A new DNA encryption technique for secure data transmission with authentication and confidentiality

4,125 views

Published on

This will describe new technique about data encryption using DNA computing. Proposed a new technique that will provide authentication.

Published in: Education, Technology
0 Comments
4 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
4,125
On SlideShare
0
From Embeds
0
Number of Embeds
16
Actions
Shares
0
Downloads
276
Comments
0
Likes
4
Embeds 0
No embeds

No notes for slide
  • 09/21/13
  • A new DNA encryption technique for secure data transmission with authentication and confidentiality

    1. 1. A New Dna Encryption Technique For Secure Data Transmission With Authentication And Confidentiality Supervised by Presented by Shyla Afroz Md. Sajedul karim Lecturer Roll:083008 Dept. of CSE, RUET RUET
    2. 2. Outline  Objective  Background Study  Importance of DNA cryptography  Algorithm & Implementation  Proposed Model  Future work  References 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 2/20
    3. 3. Objective  Encrypt the plain text into DNA sequence(cipher text ) using new DNA encryption technique.  Decrypt this cipher text using DNA decryption technique.  Detect the limitation of this technique.  Propose a new model to solve this limitation. 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 3/20
    4. 4. Background Study  Nucleic Acid 2 types: DNA & RNA 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 4/20
    5. 5. Background Study  Genetic Code: Information encoded within genetic material (DNA or mRNA base) .  DNA sequence : Order of nucleotide bases in the DNA molecule. ATTAGCCTTATGCATGAACC 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 5/20
    6. 6. Background Study  Cryptography: The art of protecting information by transforming Plain Text into an unreadable format.  Those who possess the secret key can decrypt the message .  Encrypted messages can sometimes broken by Cryptanalysis . 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 6/20
    7. 7. Symmetric Cipher Model 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 7/20
    8. 8. DNA Cryptography First introduced by L. Adleman in 1990s. Plaintext message Encoded into DNA sequences. Related fields are : information storage , massive parallel processing , highly secured data transmission and more. Based on one-time-pads . 8/2011/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality
    9. 9. Importance of DNA Cryptography Weakness of traditional cryptology. Existing algorithms are no longer secure. 1995 , Bonech break the DES Weng - Long Chang have designed integer factorization which can break RSA. Offer all feature of secure data transmission . 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 9/20
    10. 10. New DNA Encryption Technique  Introduce by R.S. Dhawan and Alice in 2012.  It is symmetric Algorithm.  Has three secret key.  Few mathematical computation is needed.  Encrypted data are DNA sequences.  Support all ASCII character. 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 10/20
    11. 11. New DNA Encryption Technique  Key={Starting_Number,Modulus,Hyphen_Indices_ Array[ ] }  Starting_Number: Used to generate some sequential integer .  Substitution_Array: Contains sequential integer .It’s size is the length of Plain text. Substitution_Array[ i ]=Substitution_Array[i-1]+Modulus;  Modulus: Difference between each sequential integer in Substitution_Array[ ]  Hyphen_Indices_ Array[ ] :Used to separate number from sequence. 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 11/20
    12. 12. StartStart Set START_NUMBER , MODULO ; SUBSTITUTION_ARRAY[0]=START_NUMBER; FOR( i=1 TO (MSG_LENGTH-1) ) SUBSTITUTION_ARRAY[i]=SUBSTITUTION_ARR AY[i-1]+ MODULO ; Calculate Quotient and Remainder FOR (i =1 TO (MSG_LENGTH-1) ) { Quotient[i]= SUBSTITUTION_ARRAY[i]/ASCII[i] Remind [i]= SUBSTITUTION_ARRAY[i]%ASCII[i] } Total_ARRAY[]=Quotient[] followed by Remind[]; Convert 10- Base number to 4-base from TOTAL_ARRAY[] to CONVERT_ARRAY[] Calculate HYPHEN_INDICES[]; Replace: 0------ A 1------T 2-------C 3-----G Cipher Text Flow Chart Of Encryption Technique STOPSTOP 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality Input : Plain text; Perform ASCII conversion into ASCII_ARRAY[] 12/20
    13. 13. Data Sheet And Output Of Encryption Technique Character ASCII [ ] SUBSTITUTION ARRAY [ ] DIVISION Quotient[ ] Remainder[ ] M 77 877 877/77 11 30 E 69 902 902/69 13 5 S 83 927 927/83 11 14 U 85 952 952/85 11 11 K 75 977 977/75 13 2 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 13/20
    14. 14. StartStart Separate 4-base number Using Hyphen_Indices Array Calculate ASCII value: For(i=0 to CIPHER_TEXT_LENGTH/2-1) D_ASCII[i]=(SUB_ARRAY[i]-REMIND[i])/ QUOTIENT[i] Mapped ASCII value to CHARACTER Convert 4- Base number to 10-base from FOUR_BASE _ARRAY[] to TEN_BASE_ARRAY[] Input : Cipher Text Mapping: A------ 0 T------1 C-------2 G-----3 Plain Text Flow Chart Of Decryption Technique STOPSTOP 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality Make SUBSTITUTION_ARRAY[ ] Separate REMIND[ ] and QUOTIENT[ ] 14/20
    15. 15. Table And Output Of Decryption Technique QUOTIENT REMAINDER For(i=0 to cipher_text_length/2) D_ASCII[i]=(SUB_ARRAY[i]-REMIND[i])/ QUOTIENT[i] Character 11 30 (877-30)/11= 77 M 13 5 (902-5)/13= 69 E 11 14 (927-14)/11= 83 S 11 11 (952-11)/11= 85 U 13 2 (977-2)/13 = 75 K 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality Cipher Text:TTTCCTTGGCATAAGTTGAC 15/20
    16. 16. Result Analysis  Can Encrypt and Decrypt all ASCII character.  Provide Avalanche effect.  Provide Confidentiality.  Limitations:  Can not provide Authentication property.  Can not detect Modification of message. 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 16/20
    17. 17. Proposed Model 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality M || H E D M C(K1,M) H Compare K1 K2 K2 E(K2,[M||H(K1,M)]E 17/20 M=Plain Text H=Hash function E=Encryption D=Decryption K1 , K2=Key D K1
    18. 18. Future Work  Provide Authentication property using Digital Signature .  Add function that will detect Modification of message.  Compare performance with Existing one.  Implement this approach in Programming Language. 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 18/20
    19. 19. REFERENCES [1] RS Dhawan and Alice(2012). A new DNA Encryption technique for secure data transmission. Research Scholar , Kurukshetera University, Haryana, India. [2] Guangzhao Cui , Cuiling Li , Haobin Li , Xiaoguang Li (2009). DNA computing and its application to information security field. Research ScholarHenan key Lab of information-based Electrical Application , Zhengzhou 450002. 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 19/20
    20. 20. REFERENCES [3] Pankaj Rakheja(2012). Integrating DNA computing in international data encryption Algorithm(IDEA). Deep Institute of Engineering and Technology, Haryana, India. [4] Abdullah Al Mueen & Md. Nurul Amin Applications of Graphs in Bioinformatics pp.16-50, 2006 11/9/2013 A New DNA Encryption Technique For Secure Data Transmission With Authentication And Confidentiality 20/20

    ×