Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Chromosomų ir genų mutacijos

16,267 views

Published on

Chromosomų ir genų mutacijos

Published in: Education
  • Be the first to comment

Chromosomų ir genų mutacijos

  1. 1. CHROMOSOMŲCHROMOSOMŲ IR GENŲIR GENŲ MUTACIJOSMUTACIJOS
  2. 2. 7.1 GENETINIO KINTAMUMO TIPAI  Genetinis kintamumas apibūdinamas kaip skirtumai, stebimi tarp tos pačios rūšies individų arba tarp skirtingų rūšių  Alelinis kintamumas atsiranda dėl mutacijų individualiuose genuose  Chromosomų aberacijos atsiranda dėl esminių chromosomų struktūros pokyčių  Jos, kaip taisyklė, paveikia daugiau nei vieną geną  Jos taip pat vadinamos chromosomų mutacijomis 7-2
  3. 3. Mutacijos  Terminas “mutacija” reiškia genetinės medžiagos paveldimą pokytį  Mutacijos sukuria alelinį kintamumą  Teigiama mutacijų savybė yra ta, kod jos sukuria genetinį evoliucijos pagrindą  Neigiama mutacijų savybė yra ta, kad jos yra daugelio ligų priežastis  Kadangi mutacijos gali būti gana žalingos, organizmuose išsivystė DNR reparacijos priemonės 7-3
  4. 4. Mutacijos 7-4  Mutacijos gali būti trijų pagrindinių tipų  1. Chromosomų mutacijos  Chromosomų struktūros pokyčiai  2. Genominės mutacijos  Chromosomų skaičiaus pokyčiai  3. Genų mutacijos  Palyginti nedideli DNR struktūros pokyčiai, įvykę viename gene
  5. 5.  Chromosominio kintamumo tyrimai svarbūs dėl keleto priežasčių  1. Jis gali turėti didelės reikšmės organizmo fenotipui  2. Jis gali turėti didelės reikšmės organizmo palikuonims  3. Jis yra rūšių evoliucijos svarbi varomoji jėga 7-5 7.2 CHROMOSOMŲ STRUKTŪROS KINTAMUMAS
  6. 6.  Citogenetika yra genetikos sritis, nagrinėjanti chromosomų struktūrą ir jų kiekį bei pokyčius.  Paprastai citogenetiniai tyrimai atliekami mikroskopu, nustatant individualių ląstelių ar organizmų chromosomų sudėtį  Tai leidžia nustatyti individus, turinčius nenormalius chromosomų kiekius arba struktūrą  Šiuo metodu taip pat galima atskirti įvairias rūšis 7-6 Citogenetika
  7. 7. 7-7  Klasikinėje citogenetikoje chromosomos atskiriamos pagal tris pagrindinius požymius  1. Dydį  2. Centromeros padėtį  3. Ruožų piešinį  Visos šios ypatybės yra matomos kariotipe – organizmo chromosomų rinkinyje, išdėstytame pagal chromosomų dydį ir centromeros padėtį Citogenetika
  8. 8. 7-8 Trumpasis petys; petite (Pranc.) Ilgasis petys Chromosomų klasifikacija pagal centromeros padėtį Metacentrinė Submetacentrinė Akrocentrinė Telocentrinė
  9. 9. 7-9  Tiksliai identifikacijai chromosomas reikia dažyti naudojant specialius metodus tam, kad išryškėtų būdingas ruožų piešinys  Pavyzdys: G-ruožuotumas  Chromosomos yra paveikiamos proteolitiniais fermentais (tripsinu) ir dažomos Giemsa dažais  Prie kai kurių segmetų prisitvirtina daug dažo molekulių  Tamsūs ruožai  Prie kitų segmentų dažo prisijungia nedaug  Šviesūs ruožai  Žmogaus chromosomose  300 G ruožų matoma metafazės stadijoje  2,000 G ruožų – profazėje Citogenetika
  10. 10. 7-10 Ruožuo- tumas metafazėje Ruožuo- tumas profazėje Žmogaus chromosomų G ruožai ir jų numeravimas
  11. 11. 7-11
  12. 12.  Dažymas išryškinant ruožuotumą yra naudingas keletu požiūriu:  1. Padeda atskirti chromosomas vieną nuo kitos  2. Padeda aptikti net subtilius chromosomų struktūros pokyčius  3. Padeda nustatyti glaudžiai susijusių rūšių evoliucinius ryšius Citogenetika 7-12
  13. 13.  Šiuolaikinėje citogenetikoje chromosomų identifikacijai plačiai taikomas fluorescencinės in situ hibridizacijos metodas (FISH) ir jo modifikacijos Citogenetika 7-13
  14. 14.  Yra du pagrindiniai chromosomų struktūros persitvarkymo būdai  1. Bendras genetinės informacijos kiekis chromosomoje pakinta  Delecijos  Duplikacijos  2. Genetinė medžiaga lieka ta pati, tačiau ji pertvarkoma  Inversijos  Translokacijos 7-14 Mutacijos gali pakeisti chromosomų struktūrą
  15. 15. 7-15  Delecija  Chromosomos segmento praradimas  Duplikacija  Chromosominio segmento pasikartojimas, lyginant su normalia chromosoma  Inversija  Genetinės medžiagos išsidėstymo krypties pasikeitimas individualioje chromosomoje  Translokacija  Vienos chromosomos segmento prisitvirtinimas prie kitos chromosomos  Paprasta translokacija  Vienkryptė pernaša  Reciprokinė translokacija  Dvikryptė pernaša
  16. 16. 7-16 Žmogaus 1-ma chromosoma Žmogaus 21-ma chromosoma Delecija Duplikacija Inversija Paprasta translokacija Reciprokinė translokacija
