Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Aplicaciones biomédicas de la genómica

698 views

Published on

Published in: Education
  • Be the first to comment

  • Be the first to like this

Aplicaciones biomédicas de la genómica

  1. 1. Aplicaciones biomédicas de la genómicaAngel CarracedoFundación Galega de Medicina XenómicaCentro Nacional de Xenotipado-USCPontevedra
  2. 2. El genoma es...• El conjunto completo de genes de un organismo, donde se guarda toda la información genetica.
  3. 3. GENOMA HUMANO3.000.000.000 de pares debases (A, T, C, G)Alrededor de 30.000genes
  4. 4. Grupo de Medicina Genómica USC-SERGAS http//:xenomica.org IML
  5. 5. La Genética nace con la teoría del gen y las leyes que explican los patrones más sencillos de herencia. El componente genético de la variación de todos los caracteres de los seres vivos se puede explicar por un número limitado de elementos discretos: los factores mendelianos o genesGregor JohannMendel (1822-1884) La Genética se ocupa del estudio de las leyes biológicas de la herencia y de la variación
  6. 6. EL CARIOTIPO HUMANO23 pares de cromosomas: 1956
  7. 7. EL ANÁLISIS CROMOSÓMICO Ý LOS SÍNDROMES HEREDITARIOS J. Lejeune (1960)
  8. 8. 1977Allan Maxam y Walter Gilbert (foto) de laUniversidad de Harvard University y FrederickSanger del U.K. Medical Research Council (MRC)desarrollan métodos de secuencia independientesDNA
  9. 9. LA “PCR” UNA REVOLUCIÓN EN LA1988 BIOLOGÍA MOLECULAR * ADN PROBLEMA * CEBADORES * dNTPs(A,T,C,G) * Taq Polimerasa * CL2MgK.B. Mullis: premio Nobel de 1993 * BUFFER por el desarrollo del método de amplificación en cadena de la polimerasa (PCR)
  10. 10. PROYECTOGENOMAHUMANO Abril 1990 El NIH y el DOE acuerdan un plan para completar mapas genéticos, físicos y la secuencia completa de un mapa genético y físico con marcadores cada 100 kb y secuenciar : Mycoplasma capricolum, Escherichia coli (en la figura), Caenorhabditis elegans, Saccharomyces cerevisiae y el GENOMA HUMANO
  11. 11. OBJETIVOS DEL PROYECTO GENOMA HUMANO (NIH, DOE, 1990)– Identificar todos los genes– Determinar la secuencia de los 3.000 millones de bases del ADN humano– Almacenar toda la información en bases de datos– Desarrollar las herramientas para el análisis y acceso a los datos– Desarrollar los problemas éticos, sociales y legales que se derivarán
  12. 12. 1990TRES GRUPOS DESARROLLANINDEPENDIENTEMENTE LAELECTROFORESIS CAPILARLloyd Smith (Nucleic Acids Research),Barry Karger (Analytical Chemistry), yNorman Dovichi (Journal ofChromatography)1991Desarrollo de la tecnología defluorocromos (PE)
  13. 13. 2001(Febrero) El consorcio HGP publica un borrador deltrabajo en Nature (15 Febrero), y Celera en Science (16Febrero) 2003: Primera fase considerada concluída
  14. 14. 20022005 1ª fase2006 2ª fase
