Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

CDAC 2018 Cantor liquid biopsies

21 views

Published on

Presentation at the CDAC 2018 Workshop and School on Cancer Development and Complexity
http://cdac2018.lakecomoschool.org

Published in: Health & Medicine
  • Be the first to comment

  • Be the first to like this

CDAC 2018 Cantor liquid biopsies

  1. 1. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. The challenge of early cancer detection by liquid biopsy Charles R. Cantor Como, May 2018
  2. 2. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential.  Why early cancer detection is necessary  DNA in plasma  NIPT as a proof of concept  Somatic mutation detection in tumor biopsies versus plasma or urine  Stochastic noise and how to overcome it  Prospects for pre-symptomatic detection 2 Outline
  3. 3. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential.  Annual routine inexpensive test from blood, urine, or a buccal swab  Must be inexpensive; good specificity and sensitivity- i.e. few false positives and false negatives  Positives must be actionable- must reflex to an established diagnostic test 3 Cancer screening in 2025
  4. 4. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential.  Later stage tumors are extremely heterogeneous  Genome instability- mutator phenotype, chromosome instability, massive epigenetic alterations and probably epigenetic instability  Inexpensive cures are unlikely to be achievable; therapy to combat disease progression is extremely expensive 4 Why early detection is necessary
  5. 5. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential.  Tumors very small and are likely to be very similar to normal tissue  Tumor-specific biomarkers will be present at very low abundance in any sample that can be obtained without biopsy  Cost must be low  Clinical trials are prohibitively expensive 5 Major challenges for early cancer screening
  6. 6. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential.  PCR and other amplification systems allow robust detection of single molecules  All aspects of sample preparation, amplification and detection are generic  Analysis is pretty cheap  Multiplexing- it is routine to measure from tens to thousands of analytes at once 6 Nucleic acids are the best biomarkers
  7. 7. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential.  Sequences changes - definitively identify a cancer and its drug sensitivity but are hard to measure for early disease  Chromosome copy number changes - easy to measure but likely absent in early disease  Gene copy number changes - probably not common many early cancers  Methylation changes – interesting target! 7 Prioritizing biomarkers for early cancer detection
  8. 8. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Cell free DNA in plasma or urine A mature commercial technique for non invasive prenatal testing Proven utility for monitoring transplant rejection Very promising for monitoring cancer therapy and relapse Possible utility in neurodegenerative diseases Pre-symptomatic detection remains a future challenge
  9. 9. Characteristics of cell-free DNA in plasma (half life 15 minutes) • Amounts: • Cellular DNA about 100 million molecules per ml • Cell-free DNA 1,000 molecules per ml • DNA from remote sites 100 molecules per ml • Sizes: • DNA from blood and endothelial cells about 160 base pairs • DNA from remote sites about 145 base pairs • Endosomes with DNA from distant sources about 10 molecules per ml • Cells from distant sources about 1 molecule per ml 9
  10. 10. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential.  Draw 10 cc of maternal blood; isolate 4 cc of plasma  Random shotgun sequence and assign sequences by comparing with an assembled human sequence  Ignore any sequence reads which cannot be aligned to reference, ignore most or all sequence differences from reference Procedure for non-invasive prenatal testing by analyzing fetal DNA in the mother’s blood 10
  11. 11. Principles of Fetal Aneuploidy Testing  ~13% of the DNA fragments in pregnant woman’s blood are from the fetus ( )  ~87% are from the mother ( ) 18
  12. 12. GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 Principles of Fetal Aneuploidy Testing GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21 GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 Sequencing tells you which chromosome the fragment comes from. TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y 19