  17. 17. 7-17  Delecija įvyksta tada, kai chromosoma sulūžta, o susidaręs fragmentas yra pametamas Delecijos a) Terminalinė delecija b) Intersticinė delecija Vienas trūkis Pametamas ir degraduoja Pametamas ir degraduoja Du trūkiai ir likusių dalių susijungimas
  18. 18. 7-18  Fenotipinės delecijų pasekmės priklauso  1. Nuo delecijos dydžio  2. Nuo to, kurioje chromosomos vietoje įvyko delecija  Ar pamesti genai yra gyvybiškai svarbūs organizmui Delecijos  Kai delecijos pasireiškia fenotipiškai, jos, kaip taisyklė, būna žalingos Pavyzdžiui žmogaus cri-du- chat sindromas  Atsiranda dėl 5 chromosmos trumpojo peties delecijos
  19. 19. 7-19  Chromosomų delecijos aptinkamos įvairiais būdais  Citologiniais metodais  Naudojami didelėms delecijoms aptikti  Molekuliniais metodais  Genetiniais metodais  Jei mutantai negali sugrįžti į laukinį tipą, tai gali būti delecijos požymis  Dėl delecijų gali atsirasti reiškinys, vadinamas pseudodominavimu  Viena geno kopija pašalinama dėl delecijos  Tada gali vykti kitoje chromosomoje esančios recesyvinio alelio ekspresija
  20. 20. 7-20  Chromosmų duplikacijos dažniausiai atsiranda dėl rekombinacijos sutrikimų Duplikacijos Nelygus krosingoveri s Duplikacija Delecija
  21. 21. 7-21  Duplikacijų, kaip ir delecijų, fenotipinės pasekmės priklauso nuo dydžio  Fenotipinių pasekmių tikimybė tuo didesnė, kuo didesnė duplikacija  Tačiau duplikacijos, kaip taisyklė, yra mažiau žalingos negu tokio paties dydžio delecijos Duplikacijos
  22. 22. 7-22  Dauguma mažų duplikacijų neturi fenotipinių pasekmių  Tačiau jos yra labai svarbios, nes padeda atsirasti papildomiems genams  Galiausiai tai gali suformuoti genų šeimas  Genų šeimas sudaro du ar daugiau panašių genų Duplikacijos ir genų šeimos
  23. 23. 7-23 Genai, kilę iš vieno pirmtako Nenormalūs genetiniai procesai Sukelia geno duplikaciją Per daugelį generacijų genai gali pradėti skirtis dėl laipsniškos mutacijų akumuliacijos Mutacijų taškai Homologiniai genai
  24. 24. 7-24  Geras pavyzdys yra globinų genų šeima  Šie genai koduoja baltymus, kurių funkcija yra surišti deguonį  Pvz.: hemoglobinas  Globinų genų šeimą sudaro 14 homologinių genų, išsidėsčiusių trijose skirtingose chromosomose  Visi 14 genų yra kilę iš vieno protėvių geno  Skirtingų mutacijų kaupimasis skirtinguose šeimos genuose sukūrė  1. Globinų genus, kurių ekspresija vyksta skirtingomis žmogaus vystymosi stadijomis  2. Globinų baltymus, kurių funkcijos labiau specializuotos
  25. 25. 7-25 Duplikacija Geriau prisijungia ir saugo deguonį raumenų ląstelėse Geriau prisijungia ir saugo deguonį eritrocituose Ekspresija ankstyvojo embrioninio periodo metu Maksimali ekspresija nėštumo antrojo ir trečiojo trimestro metu Ekspresija po gimimo
  26. 26. 7-26  Inversija yra chromosomos segmentas, pakeitęs savo orientaciją priešinga kryptimi Inversijos Centromera invertuotos srities viduje Centromera už invertuotos srities ribų a) Pericentrinė inversija b) Paracentrinė inversija Normali chromosoma Invertuota sritis Invertuota sritis
  27. 27. 7-27  Inversijos atveju bendras genetinės informacijos kiekis nekinta  Todėl dauguma inversijų neturi fenotipinių pasekmių  Retais atvejais inversijos gali keisti individo fenotipą  Trūkio vietos pasekmė  Trūkiai, dėl kurių susidaro inversija, įvyksta gyvybiškai svarbiuose genuose  Padėties pasikeitimo pasekmė  Dėl padėties pasikeitimo pasikeičia ir geno ekspresija  Maždaug 2% žmonių turi inversijas, kurias galima aptikti šviesiniu mikroskopu  Dauguma individų yra fenotipiškai normalūs  Tačiau kai kurių palikuonys gali turėti genetinių defektų
  28. 28. 7-28  Chromosomų translokacija atsiranda tada, kai vienos chromosomos segmentas prisitvirtina prie kitos chromosomos  Formuojantis reciprokinėms translokacijoms, genetine medžiaga apsikeičia dvi nehomologinės chromosomos  Reciprokinės translokacijos atsiranda dėl skirtingų priežasčių  1. Chromosomų trūkiai ir reparacija  2. Nenormalus krosingoveris Translokacijos
  29. 29. 7-29 Telomeros saugo chromosomų DNR nuo sulipimo su kitos chromosomos DNR a) Chromosomų trūkiai ir reparacija b) Nehomologinis krosingoveris
  30. 30. 7-30  Reciprokinės translokacijos pertvarko genetinę medžiagą, tačiau nekeičia jos bendro kiekio  Todėl jos vadinamos subalansuotomis translokacijomis  Reciprokinės translokacijos, kaip ir inversijos, dažniausiai neturi fenotipinių pasekmių  Retais atvejais jos gali sukelti padėties pasikeitimo pasekmes  Paprastos translokacijos genetinę medžiagą perneša tik viena kryptimi  Jos taip pat vadinamos nesubalansuotomis translokacijomis Translokacijos