  15. 15. ¿Qué sabemos?*Que tenemos unos 3 mil millones de pares de bases (A,C,T, G)*Que un gen tiene de media 3000 bases pero varía mucho sutamaño*Que el número de genes total que tenemos es alrededor de25,000*Que los seres humanos somos un 99,9% idénticos*Que sólo el 2% del genoma codifica para proteínas*Que la mayoría del ADN es no codificante*Que sobre un 50% del ADN son frases que se repiten (muchomás que ninguna otra especie)
  16. 16. ¿Qué no sabemos?*El número exacto de los genes*La función de la mayoría*La manera como interaccionan*La mayoría de los genes implicados en enfermedades comunes*Muchas de las funciones del ADN no codificante*La coordinación exacta de la expresión génica, síntesis deproteínas y eventos postraslacionales.*El proteoma (Contenido total de proteínas, su función einterrelaciones)
  17. 17. UTLIDAD DE LOS ANÁLISISGENÉTICOS*DIAGNÓSTICO*PRONÓSTICO*TRATAMIENTO Consejo genético Diagnóstico prenatal Diagnóstico preimplantacional
  18. 18. Enfermedades mendelianasGenesAmbiente (monogénicas y genéticamente heterogéneas)Genes EnfermedadesAmbiente complejasGenes EnfermedadesAmbiente ambientales
  19. 19. Forma PrP maligna normal (PrP (PrP scrapie) celular) 129 181 197Amino terminal Carboxi terminalEnfermedad de Creutzfeldt-Jakob Codón 129 PRNP A>A Met-Met desarrollan la enfermedad
  20. 20. Distribución de la enfermedad genética identificable Cromosom. Mendelianas Complejas
  21. 21. AD Roses,Lancet 2000; 355: 1358–61
  22. 22. The conversion of the Abl proto-oncogene into an oncogene in patientswithchronic myelogenous leukemia. The chromosome translocationresponsible joins the Bcr gene on chromosome 22 to the Abl gene fromchromosome 9, thereby generating a Philadelphia chromosome. Theresulting fusion protein has the N-terminus of the Bcr protein joined to theC-terminus of the Abl tyrosine protein kinase; in consequence, the Ablkinase domain becomes inappropriately active, driving excessiveproliferation of a clone of hemopoietic cells in the bone marrow.
  23. 23. Localización: 17q21 BRCA1 Tamaño ≈ 100 Kb Región codificante: 5.592 pb 24 exones, 22 codificantes Exón 11: 3.425 pb 11 GEN APC Localización: 5q21-q22 ORF = 8.529 bp 15 exones codificantes Exón 15 = 6.571 bp 1061 13091 splicing alternativo 15
  24. 24. CÁNCER DE MAMA.- 80% esporádicos.- 20% predisposición genética: - menor edad de aparición - ↑ c. mama bilateral - otros cánceres en la familia
  25. 25. Enfermedades mendelianas 2500 1980 1983 2000 1986 1989 Número 1500 1992 de loci 1000 1995 500 1998 2001 0 2004 AÑO 2007FundaciónGallega de 1997Medicina 5000 1998 4000 1999Genómica 2000 Galicia Pruebas 3000 2001 +30% anual solicitadas 2000 2002 2003 Externa 1000 2004 +150% anual 0 2005 AÑO 2006
  26. 26. Pr o 0 1000 1200 1400 1600 200 400 600 800 tro m bi n a H Ig em H t(1 oc 4; t(9 ro 18 ;2 m ) 2) at os (B is C R- AB L) TC F R V 21 Le -H i id den ro xi la sa casos año) PM TN L- F RA R a Ti G ro H gl -R ob ul in a p5 3170 menos de 100 casos/año t(1 1; 14 ) G H -1 M C Q TH or ea uim FR de eri Hu smo In C nt in es ha gt ta rc on bi ot lid M ad ar de ie-T m o icr oth os 1A at el Po it liq e s ui st os is t(8 ;2 1) IN V TE (16 L- ) Relación pruebas por demanda (> de 10050 menos de 10 casos/año AM L1 AP C
