
442
On SlideShare
0
From Embeds
0
Number of Embeds
5
Actions
Shares
0
Downloads
6
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Chelonian diagnostics, pathology and treatment

  1. 1. Chelonian Diagnostics, Pathology, and Treatment Matt Allender, DVM, MS, PhD, Diplomate ACZM Ranavirus Symposium July 2013 @Turtle_Doc #RV13
  2. 2. Ranavirus epidemiology  Disease events are often clustered in local epizootics  Some occur on annual basis  Several sources report a significant threat to biodiversity  Population density mortality in salamander studies  Environmental factors change prevalence  Restoration efforts
  3. 3. Quantitative PCR  TaqMan primer-probes were designed using Primer Express targeting a portion of the MCP that was contained within the 531 bp product  Forward: AACGCCGACCGAAAACTG  Reverse: GCTGCCAAGATGTCGGGTAA  Probe: CCGGCTTTCGGGC  Resultant segment was a 54 bp product
  4. 4. Conventional PCR Level of Detection: 529,000 viral copies 52 viral copies Quantitative PCR
  5. 5. Epidemiologic evidence Category Institution FV3 positive FV3 negative Prevalence 95% CI Free-living* OR 1 308 0.3% 0 – 1.8 % Rehabilitation* 7 217 3.13% 1.5 – 6.3% UT 3 35 7.9% 2.7 – 20.1 % WCV 2 120 1.6% 0.4 – 5.9 % NCSU 0 46 0.00% 0 – 7.7 % AWC 2 14 14.3% 4.0 – 39.9 % UGA 0 9 0.00% 0 – 29.9 % Total 8 525 1.5% 0.8 – 2.9% * Significant difference between prevalence in free-living population and rehabilitation populations, p=0.01, one-tailed
  6. 6. Results Variable FV3 positive FV3 negative Prevalence 95% CI Female 3 168 1.8 % 0.6 – 5.0 % Male 0 218 0.00% 0 – 1.7 % Adult 2 398 0.5 % 0.1 – 1.8 % Juvenile 2 55 3.5 % 0.9 – 11.9 % Sex: p=0.157, observed power = 0.73 Age: p=0.081, observed power = 0.91
  7. 7. Housing  Environmental chamber within Division of Animal Resources at UI-CVM  15’9” x 12”  Temperature was acclimated for 1 week prior to beginning study  Recorded daily and maintained +/- 1°C throughout duration of study  Adult female red-eared sliders maintained in 45 or 50 gallon plastic enclosures with ~20 gallons freshwater and basking spot
  8. 8. Virus  Ranavirus isolated from infected eastern box turtle  100% sequence homology to MCP of FV3  Grown to confluence in TH-1  Divided into aliquots of 5 x 105 TCID50  Quantitative PCR performed on virus  Four animal in each temperature group were administered 1 aliquot (0.67 ml) in the right forelimb muscle  Uninfected controls administered same volume crude cell lysate
  9. 9. Sample collection  Weight, whole blood, oral and cloacal swabs collected twice prior to inoculation to confirm negative status, then twice weekly throughout duration of study  PCV, TS, WBC, differential performed each sample  Clinical signs were recorded daily  Animals were euthanized when clinical signs were severe (as described in IACUC) or at 30 days post- inoculation  Control animal was euthanized at same time as inoculated animal  Gross necropsy performed within 48 hours  Histopathology of 8 tissues  qPCR of necropsy tissues
  10. 10. Results  Survival  22°C – all inoculated turtles were euthanized due to severity of signs  28°C – only 2 turtles were euthanized due to clinical signs  One uninfected control died of sepsis  Median survival times  22°C = 24 days (14 -30)  28°C = 30 days (17-30) 22C 28C
  11. 11. Results  *Significant increase over time (F=11.1, p=0.045)  Significant difference between control and inoculated turtles (p=0.035)  #Significant increase over time (F=7.13, p=0.026) Time 22°C Weight 28°C Weight Pre-inoculation 1693.5625* 2063.1250# Initial post- inoculation 1692.50* 2082.50# Terminal 1802.50* 2159.50#
  12. 12. Results Tissue Parameter 22C Viral Copies 28C Viral Copies Tongue Mean/median* 1.25 x 109* 5.94 x 106* Skeletal Muscle Mean/median* 3.7 x 1010* 3.64 x 108* Lung Mean/median* 6.29 x 109* 5.01 x 109* Heart# Mean/median* 2.92 x 1010 1.27 x 109* Liver^ Mean/median* 2.15 x 109 1.70 x 107* Spleen Mean/median* 2.23 x 1010* 5.44 x 107* Ovary Mean/median* 8.93 x 109* 9.06 x 106* Kidney Mean/median* 3.46 x 1010* 2.54 x 108* # Significant difference between environmental temperatures, p=0.012 ^ Significant difference between environmental temperatures, p=0.011
  13. 13. Results
  14. 14. Temperature evidence  Mortality  22°C  Significant association between inoculation and disease (p=0.014)  28°C  No significant association between inoculation and disease (p=0.214)  Non-significant mortality was seen at lower temperature (100%) than higher temperature (50%)  Power = 0.34
  15. 15. Temperature evidence  qPCR  Viral copies quickly went from undetectable to millions/billions of copies  All positive turtles had between 2 and 4 positive samples prior to death  Highest in whole blood, lowest in cloacal swab (non- significant) at 22°C  Specificity and Sensitivity  Whole blood  100% specific and 100% sensitive  Oral swab and cloacal swab  100% specific and 83% sensitive
  16. 16. Results
  17. 17. Conclusions  Prevalence in surveys of free-ranging populations are low  Are chelonians a spill-over host?  Natural history characteristics make it difficult to identify mortality events?  Are chelonians a reservoir host and fail to develop signs?  Are mechanisms of transmission different in chelonians which provide natural protection?
  18. 18. Conclusions  Environmental temperature leads to differences in mortality in red-eared sliders  Both host and pathogen factors that may lead to protection at higher temperatures  May play a role in persistence or transmission  Do other species have similar response to changes in temperature?  Opportunity for therapeutic intervention
  19. 19. Funding Sources  Morris Animal Foundation  qPCR development and prevalence study  CRESO  Prevalence study  Fluker’s Farms/Cox Pharmacology lab  PK study
  20. 20. Questions?

×