  31. 31. 7-31  Pavyzdys: šeiminis Dauno (Down) sindromas  Didesnioji 21-os chromosomos dalis yra prisitvirtinusi prie 14-os chromosomos  Individas turi tris kopijas genų, esančių 21-oje chromosomoje  Todėl jam būdingi Dauno sindromo bruožai
  32. 32. 7-32  Šeiminis Dauno sindromas yra Robertsono translokacijos pavyzdys  Ši translokacija susiformuoja taip  Trūkiai įvyksta dviejų nehomologinių akrocentrinių chromosomų pačiuose galuose  Maži acentriniai fragmentai pametami  Didesnieji fragmentai susilieja centromerinėmis sritimis, sudarydami vieną chromosomą  Šio tipo translokacijos dažniausiai sutinkamos žmogaus organizme  Nesubalansuotos translokacijos dažniausiai sukelia sunkias fenotipines pasekmes ar net letalumą
  33. 33.  Chromosomos persitvarkymas gali paveikti geno veiklą dėl to, kad trūkis įvyksta geno viduje  Kai kuriais atvejais genas lieka nepaliestas, tačiau jo ekspresija pakinta dėl jo naujos padėties  Tai vadinama padėties efektu  Padėties efektas pasireiškia dėl dviejų dažniausių priežasčių:  1. Geno persikraustymo prie kitų reguliacinių sričių  2. Geno persikraustymo į heterochromatininę chromosomos sritį Chromosomų struktūros pokyčiai gali veikti genų ekspresiją 7-33
  34. 34. 7-34 Reguliacinės sekos dažnai yra dvikryptės a) Padėties efektas dėl reguliacinių sekų b) Padėties efektas dėl translokacijos į heterochromatininę sritį
  35. 35.  Chromosomų skaičius gali kisti dviem pagrindiniais būdais  Euploidija  Ištisų chromosomų rinkinių kiekio kitimas  Aneuploidija  Chromosomų rinkinio pavienių chromosomų skaičiaus kitimai  Euploidinis kintamumas retkarčiais aptinkamas tarp gyvūnų ir dažnai – tarp augalų  Aneuploidinis kintamumas sukelia įvairius nenormalumus 7.3 Chromosomų skaičiaus kintamumas 7-35
  36. 36. 7-36 Poliploidiniai organizmai turi tris ar daugiau chromosomų rinkinius Individas vadinamas trisomiku Individas vadinamas monosomiku
  37. 37. 7-37  Kiekvienos eukariotų rūšies fenotipas priklauso nuo tūkstančių skirtingų genų  Šių genų ekspresija yra sudėtingai koordinuojama tam, kad išsivystytų fenotipiškai normalus individas  Aneuploidija dažniausiai sukelia nenormalų fenotipą  Tai įvyksta dėl genų produktų kiekio disbalanso Aneuploidija
  38. 38. 7-38 Daugeliu atveju tokie pokyčiai yra žalingi. Jie sukuria individus, kuriems tikimybė išgyventi yra mažesnė nei euploidiniams individams
  39. 39. 7-39  Visais 12 galimų trisomijų atvejais formavosi dėžutės (išdžiūvę vaisiai), kurių fenotipai skyrėsi  Be to, aneuploidiniai augalai pasižymėjo ir kitomis morfologinėmis ypatybėmis  Tarp jų buvo ir žalingų požymių Aneuploidija Žalingas aneuploidijos poveikis pirmą kartą buvo nustatytas, tiriant paprastąją durnaropę Datura stramonium
  40. 40. 7-40 Silpni augalai, su artimai išsidėsčiusiais ir susipynusiais lapais
  41. 41. 7-41  Chromosomų skaičiaus pokyčiai gana dažnai įvyksta formuojantis gametoms  Maždaug 5-10% visų žmogaus embrionų turi nenormalų chromosomų skaičių  ~ 50% visų spontaninių abortų yra dėl šios anomalijos  Kai kuriais atvejais chromosomų skaičiaus pokyčiai nėra letalūs ir embrionai išgyvena. Tačiau tai visada susiję su didesnio ar mažesnio laipsnio vystymosi sutrikimais ir patologija Aneuploidija
  42. 42. Žmogaus sindromai, susiję su aneuploidijomis Stovis Dažnis Sindromas Ypatybės Autosomų anomalijos Trisomija 21 1/800 Dauno Protinis atsilikimas, nenormali dermatoglifika, siauros akys, plokščias veidas, žemas ūgis Trisomija 18 1/6000 Edvardo Protiniai ir fiziniai defektai, veido anomalijos, aukštas raumenų tonusas, ankstyva mirtis Trisomija 13 1/15000 Patau Protiniai ir fiziniai defektai, daugybinės vidaus organų pažaidos, didelė trikampė nosis, ankstyva mirtis Lytinių chromosomų anomalijos XXY 1/1000 (v) Klainfelterio Nevaisingumas, krūtinės pabrinkimas, elgsenos anomalijos XYY 1/1000 (v) Jakobso Aukštas ūgis, elgsenos anomalijos XXX 1/1500 (m) Trigubos X Aukštos ir kūdos, nereguliarios menstruacijos, didesnis psichinių ligų dažnis X0 1/5000 (m) Ternerio Žemas ūgis, klostuostas kaklas, lytinis neišsivystymas, lengvas protinis atsilikimas 7-42
  43. 43. 7-43  Autosomų aneuploidijos, leidžiančios embrionui išgyventi, yra 13, 18 ir 21chromosomų trisomijos  Šios chromosomos yra santykinai mažos ir turi daug heterochromatino  Lytinių chromosomų aneuploidijos sukelia mažiau sunkias pasekmes negu autosomų aneuploidijos  Tai galima paaiškinti X chromosomos inaktyvacija  Todėl fenotipinės pasekmės gali atsirasti dėl  1. X chromosomoje esančių genų ekspresija iki X chromosomos inaktyvacijos embrione  2. Pseudoautosominių genų ekspresijos disbalansu