  27. 27. TI POS DE PATOLOGÍ AS GENÉTI CAS Caracteres asignados a genes simples. OMIMHERENCI A MENDELI ANA• MonogénicasMuchas raras: Prevalencia < 1/ 2000HERENCI A NO MENDELI ANA• Cromosómicas• Mitocondriales• Somáticas adquiridas• Multifactoriales
  28. 28. Williams Deletion Region
  29. 29. 14 Unstable Trinucleotide Repeat Disorders in Humans AUG TAA CGG GAA CAG CTG Fredreich’s Ataxia Myotonic DystrophyFragile X Syndrome Spinobulbar Muscular Atrophy Fragile XE MR Huntington’s Disease Dentatorubral-Pallidoluyslan Atropphy Spinocerebellar Ataxia Type 1 Spinocerebellar Ataxia Type 1 Spinocerebellar Ataxia Type 2 Spinocerebellar Ataxia Type 6 Spinocerebellar Ataxia Type 7 Spinocerebellar Ataxia Type 8 Spinocerebellar Ataxia Type 12 Machado-Joseph Disease (SCA3)
  30. 30. La mayor parte de los conflictos y de los problemas éticos de lanueva medicina genómica se derivan del carácter predictivo
  31. 31. Epidemiólogos GastroenterólogosColaboración Cirujanos Oncólogosmulticéntrica Radiólogos ti c ro n é e je Patólogos o Ge ns Etc. o Co l og sicó Unidad de P Consejo n e ular a Genético i st Ge c t le Oncólog o Mo Cirujano Asistencia Colaboración Primaria Internacional
  32. 32. Dos casos de este mes para ilustrar el problema
  33. 33. MORE THEN 40 Y. OLD/ SPAIN : 40/100.000 /y ARRYTHMIC DEATH 50% Ischemic Non ischemic SECONDAR PRIMARY ION CHANEL- ACUTE CRONIC ELECTRIC MYOCAR. MYOCAR. DISORDERS HYPERTENSION HCM BRUGADA EULALIA MYOCARDITIS MCD LONG QT PROJECT: VALVULAR DAVD SHORT QT ALCOHOL MCR TV CATECOL 50% Myocar. OTHERS ILVNC ICCD
  34. 34. Causes of SCD in <40 y.Congenital coronary Mildly increased cardiac mass HCM? anomalies (10%) (19%) Ruptured aorta 5% Tunnelled LAD 5% Aortic stenosis 4% Myocarditis 3% HCM (36%) DCM 3% 45% <35 y. ARVC 3% MVP 2% CAD 2% Other 6%Maron BJ et al. Circulation. 1996;94:850-56.
  35. 35. Frequency of mutations in 215 Spanishpatients with HCM MYH7 27% MYBPC3 35% TNNT2 TNNI 3 MYL2 MYL3 ACTC TPM1 TNNC1 4% 26% None 4% 65% found after extensive sequencing of 12 genes-it could be extended to 70%
  36. 36. % WITH MUTATION IN RELATION WITH AGE FIRST PANNEL (300 MUTATIONS)403530 <30 <4025 AGE <30 <5020 AGE <40 AGE >3015 <50 >4010 >50 AGE AGE 5 >30 >40 AGE AGE >60 >50 >60 0 % WITH MUTATION
  37. 37. USA Comparison of death risks 4th cause of death 5% admissions 4 Billions $/year Annual rate of death1 en 107 1 en 106 1 en 105 1 en 104 1 en 103 1 en 102 Electrocución Air crash Homicide Car crash Pharmacogenetics Adversary reactions to drugs Pharmacogenetics can benefit 20% ADRs actually and it expected to beneficit 40% in 4 years
  38. 38. Some Individualizing Therapy iswide therapeutic range drugs have such a Important for Drugs with that individualizing the dose is not important a Narrow Therapeutic Range but in others is essential toxicity 100 100 efficacy efficacy toxicity Dose Dose wide therapeutic narrow range therapeutic range e.g. penicillin e.g. anticancer drug Safe to prescribe dose effective for Difficult to prescribe effective >90% of population non-toxic dose