  13. 13. Unaffected Chromosome 21 on left (2 fragments) Affected Chromosome 21 on right (3 fragments) Unaffected Fetus Fetus with Trisomy 21 Each fragment is “x” thousands of counts. 20 Detecting a trisomy
  14. 14. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Sequenom CMM Laboratory Cases, Through March 2013 Bombard et al. Noninvasive prenatal testing (NIPT) in multiple gestations: A report of laboratory experience. American College of Medical Genetics Annual Meeting. Poster. New Orleans, LA May 2013 14 | SCMM Slide CC-008
  15. 15. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Reasons for NIPT Discrepancies  Confined placental mosaicism (CPM)  Co-twin demise/vanishing twin  Fetal mosaicism  Maternal mosaicism  Maternal malignancy  Laboratory error  Other 15 | SCMM Slide CC-008
  16. 16. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Oncology – Circulating Tumor DNA Case 1  Clinical indication – AMA – Fetal fraction 48% – Z21 3.15 – Z13 -10.68 – Z18 -39.70 Diagnosed 2 weeks post partum with metastatic carcinoma. 16 | SCMM Slide CC-008
  17. 17. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Oncology – Circulating Tumor DNA Case 2  Clinical indication – AMA – Fetal fraction 22% – Z21 -11.62 – Z13 -15.83 – Z18 48.44  Second aliquot • Z21 -10.36 • Z13 -14.25 • Z18 46.75 Invasive angiosarcoma 17 | SCMM Slide CC-008
  18. 18. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. MaterniT21TM PLUS LDT: Fetal Insertion – 18p+ Sequenom CMM – unpublished data Information presented September 22, 2012; ACOG Districts VI, VIII, IX Annual Meeting; Phoenix, AZ 18 | SCMM Slide CC-008
  19. 19. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Preferential detection of methylated DNAof Methylation Reaction Step 3: Competitive PCR and and single base extension Step 1: CCF DNA isolation Step 2: DNA digestion using methylation sensitive RE D C Step4: Separation of analytes using MassArray® Unmethylated maternal DNA Methylated fetal DNA (D) 19
  20. 20. Example a single methylation marker • Very low background in non pregnant samples. • Accurately identifies fetal DNA percentage. • Assay can identify sample with no fetal DNA contribution. Nygren et al Clin. Chem. 56:10 1627-1636 (2010) 20
  21. 21. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Chromosome 21 Z score per Plate and Complete Study results: epigenetic testing 21
  22. 22. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential.  We consider only bi-allelic single nucleotide polymorphisms  No tri-allelic loci, no insertions, deletions  Focus just on sequence differences from the reference loci  Mendelian inheritance provides relationship between fetus and parents  No de novo mutations considered 22 A simple model for fetal sequencing
  23. 23. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential.  Fraction fetal DNA , f, known or determined by fitting data  Sequence read depth is high- typically 100 x coverage  For simplicity we consider just A/C SNPs. All are equivalent 23 Fetal genome sequencing
  24. 24. Fetal DNA % Calculated for Each Chromosome 24 | Improving healthcare through revolutionary genetic analysis solutions
  25. 25. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Types of SNPs Considered SNP Category Parental Genomic DNA Analysis Paternal Maternal Genotype Genotype Fetal Genotypes Possible 1. A/A C/C AC 2. A/A A/A AA 3. A/C A/A AA or AC 4. A/A A/C AA or AC 5. A/C A/C AA or AC or CC 25 | Improving healthcare through revolutionary genetic analysis solutions
  26. 26. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential.  Mother AA Father AC  Fetus AA  Allele frequencies A = 1 C = 0 Or Fetus AC Allele frequencies A = 1 – f/2 C = f/2 Thus from allele frequencies you know fetal sequence at this location 26 Type 3 SNP’s
  27. 27. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential.  Mother is AC Father is AA  Fetus is AC Allele frequencies A = 0.5 C = 0.5 Or Fetus is AA Allele frequencies A = 0.5 + f/2 C = 0.5 – f/2 Allele frequencies reveal fetal sequence 27 Type 4 SNP’s