  44. 44. 7-44  Kai kurių žmogaus aneuploidijų dažnis priklauso nuo tėvų amžiaus  Vyresni tėvai dažniau susilaukia nenormalių palikuonių  Pavyzdys: Dauno sindromas (21 chr. trisomija)  Dažnis ypač priklauso nuo motinos amžiaus
  45. 45. 7-45  Dauguma gyvūnų rūšių yra diploidinės  Daugeliu atveju euploidiškumo pokyčiai nėra toleruojami  Gyvūnams poliploidija dažniausiai yra letali  Tačiau kai kurie euploidijos variantai yra natūraliai sutinkami gamtoje  Bičių patelės yra diploidinės  Bičių patinai (tranai) yra monoploidai  Jie turi tiktai vieną chromosomų rinkinį Euploidija (gyvūnai)
  46. 46.  Gamtoje aptikta tiktai keletas poliploidinių stuburinių rūšių Hyla chrysocelis (2n) Hyla versicolor (4n) 7-46
  47. 47. 7-47  Tačiau daugelio gyvūnų organizme yra audinių, kuriuose chromosomų rinkinių skaičius varijuoja natūraliai  Diploidiniai gyvūnai kartais turi poliploidinių audinių  Šis reiškinys vadinamas endopoliploidija  Pavyzdžiui, kepenų ląstelės gali būti triploidinės, tetraploidinės ar net oktoploidinės (8n)  Vabzdžių politeninės chromosomos yra geras natūralaus ploidiškumo kitimo pavyzdys Euploidija (gyvūnai)
  48. 48. 7-48  Dažniausiai susidaro drozofilos ir kitų vabzdžių seilių liaukose  Chromosomos keletą kartų replikuojasi, tačiau ląstelės nesidalija  Drozofilos seilių liaukų chromosomų poros dvigubėja maždaug 9 kartus (29 = 512)  Šie dvigubėjimai sudaro paraleliai išsidėsčiusių chromosomų ryšulius  Tokios chromosomos vadinamos politeninėmis Politeninės chromosomos
  49. 49. 7-49 Kiekviena chromosoma prisitvirtina prie chromocentro šalia savo centromeros Kartotinė chromosomų replikacija sukuria politenines chromosomas Politetinių chromosomų susidarymas Iš normalių drozofilos chromosomų Kiekvieną politeninės chromosomos petį sudaro šimtai lygiagrečiai išsidėsčiusių chromosomų Chromocentras Centrinis taškas, kur agreguoja visos chromosomos
  50. 50. 7-50  Politetines chromosomas nesunku tirti mikroskopu dėl jų ypatingo dydžio  Jos yra tokios didelės, kad gali būti tiriamos interfazėje  Politeninėms chromosomoms būdingas specifinis ruožuotumas  Kiekvienas tamsus ruožas vadinamas chromomera  Tamsaus ruožo DNR yra kompaktiškesnė, nei esanti tarpruožyje  Drozofilos politeninėse chromosomose rasta apie 5000 ruožų Politeninių chromosomų tyrimai padėjo išsiaiškinti daugelį procesų, vykstančių chromosomose interfazėje
  51. 51. 7-51  Priešingai nei gyvūnų, augalų poliploidija yra būdingas reiškinys  30-35% visų paparčių ir žydinčių augalų yra poliploidai  Dauguma maistui vartojamų vaisių ir grūdų taip pat yra poliploidiniai  Gana dažnai poliploidiniai augalai pasižymi geromis agrokultūrinėmis ypatybėmis  Jie būna didesni ir atsparesni aplinkos poveikiui Euploidija (augalai) Diploidinės petunijos Tetraploidinės petunijos
  52. 52. 7-52  Poliploidai, turintys nelyginį chromosomų rinkinių skaičių, paprastai būna sterilūs  Šių augalų gametos dažnai yra aneuploidinės  Pavyzdys: Triploidiniame organizme trys homologinės chromosomos anafazės I metu netolygiai pasiskirsto tarp dukterinių ląstelių Kiekviena ląstelė gauna po vieną kai kurių chromosomų kopiją ir po dvi kitų chromosomų kopijas
  53. 53. 7-53  Sterilumas paprastai yra žalingas požymis  Tačiau jis gali būti agrokultūriškai naudingas, nes gali sukurti  1. Besėklius vaisius  Besėkliai arbūzai ir bananai  Triploidinės veislės  Dauginami nelytiniu keliu ūgliais  2. Besėkles gėles  Triploidinės veislės
  54. 54. Mitozės anomalijos  Genetinės anomalijos, įvykusios po apvaisinimo, sukuria mozaicizmą  Dalis organizmo turi ląsteles, kurios genetiškai skiriasi nuo likusios dalies ląstelių  Mozaikinės srities dydis ir padėtis priklauso nuo to, kuriuo embrioninio vystymosi metu susidarė anomalija  Kraštutiniu atveju anomalija gali įvykti pirmojo mitozinio dalijimosi metu 7-54
  55. 55.  Apvaisintas drozofilos kiaušinis turi dvi X chromosomas (XX)  Viena X chromosoma pametama pirmojo mitozinio dalijimosi metu  Tai sukuria XX ir X0 ląsteles 7-55 Iš ląstelės XX vystosi moteriška drozofilos pusė Iš ląstelės X0 vystosi vyriška drozofilos pusė  Šis ypatingas ir retas individas yra vadinamas bilateraliniu ginandromorfu
  56. 56. Tarprūšiniai hibridai  Pilnas neišsiskyrimas gali sukurti individus su papildomais chromosomų rinkiniais  Tai vadinama autopoliploidija 7-56 Autopoliploidija
  57. 57. Tarprūšiniai hibridai  Daug dažnesnis chromosomų rinkinių skaičiaus kitimo mechanizmas yra aloploidija  Ji atsiranda dėl tarprūšinės hibridizacijos 7-57 Aloploidija