  39. 39. The Translocation of t(9;22)(q34;q11) in CML Medicamentos BCR-ABL inteligentes Estrategias diagnósticas (Inhibidores de la tirosin kinasa) IMATANIB
  40. 40. ONCOFARMACOGENÉTICA Fundación Gallega de Medicina GenómicaFÁRMACO GEN POLIMORFISMO EFECTO EFECTOS BIOQUIMICO SECUNDARIOS ASOCIADOSIRINOTECÁN UGT1A1 PROMOTOR: [ A(TA)NTAA ] DISMINUCIÓN DEL NEUTROPENIA WT:TA6 70% DE LA DIARREA UGT1A1*28:TA7 ACTIVIDAD ASTENIA… TRANSCRIPCIONAL5-FU 1) DPYD IVS14+1 G->A DELECCION DEL EXON TOXICIDAD SANGUÍNEA DPYD*2 (alelo inactivo más 14 DE 165BP Y DIGESTIVA común-50% de los casos) (SKIPPING) 2) TYMS a) VNTR de 28 bps en región A MÁS REPETICIONES NIVELES PROTEICOS DE promotora: AUMENTA LA TS INVERSAMENTE WT: TSER*2 EFICACIENCIA EN LA RELACIONADOS CON MUT: TSER*3 TRADUCCION RESPUESTA CLÍNICA AL TUMOR c) SNP G->C en nucleótido HAPLOTIPOS DE ALTA MAYOR SUPERVIVENICA 12 de segunda repetición en Y BAJA EXPRESION EN LOS GRUPOS DE BAJA TSER*3 ALTA:2R/3G,3C/3G,3G EXPRESIÓN /3G BAJA:2R/2R,2R/3C,3C/ 3C b) Delección de 6bp en DISMINUYE LA 3’UTR (1494) ESTABILIDAD DEL mRNA 3) MTHFR a) SNP C677T (rs 1801133) FACTORES b) SNP A1298C INDEPENDIENTES DE LA RESPUESTA DEL PACIENTE AL TRATAMIENTO DEL CÁNCER COLORRECTAL CON 5FU
  41. 41. Limited therapeutic efficacy in many TAsDe: Spear et al., Trends Mol Med 7:201-204, May 2001
  42. 42. ¿qué es la fiebre? ¿y la artritis? ¿y la esquizofrenia?Una de las mayores razones de la falta deeficacia en el tratamiento es que muchasenfermedades son en realidad síndromesde etiopatogenia no bien conocida y denaturaleza polifactorial y multigénica(enfermedad genéticamente compleja-QTLs)
  43. 43. SNP: SINGLE NUCLEOTIDE POLYMORPHISM ATCGGCGTACCTGATTCCGAATCCGTATCG ATCGGCGTACCTGAATCCGAATCCGTATCG Distribution: 1 every 300bp >10 million SNPs in the human genome (around 6M validated)->11M in dbDNP Human DNAA SNP MAP
  44. 44. p13.1 p12 p11 q11 q12 q13.1 q13.2 q13.3 q13.4Chr. 19SNPs XRCC1 APOE DM CALM3Genes 0 1000 2000 3000 4000Kb Desequilibrio de ligamiento entre población sana y afecta
  45. 45. Human Genetic Association Study Design Phenotype A Phenotype B Responder Non-responder ADR Allele 1 Allele 2 Marker A: Allele 1 = Allele 2 = Marker A is associated with Phenotype
  46. 46. Genotyping means patient classification
  47. 47. HapMap (2002)• Reduction of SNPs required to examine the entire genome for association with a phenotype from 10 million to 500,000 tagSNPs• Genome scan approaches for genes involved in complex traits more efficient and comprehensive
  48. 48. Genotyping technologies Illumina SNPlex Sequenom1500 - 400 SNPs 400 - 40 SNPs 200- 5 SNPs WGS Affymetrix Whole genome scans