  28. 28. 28 Typical error rate of around 0.1% leads to false positives for all sequence loci, and caps the minimum allele frequency detectable at 0.1% To detect low allele frequencies require very high sequence coverage To detect alleles at less than 1% requires “error free” double strand sequencing which is still quite expensive Sequencing will discover variants of unknown significance- what do you tell the patient? Limitations of DNA sequencing as a clinical diagnostic tool
  29. 29. 29  Digital (droplet) PCR (Raindance, Biorad, Fluidigm, Beaming)  Single molecule sorting (Nanostream)  DNA mass spectrometry (Sequenom, now Agena)  Compare sensitivity, cost, flexibility, chances to create custom assays, degree of target multiplexing Genotyping – determining SNP’s Techniques of intermediate complexity
  30. 30. 30 DNA mass spectrometry • PCR amplify 10 to 40 loci in a single microtitre plate well • Simultaneously sequence polymorphic loci within these amplicons • Results are much more sensitive, quantitative, and cost effective than real time PCR alone • Requires sequence to be approximately known in advance
  31. 31. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Genotyping by mass spectrometry 31 PCR and primer extension DNA consists of a four- letter alphabet: A, C, G, T Each letter (nucleotide) has defined molecular mass: dAMP = 313.2 Da dCMP = 289.2 Da dGMP = 329.2 Da dTMP = 304.2 Da
  32. 32. Haplotype Analysis with Multiplexed Genotyping of Single DNA Molecules Dilution5 ng Genomic DNA ~1600 copies 3 pg Genomic DNA ~1 copy A/C C/GG/A SNP1 SNP2 SNP3 Each SNP is genotyped, but phase of SNPs is not determined. A CG Dilution into single molecule physically separates two haplotypes and simultaneous genotyping of all three SNPs with multiplex assay directly determines the haplotype Chunming Ding Bioinformatics Program and Center for Advanced Biotechnology Boston University
  33. 33. Confidential, Do Not Distribute Routine Genotyping and Single Molecule Genotyping 5 ng Genomic DNA ~1600 copies 3 pg Genomic DNA ~1 copy Note: 3-plex PCR. P: unextended primer, A/G/C: individual genotype 3 different colors represent the 3 different assays in the 3-plex. ………………………………… ……. Note: 3-plex PCR. P: unextended primer, A/G/C: individual genotype. 3 different colors represent the 3 different assays in the 3-plex. Routine Genotyping and Single Molecular Genotyping
  34. 34. Confidential, Do Not Distribute 0 10 20 30 40 50 60 Incomplete multiplex Both Alleles Haplotype Percentage Percentage No PCR product 1 DNA copy 1.6 DNA copies 3 DNA copies Performance with Different Genomic Concentrations
  35. 35. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential.  Need to search for somatic (de novo) mutations not present in normal tissue  These mutations are difficult to distinguish from sequencing errors- Mendelian inheritance doesn’t help you  Heterogeneity: you cannot tell which mutations arose in the same cell  Allele frequencies may be much smaller 35 Plasma DNA: Cancer is harder than fetus
  36. 36. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Biopsy Somatic Mutation Analysis 36 MassSpectra for a PIK3CA somatic mutation  Used OncoCarta to screen primary and metastatic colorectal cancer samples  Created a subpanel of assays specific to colorectal cancer mutations  Achieved 5-10% sensitivity of mutant detection within normal background in FFPE tissue  Data example shown: – 4.8% PIK3CA mutation A rapid, sensitive, reproducible and cost-effective method for mutation profiling of colon cancer and metastatic lymph nodes Fumagalli et al., 2010, BMC Cancer; 10(101)
  37. 37. 37 Lung adenocarcinoma testing paradigm Image based on Horn L and Pao W: EML4-ALK: Honing in on a new target in non-small-cell lung cancer. J Clin Oncol 27:4232-4235, 2009 Test for KRAS Mutations Cytotoxic Chemotherapy (15-30%) Test for EGFR Mutations Test for EML4-ALK translocation Test for other Mutations ?* EGFR Tyrosine Kinase Inhibitor (10%) ALK Kinase Inhibitor (5-10%)- + - + - + Test for acquired resistance (eg. EGFR_T790M) (*) “Other” includes BRAF, MEK1, AKT1, PIK3CA, DDR2……and/or intensive research to identify new driver mutations
  38. 38. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Patient 6 – Complete Metabolic Response 1.9 0.6 0 0.2 0.10 0 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2 7/30/14 8/29/14 9/28/14 10/28/14 KRAS G12D - Frequency (%) NRAS G12AV - Frequency (%)