  58. 58.  Alodiploidai turi vieną chromosomų rinkinį, sudarytą iš susikryžminusių rūšių chromosomų 7-58  Pavyzdys yra dviejų antilopių (Hippotragus equinus ir Hippotragus niger) hibridas  Šios dvi artimos rūšys turi vienodą chromosomų skaičių, kurios, be to, yra panašaus dydžio ir ruožuotumo  Evoliuciškai susijusios dviejų skirtingų rūšių chromosomos vadinamos homeologinėmis  Šis alodiploidas yra fertilus, nes homeologinės chromosomos gali sudaryti sinapses mejozės metu
  59. 59.  Alopoliploidai susiformuoja įvykus autopoliploidijai ir aloploidijai  Pavyzdžiai: Raphanobrasicca, Triticale, Gossipium var. americana 7-59 Alotetraploidas: turi du pilnus chromosomų rinkinius, gautus iš skirtingų rūšių Alopoliploidija
  60. 60.  Taškinė mutacija yra vienos bazių poros pokytis  Tai gali būti bazių pakaitos 7-60 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACGCGAGATC 3’ 3’ TTGCGCTCTAG 5’  Tranzicija yra pirimidino (C, T) pakeitimas kitu pirimidinu arba purino (A, G) pakeitimas kitu purinu  Transversija yra pirimidino pakeitimas purinu ir atvirkščiai  Tranzicijos aptinkamos dažniau už transversijas 7.4 GENŲ MUTACIJOS Genų mutacijos keičia DNR sekas
  61. 61.  Taškinės mutacijos taip pat susiformuoja dėl trumpų DNR sekų insercijų (intarpų) ar delecijų (iškritų) Genų mutacijos keičia DNR sekas 7-61 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACGCGC 3’ 3’ TTGCGCG 5’ 5’ AACGCTAGATC 3’ 3’ TTGCGATCTAG 5’ 5’ AACAGTCGCTAGATC 3’ 3’ TTGTCAGCGATCTAG 5’ Keturių bazių porų delecija Keturių bazių porų insercija
  62. 62.  Mutacijos, įvykusios struktūrinio geno koduojančioje srityje, gali turėti įvairias pasekmes polipeptidui  Tylinčios mutacijos yra tokios bazių pakaitos, kurios nepakeičia aminorūgščių sekos polipeptide  Tai vyksta dėl genetinio kodo išsigimimo  Misens mutacijos yra tos bazių pakaitos, kurios pakeičia aminorūgščių seką polipeptide  Pavyzdys: Siklemija  Jei pakeista aminorūgštis pasižymi panašiomis savybėmis, kaip ir ankstesnioji, tai tokia mutacija vadinama neutralia Genų mutacijos gali pakeisti koduojančias geno sekas 7-62
  63. 63. Misens mutacija sukelia siklemiją  Siklemiją sukelia taškinė mutacija, dėl kurios β globino polipeptide glutamo rūgštis pakeičiama valinu a) Normalūs eritrocitai b) Siklemija sergančio žmogaus eritrocitai 7-63
  64. 64.  Mutacijos, įvykusios struktūrinio geno koduojančioje srityje, gali turėti įvairias pasekmes polipeptidui Genų mutacijos gali pakeisti koduojančias geno sekas 7-64  Nonsens mutacijos keičia normalų kodoną į terminalinį kodoną  Rėmėlio poslinkio (frameshift) mutacijos atsiranda dėl vienos bazės ar kartotinio dviems bazių skaičiaus insercijos ar delecijos  Tai pakeičia skaitymo rėmelį taip, kad pasroviui nuo mutacijos susiformuoja visiškai skirtinga aminorūgščių seka
  65. 65. 7-65 Taškinių mutacijų, įvykusių koduojančiose sekose, pasekmės Mutacijos tipas Mutacija DNR Pavyzdys Nėra Tylinti Misens Nonsens Rėmelio poslinkio Nėra Bazių pakaita Bazių pakaita Bazių pakaita Insercija
  66. 66.  Gamtinėse populiacijose dažniausiai sutinkamas genotipas vadinamas laukinio tipo genotipu  Tiesioginė mutacija keičia laukinio tipo genotipą į naują  Jei mutacija naudinga, naujas genotipas gali būti išsaugotas evoliucijos  Priešingu atveju mutacija greičiausiai bus pašalinta iš populiacijos  Grįžtamoji mutacija turi priešingą poveikį  Ji taip pat vadinama reversija Genų mutacijos ir jų pasekmės genotipui ir fenotipui 7-66
  67. 67.  Mutavę individai dažnai skiriasi savo sugebėjimu išgyventi  Žalingos mutacijos sumažina išgyvenimo tikimybę  Kraštutinis atvejis yra letalios mutacijos  Naudingos mutacijos sustiprina organizmo išgyvenamumą arba jo reprodukcinę sėkmę  Kai kurios mutacijos yra vadinamos sąlyginėmis  Jos veikia fenotipą tik esant tam tikroms sąlygoms  Pavyzdžiui, temperatūrai jautrūs mutantai 7-67 Genų mutacijos ir jų pasekmės genotipui ir fenotipui
  68. 68.  Įvykusi antroji mutacija kartais turi įtakos pirmosios mutacijos fenotipinei ekspresijai  Šios mutacijos vadinamos supresinėmis mutacijomis arba tiesiog supresoriais  Supresoriai skirstomi į dvi grupes  Intrageniniai supresoriai  Antrosios mutacijos vieta yra tame pačiame gene (tačiau ne toje pačioje vietoje!), kur įvyko pirmoji mutacija  Intergeniniai supresoriai  Antrosios mutacijos vieta yra kitame gene 7-68 Genų mutacijos ir jų pasekmės genotipui ir fenotipui
  69. 69. 7-69 Normalu Mutacija Intergeninė supresija