  49. 49. Spanish National Genotyping Center GenotypingPre-genotyping Pre-genotyping Genotyping platforms: Post-genotyping Post-genotypingDNA extraction and Designs ••Data download Data download DNA extraction and ••Format changes Format changes quantification quantification ••Data analysis Genotyping Data analysisProject design Project design ••Customer support Customer supportSNP selection based on: Data checking SNP selection based on:Function prediction Function prediction•• PreviousLD Previous LD• Known disease association • Known disease association Researchers Researchers 50% cost covered by Genoma España- Groups out of Spain can benefit if they have collaborative projects with groups in Spain
  50. 50. Association studiesCandidate gene approach -Causative hypothesis or candidate genes -Causative SNPs can be exploredMany examples but very few with more than 1 M genotypesWhole genome scans -No need of gene selection -Lack of bias towards specific genesExample: Kammerer et al. Cancer res. 64: 8906, 2004) 25,000SNPs (254 samples and 268 controls + replication)CGEMS-NCI (coming soon)
  51. 51. 1412 CANCER10 PSYCHIATRY NEUROLOGY8 ENDOC-MET6 REUMATHOL. OFTALMOL4 CARDIOVAS2 OTHERS0 TOTAL 2005: 55 PROJECTS 2006: 95 PROJECTS >1B Genotypes (including WGS projects)
  52. 52. Human genome variation 99.9% identity
  53. 53. FORENSIC GENETICS
  54. 54. PATERNITY TESTING *6 9 P. FATHER 1 3 *8 MOTHER *6 *8 CHILD 3 9 P. FATHER 2
  55. 55. DYS393 SUSPECT 1 0.1 ng DNA DYS390 DYS389-I DYS19 DYS389-II DYS393 SUSPECT 2 : AZOOSPERMIC DYS19 DYS389-I DYS390 DYS389-II DYS393 0.5 ng DNA DYS390DYS393 DYS389-I DYS19 VAGINAL SWAB DYS19 DYS389-I DYS390 DYS389-II
  56. 56. Análisis de los restos de lafamilia Romanov
  57. 57. MUESTRAS ANALIZADAS:CorazónCabellos de María Antonieta, madre de Luis XVIICabellos de Juana Gabriela y María Josefa, hijas de María Teresa de Austria, abuela del infante EL “CORAZÓN DE PIEDRA” PERTENECE AL DEL HIJO DE MARÍA ANTONIETA Familiares vivos estudiados (descendientes actuales de los Habsburgo): NADIE HA DEMOSTRADO QUE SEA EL Reina Ana de Rumanía y su hermano príncipe Andrés de Borbón-Parma HIJO DE LUIS XVI….
  58. 58. SNPs: SINGLE NUCLEOTIDE POLYMORPHISMS ATCGGCGTACCTGATTCCGAATCCGTATCG ATCGGCGTACCTGAATCCGAATCCGTATCGThe World Trade Center Data• 10,000 reference profiles for 2,724 victims• 50% failed• SNPs makes the difference
  59. 59. Population indicative SNPs or AIMs could give an important forensic analysis tool First 9 victims identified from the London transport attacks 7-7-05
  60. 60. Trait Analysis - Hair Colour Red hair is a single gene Black / Brown / Blonde hair is multigenic
  61. 61. Trait Analysis - Facial Features Can begin to isolate genes for facial features by association studies of SNP profiles with particular characteristics
  62. 62. DNA databases could avoid errors like this! DNA evidence related both cases and allowed the solution of the case Sonia Carabantes 1999 Rocío Wanninkhof 2000 Tonny KingDolores Vázquez Previously Tonny BromwichDeclared guilty in 2002 and punished convicted in the UK 1985-1995with 20 years. 2 years in prison for rape of 5 women
  63. 63. CAPÍTULO SEGUNDOSentencia del Tribunal Supremo 23 de Mayo de 1997
  64. 64. ATAPUERCA 7500 B.D.