  39. 39. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Copyright©2015 39 1Husain et al., ELCC 2015 0 10 20 30 40 50 60 70 80 0 50 100 150 200 250 10/20/2014 10/27/2014 11/3/2014 11/10/2014 11/17/2014 11/24/2014 12/1/2014 12/8/2014 12/15/2014 12/22/2014 12/29/2014 1/5/2015 1/12/2015 1/19/2015 UrineEGFRCopies/100KGE T790M Ex19 del Size on CT scan SumofLongestDiameters(mm) Week 1 on drug 6 wks CT scan 12 wks CT scan Oncogene mutations in urine following therapy against EGFR T790M resistant lung cancer (Slide from Trovagene)
  40. 40. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. UltraSEEK™ Oncogene Panel  55 samples contained the expected mutation – 46 samples (3/3 replicates positive) – 5 samples (2/3 replicates positive) – 3 samples (1/3 replicates positive)  68 samples were negative – 67 samples (3/3 replicates negative) – 1 failed sample (degraded plasma DNA) 40 Feasibility study with cell free DNA
  41. 41. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. UltraSEEK™ Oncogene Panel 41 Feasibility study with cell free DNA
  42. 42. 42 • If you have less than a few hundred molecules of analyte: • Impossible to quantify abundance precisely • May miss a rare sequence altogether • Sample handling must compulsively try to not lose any of the analyte • Critical to have a way to qualify samples: e.g. leave in a little detection of wild type allele Stochastic noise is a major complication in the measurement of rare biomarkers FALSE NEGATIVES
  43. 43. 43 • Repeat individual measurements – but impossible if each measurement consumes all of a 10 ml blood sample • Combine results from different but biologically equivalent markers Can we overcome stochastic noise?
  44. 44. Sensitivity Enhancement by Fragmentation (SEF) Application of SEF to a typical nucleic acid assay Preparation of target nucleic acid molecules for analysis (such as extraction of DNA or RNA, removal of other materials, and conversion of RNA to DNA) Amplification of target nucleic acid molecules or their segments Detection of many different amplified nucleic acid molecules or their segments ( many amplicons) Fragmentation of target nucleic acid molecules
  45. 45. Application of SEF to Digital PCR Target nucleic acid molecule Digital PCR Fragmentation Digital PCR Target-derived fragments
  46. 46. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. 46 Detection rate per assay using 24 replicates
  47. 47. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. Pre-symptomatic plasma DNA testing  There are not enough molecules of any single DNA sequence to see in 10 ml of blood  Must aggregate results from large numbers of different DNA sequences  Or find a way to perturb the patient to increase the number of molecules of a single DNA sequence or switch to RNA or proteins
  48. 48. Hierarchical clustering based on methylation profiles identifies tissue specific sample groups. 66 cell lines (vertical) versus meCpG sites (horizontal) Methylation of 12,000 sites in genes relevant to cancer 48
  49. 49. Multiplex DNA methylation markers in plasma  Single tube qPCR assay – robustly detect 0.02% ctDNA in total cell-free DNA – Multiple cancer specific methylation markers – Internal control Methylation Level (One Way ANOVA) I II III IV -10 -5 0 5 10 15 *** (p = 0.0003) CRC Stage Mean_ΔCq Methylation Level (One Way ANOVA) Healthy BenignPolyp dvancedAdenoma CRC -10 -5 0 5 10 15 *** (p < 0.0001) Mean_ΔCq NormalBenign polypAdv. Ad CRC ΔCt = Ct(Internal control) – Ct(multiplex markers) Higher ΔCt means stronger cancer-specific signal
  50. 50. Improved sample preparation may be the answer  Can you recover more DNA molecules from plasma  Are some cancer DNA sequences over- represented in plasma for whatever reason  Is it time to revisit using plasma RNA or proteins instead of plasma DNA 50
  51. 51. Total circulating free DNA (cfDNA, average size ~176bp) in human peripheral blood plasma was enriched with the Apostle MiniMax technology (red), compared with a major current technology (blue). The enriched samples were characterized by Bioanalyzer 2100 and HS Kit (Agilent). Apostle MiniMaxTM technology – performance of total cfDNA isolation
  52. 52. © 2015 Agena Bioscience. All Rights Reserved. For Research Use Only. Not for use in diagnostic procedures. Confidential. 52 ..Thanks for your attention…

×