  70. 70.  Mutacijos nekoduojančiose sekose taip pat gali paveikti genų ekspresiją  Mutacija gali pakeisti promotoriaus seką  Mutacijos “į promotorių” padaro promotorių panašesnį į konsenso seką  Tai gali sustiprinti transkripciją  Mutacijos “nuo promotoriaus” mažina promotoriaus sekos panašumą į konsenso seką  Tai gali susilpninti transkripciją  Mutacijos taip pat gali pakeisti splaisingo vietas eukariotų genuose Genų mutacijos nekoduojančiose sekose 7-70
  71. 71.  Keletas žmogaus genetinių ligų atsiranda dėl neįprasto mutacijų tipo, vadinamo trinukleotidų kartotinių sekų ekspansija (TNRE)  Dėl šio reiškinio ilgis sekų, sudarytų iš pasikartojančių 3 nukleotidų, gali keistis iš kartos į kartą  Dėl trinukleotidų ekspansijos atsiranda tokios žmogaus ligos kaip:  Hantingtono liga  Martino-Belo sindromas (lūžiosios X sindromas;FRAXA)  Miotoninė raumenų distrofija Mutacijos dėl kartotinių trinukleotidų sekų 7-71
  72. 72.  Kai kurios chromosomų sritys turi trinukleotidines sekas, išsidėsčiusias tandemiškai  Sveiki individai perduoda nepakitusio ilgio sekas savo palikuonims  Individų, sergančių trinuleotidų ekspansijos ligomis, sekų ilgis viršija tam tikrą kritinę ribą  Jos taip pat gali lengvai pailgėti dar labiau  Tipiškas pavyzdys yra trinukleotido CAG ekspansija 7-72 CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG n = 11 n = 18 Mutacijos dėl kartotinių trinukleotidų sekų
  73. 73.  Kai kada ekspansija vyksta koduojančioje geno sekoje (Hantingtono liga)  Dažniausiai tai būna trinukleotidas CAG (glutaminas)  Todėl koduojamas baltymas turi ilgas glutamino sekas  Tai priverčia baltymus agreguoti  Agregacijos laipsnis koreliuoja su ligos sunkumu  Kitais atvejais ekspansija vyksta nekoduojančiose geno srityse (Martino-Belo sindromas)  Tai sukelia DNR struktūros pokyčius  Dėl šių pokyčių atsiranda ligos simptomai 7-73 Mutacijos dėl kartotinių trinukleotidų sekų
  74. 74.  Trinukleotidų ekspansijos ligos pasižymi dviem neįprastomis savybėmis  1. Šios ligos sunkumas progresuoja iš kartos į kartą  Šis reiškinys vadinamas anticipacija  2. Ligos sunkumas priklauso nuo to, kuris iš tėvų perdavė trinukleotidinių pasikartojimų seką  Hantingtono ligos tikimybė didesnė, jei ji paveldima tėvo linija  Miotoninės raumenų distrofijos tikimybė didesnė, jei paveldima motinos linija 7-74 Mutacijos dėl kartotinių trinukleotidų sekų
  75. 75. Lūžios X chromosomos FMR1 geno transkripcija  Premutacija virsta mutacija, bręstant moteriškoms lytinėms ląstelėms. Ji pasireiškia tik premutaciją turinčių moterų sūnums  Ilgesni nei 200 CGG pasikartojimų ilgio DNR fragmentai yra metilinami. Jei organizme dėl kokių nors priežasčių yra sutrikęs metilinimas, Martino-Belo sindromas nepasireiškia  Geno FMR1 produktas baltymas FMRP nebesintetinamas  FMRP dalyvauja pernešant mRNR į poliribosomas dendrituose, todėl jo trūkumas sukelia neuronų funkcionavimo sutrikimus 7-75
  76. 76.  Oganizmų ląstelės gali būti dviejų tipų:  Generatyvinės ląstelės  Iš jų vystosi gametos, tokios kaip kiaušialąstė ir spermatozoidai  Somatinės ląstelės  Visos likusios ląstelės  Generatyvinės mutacijos tiesiogiai įvyksta kiaušialąstėse ar spermatozoiduose arba šių lytinių ląstelių pirmtakuose  Somatinės mutacijos tiesiogiai įvyksta somatinėse ląstelėse arba jų pirmtakuose Mutacijos gali vykti lytinėse arba somatinėse ląstelėse 7-76
  77. 77. 7-77 Mutacija gali būti perduota sekančioms kartoms Dėmės dydis priklauso nuo mutacijos atsiradimo laiko Kuo anksčiau įvyko mutacija, tuo didesnė dėmė Mutacija negali būti perduota sekančioms kartoms a) Generatyvinė mutacija b) Somatinė mutacija
  78. 78.  Individai, turintys genotipiškai skirtingas somatines sritis yra vadinami genetinėmis mozaikomis 7-78
  79. 79.  Mutacijos gali atsirasti spontaniškai arba būti indukuotos  Spontaninės mutacijos  Atsiranda dėl ląstelinių ar biologinių procesų sutrikimo  Pavyzdžiui, DNR replikacijos klaidos  Indukuotos mutacijos  Sukelia aplinkos veiksniai  Veiksniai, galintys pakeisti DNR struktūrą, yra vadinami mutagenais  Tai gali būti biologiniai, cheminiai arba fiziniai veiksniai 7.4 MUTACIJŲ ATSIRADIMAS IR PRIEŽASTYS 7-79
