Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Sinteza proteina

13,180 views

Published on

  • Login to see the comments

  • Be the first to like this

Sinteza proteina

  1. 1. SINTEZA PROTEINA
  2. 2. SINTEZA PROTEINA <ul><li>GRIFFIT-OV POKUS </li></ul><ul><li>Žive nepatogene bakterije transformira neka tvar iz mrtvih bakterija </li></ul><ul><li>Avery –utvrdio da je ta tvar DNA </li></ul>
  3. 3. SINTEZA PROTEINA <ul><li>Odvija se kroz dva procesa </li></ul><ul><li>transkripcija </li></ul><ul><li>translacija </li></ul><ul><li>rezultira nastankom proteina </li></ul>
  4. 5. Transkripcija – prepisivanje DNA u RNA <ul><li>enzim RNA polimeraza </li></ul><ul><li>sinteza teče uvijek u smjeru 5'-3' </li></ul><ul><li>enzim RNA polimeraza prepisuje gene čija se RNA prenosi u citoplazmu i prevodi na ribosomima pri sintezi proteina – </li></ul><ul><li>nastaje (mRNA) </li></ul>
  5. 6. Translacija <ul><li>mehanizam kojim se transkript mRNA prevodi u točnu proteinsku sekvenciju (njezin protein) </li></ul><ul><li>tRNA + aminokiselina = aminoacil tRNA </li></ul>
  6. 8. značenje kodona
  7. 10. <ul><li>Što je to GENETIČKA UPUTA? </li></ul><ul><li>INTRONI? </li></ul><ul><li>UKOSNICA </li></ul><ul><li>BINONIMI </li></ul><ul><li>Značenje kodona? </li></ul><ul><li>Translacija </li></ul><ul><li>Transkripcija? </li></ul><ul><li>3´ -ATGTTTGGAATTGGAG -5´ </li></ul>
  8. 11. <ul><li>5´- GCCGUACGGACCGAUACCAAUCGGUCUAGA - 3´ </li></ul><ul><li>3´- GGGTACAGACCGACCGACTGTTCTGACTGGTCCA - 5´ </li></ul>

×