  65. 65. Teoria de la “Eva africana”FILOGEOGRAFÍA
  66. 66. mi Es a el omgen e me qu ó a g obli rlo e hac
  67. 67. Ethical Principles which Apply to Medical Genetics• Autonomy - being free to make decisions• Beneficence - doing the right thing, promoting well being and preventing harm• Justice - being fair• Nonmaleficence - doing no harm• Veracity - telling the truth• Fidelity - keeping all contracts and promises
  68. 68. DNA databases could avoid errors like this! DNA evidence related both cases and allowed the solution of the case Sonia Carabantes 1999 Rocío Wanninkhof 2000 Tonny KingDolores Vázquez Previously Tonny BromwichDeclared guilty in 2002 and punished with convicted in the UK 1985-1995 for20 years. 2 years in prison rape of 5 women
  69. 69. OperativasPreparaciónSin planes
  70. 70. Universales: Máxima eficacia-No discriminaciónCatálogo de delitos: Eficacia limitada a los delitos graves-Mayor libertad
  71. 71. German DNA Database:Hit by Crime Statistics 1997-2003 Burglary 11.690 84% Abduction 22 0% Violent attacks 76 1%Sexual assault 537 4% Murder Robbery and 208 blackmail 1% Other crimes 1004 396 7% 3%
  72. 72. Offenders are crossing over• To solve a specific crime type (e.g. sexual assaults) perpetrators convicted of other crimes need to be in the database.• Data from Virginia (courtesy Smith-Alling-Lane)
  73. 73. Virginia “Cold Hits” on the DNA Database All Drug Offenders to Type of Crime Solved Abduction/ Sex Offenses Car Jacking 20% (35) 8% (13)Miscellaneous Robbery 12% (20) 10% (18) Burglary Homicide 24% (41) 24% (42) Assaults 2% (3)
  74. 74. DNA Database Statistics in Europe GB NL A D SF S CH B FDate: June 06 June 06 Aug. 06 June 06 June 06 May 06 June 06 June 06 Dec. 05Total 3.7 Mill. 45,800 112,300 494,400 39,900 28,000 89,400 16,300 127,800Persons 92 % 45 % 80 % 81 % 82 % 44 % 86 % 42 % 94 %Popul. % 5.7 % 0.13 % 1.1 % 0.5 % 0.63 % 0.14 % 1.05 % 0.07 % 0.2 %+ Suspects + (+) + + + (+) + +Stains 8% 55 % 20 % 19 % 18 % 56 % 14 % 58 % 6%Hits 762,600 12,600 9,700 41,000 6,600 16,000 14,000 970 2,100Pers. hits 94 % 70 % 70 % 73 % 82 % 39 % 79 % 28 % 62 %
  75. 75. 2008 Any recordable offense Catálogo de delitos Delitos sexuales Sin planes
  76. 76. Criminal forensiccasework +Databases 2000 Justice Police Private
  77. 77. Criminal forensiccasework +Databases 2008 Justice Police Private Economic pressure in favor of general databases
  78. 78. Un 25% consentiría en implantarse un chip de detección con seguridadpolicial y jurídica
  79. 79. Análisis de ADN confines penales 2008 Common Law Controversial Sistema romano justineaneo Justicia Inquisitorial Policia PrivadosAmbos sistemas están desbalanceados a favor de la acusación
  80. 80. El cambio de valores en los últimos años (¿Por qué valoramos de distintaforma seguridad y libertad?)Las bases de datos son necesarias pero la libertad individual tambiénUna pendiente deslizante peligrosa que recuerda el mito de la caverna dePlatón-Un mundo feliz o GATTACA
  81. 81. El componente genético de la enfermedad compleja se estáempezando a conocer-sin embargo las aplicaciones clínicas sonaun muy limitadasExisten muchas empresas que comercializan productos de valorclínico dudoso o nulo (chips de muerte súbita, de respuesta afármacos, de depresión, etc)-La utilidad para tomar decisiones enel tratamiento es limitada cuando no peligrosa(presión comercial amparada en la ignorancia y en la divulgaciónde avances)-Papel de las agencias reguladoras y de las sociedadescientíficasEl problema es aun más grave en sistemas de salud basados enempresas privadas de seguros médicosSecuenciación de genomas completos y probabilidades deenfermedades o actitudes: Una realidad en pocos años. ¿En queforma afectará a nuestros sistemas de salud y hasta que puntopodrá toda esta información ser utilizada fuera de un contextomédico? : Rigurosa consideración de todas las implicacionessociales, éticas y clínicas.
  82. 82. Determinismo genético versusdeterminismo cultural. ¿Otra vez eldebate?

×