  80. 80. Mutacijų priežastys 7-80 Mutacijų priežastys Aprašymas Spontaninės mutacijos Nenormali rekombinacija Nenormalus krosingoveris gali sukelti delecijas, duplikacijas, translokacijas ir inversijas Nenormali segregacija Nenormali segregacija gali sukelti aneuploidiją ir poliploidiją DNR replikacijos klaidos DNR polimerazės klaidos gali sukelti taškines mutacijas Toksiški metabolizmo produktai Normalių metabolizmo procesų galutiniai arba tarpiniai produktai gali būti chemiškai aktyvūs junginiai, pažeidžiantys DNR struktūrą Transpozabilūs elementai Gali įsiterpti į geną ir sutrikdyti jo veiklą Depurininimas Retkarčiais gali nutrūkti ryšys tarp purino ir dezoksiribozės Deamininimas Citozinas ir 5-metilcitozinas gali būti deamininami ir virsti į uracilą ar timiną Tautomeriniai virsmai Spontaniniai bazių struktūros pokyčiai gali sukelti mutacijas, jei jie įvyksta prieš pat DNR replikaciją Indukuotos mutacijos Cheminiai veiksniai Cheminės medžiagos gali pakeisti DNR struktūrą Fiziniai veiksniai UV šviesa ir rentgeno spinduliai gali pažeisti DNR struktūrą
  81. 81.  Mutavimo greitis yra tikimybė, kad gene įvyks nauja mutacija  Jo dažniausia išraiška yra naujų mutacijų skaičius, įvykęs tiriamame gene per vieną generaciją  Mutavimo greičio skaitinė išraiška paprastai būna nuo 10-5 iki 10-9 per vieną generaciją  Tiriamojo geno mutavimo greitis nėra pastovus dydis  Jis gali padidėti, jei aplinkoje yra mutagenų  Skirtingų rūšių ar net skirtingų tos pačios rūšies linijų mutavimo greitis gali gana žymiai skirtis Mutavimo greitis ir mutacijų dažnis 7-81
  82. 82.  Net to paties individo skirtingų genų mutavimo greitis gali būti skirtingas  Kai kurie genai yra didesni už kitus  Tai padidina mutacijos tikimybę  Kai kurie genai yra taip išsidėstę chromosomose, kad tampa jautresni mutacijoms  Jie yra vadinami karštaisiais taškais (hot spots)  Karštieji taškai taip pat gali būti randami ir geno viduje  Gene aptinkamos tam tikros sritys, kuriose mutacijos vyksta žymiai dažniau, nei kitose srityse Mutavimo greitis ir mutacijų dažnis 7-82
  83. 83. 7-83 Daug mutacijų vyksta tiksliai toje pačioje geno vietoje
  84. 84.  Geno mutacijų dažnis yra nustatomas mutavusių genų skaičių padalinus iš bendro genų skaičiaus populiacijoje  Jei 1 milijonas bakterijų buvo išsėta ir tarp jų nustatyta 10 mutantų, tada  mutacijų dažnis yra 1 iš 100,000 arba 10-5  Mutacijų dažnis priklauso ne tik nuo mutavimo greičio, bet ir nuo  Mutacijų pasireiškimo laiko  Tikimybės, kad mutacija bus perduota sekančioms kartoms Mutavimo greitis ir mutacijų dažnis 7-84
  85. 85.  Spontaninės mutacijos atsiranda dėl trijų tipų cheminių pokyčių  1. Depurininimo  2. Deamininimo  3. Tautomerinių virsmų Spontaninių mutacijų priežastys 7-85 Dažniausias pokytis
  86. 86.  Depurininimas yra purinų (guanino ir adenino) pašalinimas iš DNR  Kovalentinės jungtys tarp dezoksiribozės ir purino yra kiek nestabilios  Kartais įvyksta spontaninė reakcija su vandeniu, dėl kurios bazė atkabinama nuo cukraus  Susidaro apurininis saitas (vieta)  Apurininiai saitai gali būti reparuojami  Tačiau jei reparacijos sitema nesuveikia, vykstant replikacijai gali susidaryti mutacija 7-86 Spontaninių mutacijų priežastys
  87. 87. 7-87 Spontaninis depurininimas a) Depurininimas b) Apurininio saito replikacija Depurininimas Apurininis saitas DNR replikacija X gali būti A, T, G ar C Trys iš keturių (A, T ir G) yra neteisingi nukleotidai Todėl mutacijos tikimybė yra 75%
  88. 88.  Deamininimas yra aminogrupės pašalinimas iš citozino  Kitos bazės nėra lengvai deamininamos 7-88  DNR reparacijos fermentai gali atpažinti uracilą kaip netinkamą DNR bazę ir jį pašalinti  Tačiau jei reparacijos sitema nesuveikia, po replikacijos į vyksta mutacija, kurios metu C-G virsta į A-T Citozino deamininimas
  89. 89.  Taip pat gali vykti 5-metilcitozino deamininimas 7-89  Timinas yra normalus DNR komponentas  Tai sukelia problemų reparacijos fermentams  Jie negali nustatyti, kuri iš dviejų bazių, esančių dviejose DNR grandinėse, yra klaidinga  Todėl metilintas citozinas yra mutacijų atsiradimo karštasis taškas 5-metilcitozino deamininimas
  90. 90.  Tautomeriniai virsmai yra laikinas bazių struktūros pokytis  Įprastinė, stabili timino ir guanino yra ketoninė forma  Nedidelis T ir G bazių kiekis gali virsti enoline forma  Įprastinė, stabili adenino ir citozino yra amino forma  Nedidelis A ir C bazių kiekis gali virsti imino forma  Šios retos formos skatina AC ir GT bazių porų susidarymą  Tautomeriniai virsmai sukelia mutacijas tada, kai įvyksta prieš pat DNR replikaciją 7-90
  91. 91. 7-91 RetaĮprasta
  92. 92. 7-92 Klaidingas bazių poravimasis dėl tautomerinių virsmų
  93. 93. 7-93 Laikinas tautomerinis virsmas Grįžęs atgal į normalią formą Tautomeriniai virsmai ir replikacija sukelia mutacijas Iki replikacijos vyksta adenino tautomerinis virsmas Poravimosi klaida Vyksta antroji DNR replikacija DNR molekulės, randamos 4 dukterinėse ląstelėse Mutacija
  94. 94.  Daugelis veiksnių gali veikti kaip mutagenai, negrįžtamai pakeičiantys DNR struktūrą  Mutagenai kelia problemų dėl dviejų pagrindinių priežasčių:  1. Mutagenai dažnai dalyvauja išsivystant žmogaus onkologinėms ligoms  2. Mutagenai gali sukelti genų mutacijas, kurios gali būti žalingos sekančioms organizmų kartoms  Mutageniški veiksniai dažnai klasifikuojami kaip cheminiai arba fiziniai mutagenai  Kai kurie biologiniai veiksniai taip pat gali sukelti mutacijas 7-94 Mutagenų tipai
  95. 95. Mutagenų pavyzdžiai 7-95 Mutagenai Poveikis DNR struktūrai Cheminiai mutagenai Nitritinė rūgštis Deaminina bazes Hidroksilaminas Hidroksilina citoziną Azoto ipritas Alkilina bazes Etilmetansulfonatas Alkilina bazes Proflavinas Įsiterpia (interkaliuoja) į DNR grandinę 5-bromuracilas Bazės analogas (įsijungia į DNR vietoje timino) 2-aminopurinas Bazės analogas (įsijungia į DNR vietoje purino) Fiziniai mutagenai UV šviesa Skatina timino dimerų susiformavimą Rentgeno spinduliai Sukelia bazių iškritas, DNR grandinių trūkius, sąsiuvas ir chromosomų trūkius
  96. 96.  Cheminiai mutagenai skirstomi į tris pagrindines grupes  1. Bazių modifikatoriai  2. Bazių analogai  3. Interkaliuojantys junginiai 7-96 Mutagenai pažeidžia DNR struktūrą skirtingais būdais
  97. 97.  Bazių modifikatoriai kovalentiškai modifikuoja nukleotido struktūrą  Pavyzdžiui, nitritinė rūgštis pakeičia amino grupes keto grupėmis (–NH2 į =O)  Tai gali paversti citoziną į uracilą, o adeniną į hipoksantiną  Tokios modifikuotos bazės poruojasi su kitokiais nukleotidais, nei nemodifikuotos  Kai kurie cheminiai mutagenai suardo taisyklingas poras alkilindami bazes, esančias DNR struktūroje  Pavyzdžiai: Azoto ipritas ir etilmetansulfonatas (EMS) 7-97
  98. 98. 7-98 Šis klaidingas poravimasis gali sukelti mutacijas naujose grandinėse po replikacijos Modifikuotų bazių netaisyklingas poravimasis Matricinė grandinė Po replikacijos
  99. 99.  Interkaliuojantys junginiai turi plokščias planarines struktūras, kurios geba įsiterpti į dvigubą DNR spiralę  Tai pažeidžia spiralės struktūrą  Kai DNR, turinti šiuos įsiterpusius mutagenus, replikuojasi, dukterinėje grandinėje gali susidaryti vieno nukleotido intarpai arba iškritos  Pavyzdžiai:  Akridino dažai  Proflavinas 7-99
  100. 100.  Bazių analogai įsijungia į dukterinę DNR grandinę replikacijos metu  Pavyzdžiui, 5-bromuracilas yra timino analogas  Jis gali būti įjungtas į DNR vietoje timino 7-100 Normali pora Šis tautomerinis virsmas vyksta gana dažnai Klaidingas poravimasis 5-BU poravimasis su adeninu arba guaninu
  101. 101. 7-101 5-bromuracilas gali paskatinti AT bazių porą virsti GC bazių pora Mutacijų susidarymas replikacijos metu dėl įjungiamo 5-bromuracilo
  102. 102.  Fiziniai mutagenai būna dviejų pagrindinių tipų  1. Jonizuojanti radiacija  2. Nejonizuojanti radiacija  Jonizuojanti radiacija  Rentgeno ir gama spinduliai  Pasižymi trumpu bangos ilgiu ir didele energija  Gali gilia įsiskverbti į biologines molekules  Sukuria chemiškai aktyvias molekules, vadinamas laisvaisiais radikalais  Gali sukelti  Bazių delecijas  DNR grandinių trūkius  Sąsiuvas  Chromosomų trūkius 7-102
  103. 103. 7-103  Nejonizuojanti radiacija  UV šviesa  Turi mažiau energijos  Negali giliai prasiskverbti į biologines molekules  Formuoja susiūtus timino dimerus  Timino dimerai gali sukelti mutacijas kai vyksta DNR replikacija
  104. 104.  Mutageniškumui įvertinti yra naudojama daug įvairių testų  Vienas dažniausiai naudojamų yra Eimso testas  Metodą sukūrė Briusas Eimsas (Bruce Ames)  Naudojamas Salmonella typhimurium kamienas, nesugebantis sintetinti histidino  Šios bakterijos turi mutaciją gene, dalyvaujančiame histidino biosintezėje. Todėl jos negali augti mitybinėje terpėje, kurioje nėra histidino  Įvykusi kita mutacija (t.y. reversija) atstato gebėjimą sintetinti histidiną. Tokios bakterijos sugeba augti terpėje be histidino  Eimso testu nustatomas mutantų kiekis, susiformavęs Petri lėkštelėje, kurioje auga paveiktos tiriamąja medžiaga bakterijos 7-104 Tyrimai gali nustatyti, ar medžiaga yra mutagenas
  105. 105. 7-105 Eimso mutageniškumo tyrimo testas Fermentų, galinčių metabolizuoti mutageną, šaltinis Kontrolinė lėkštelė rodo, kad spontaninių mutacijų dažnis yra žemasDidelis kolonijų kiekis rodo, kad tiriama medžiaga gali būti mutagenas
  106. 106. 7-106

×