cisgenesis and intragenesis

1. 5/22/2015 1MAHESH R HAMPANNAVAR MAHESH R HAMPANNAVAR Genetics and Plant breeding mahi5295@gmail.com

2. 2 Farmers fate , hungers and malnutrition are barriers in developing nations 5/22/2015 MAHESH R HAMPANNAVAR

3. 3 Breeder who facing failure to come up with potential variety 5/22/2015 MAHESH R HAMPANNAVAR

4. 4 Respect the nature Nature for our desire not for grid ……… 5/22/2015 MAHESH R HAMPANNAVAR

5. 55/22/2015 MAHESH R HAMPANNAVAR

6. Sisters in Innovative Plant Breeding Cisgenesis and Intragenesis; 65/22/2015 MAHESH R HAMPANNAVAR

7. Contents  Introduction  Definition  Pre-requisite for cis/intragenesis  Case study  Comparison  Bio-safety measures  Potential and disadvantage  Conclusion 75/22/2015 MAHESH R HAMPANNAVAR

8. • Environmentally sound and efficient production method • Exclusive use genetic material from same species or related species why it require? 85/22/2015 MAHESH R HAMPANNAVAR

9. CISGENIC Schouten et al. (2006) “A cisgenic is a crop plant that has been genetically modified with one or more genes isolated from crop plant” What is definition? 95/22/2015 MAHESH R HAMPANNAVAR

10. the intragenic concept as the isolation of specific genetic elements from a plant, recombination of these elements in vitro and insertion of the resulting expression cassettes into a plant belonging to the same sexual compatibility group INTRAGENIC Rommens et.al.(2004)105/22/2015 MAHESH R HAMPANNAVAR

12. (i). One or more identical copy of the endogenous gene including its promoter, introns and the terminator. (ii). No in vitro rearrangements cisgenic can harbour- What it contain ? 125/22/2015 MAHESH R HAMPANNAVAR

13. (i). Combination of genetic elements from sexually compatible gene pool.(ii). Coding regions of 1 gene can combine with the promoters and terminators from different genes of the sexually compatible gene pool. (iii). T-DNA border sequences for Agrobacterium mediated transformation isolated from sexually compatible DNA pool known as P- Borders. Intragenic can harbour- 135/22/2015 MAHESH R HAMPANNAVAR

14. . cisgenesis intragenesis Within species or related spice Intragesis P-DNA boarders In vitro rearrangement Cisgenesis No strictly use P-DNA Native form of gene induce What is similarities and difference? 145/22/2015 MAHESH R HAMPANNAVAR

15. Variations in definitions of coding-, regulatory-, border- and vector-backbone-sequences used for intragenesis and cisgenesis 155/22/2015 MAHESH R HAMPANNAVAR

16. What is Sources of genes ? l Tertiary gene pool Secondary gene pool Primary gene pool Breeder gene pool Quater nary gene pool 165/22/2015 MAHESH R HAMPANNAVAR

17. What are all Pre requisites of cis/intragenic plant? • Sequence information of plant • The isolation and characterization of gene of interest from crossable relatives • Transformation technique • Marker free transformation • Intragenic vectors development 175/22/2015 MAHESH R HAMPANNAVAR

18. Web site address for data base info.. • Database integrating genotypic and phenotypic data useful to finding candidate genomic regions involved in agronomic traits of interest Crop plant world wide web address Grass http://www.gramene.org/qtl/index.html Grape http://www.vitaceae.org Tomato http://164.107.85.47:8004/cgi-bin/_information.pl http://zamir.sgn.cornell.edu/Qtl/Html/home.htm Potato http://www.scri.ac.uk/research/genetics/GeneticsAndBreeding/p otatoes/mappingqtls Cucurbitaceous www.icugi.org Rosaceous http://www.bioinfo.wsu.edu/gdr/ Various http://www.phenome-networks.com/ 185/22/2015 MAHESH R HAMPANNAVAR

19. General scheme for the selection, confirmation and introduction of alleles from the breeder’s gene pool • QTL mapping • Fine mapping • LD mapping • Transient Assays(VIGS) • New alleles TILLING/eco • Translational genomics • Phenomics • synteny QTL maps • BIBAC libraries • transformation large fragment • Validation of standard transfer Confirm gene of interest 195/22/2015 MAHESH R HAMPANNAVAR

20. Table . Examples of Traits That Can Be Incorporated into a Plant by either Transferring or Modifying the Expression of Native Genes (Rommens, 2004) 205/22/2015 MAHESH R HAMPANNAVAR

21. Table . Examples of currently available native traits (Rommens, 2004)215/22/2015 MAHESH R HAMPANNAVAR

22. Transformational technique 225/22/2015 MAHESH R HAMPANNAVAR

23. Methods to produce the marker free cis/intrage nesis plant Co- transformation Site-specific recombinase- mediated marker Transposaon- based expelling systems Intrachromoso mal recombination based excision Transformation without marker 235/22/2015 MAHESH R HAMPANNAVAR

24. Co-transformation Borys Chong.et.al 245/22/2015 MAHESH R HAMPANNAVAR

25. Site-specific recombinase-mediated marker Targeted site Recombinase source lox Cre Bacteriophase P1 FTR FLP Saccharomyces cerevisiae RS RS Zygosaccharomyces rouxii Excised and lost Borys Chong.et.al 255/22/2015 MAHESH R HAMPANNAVAR

26. Transposon-based expelling systems Borys Chong.et.al265/22/2015 MAHESH R HAMPANNAVAR

27. Methods used to produce marker-free intragenic/cisgenic plants 275/22/2015 MAHESH R HAMPANNAVAR

28. Development of Intragenic vector • Intragenic vector system is an extension of the minimal T-DNA vector system. Plasmid 285/22/2015 MAHESH R HAMPANNAVAR

29. Intragenic vector a plant derived T- DNA like region that should contain 2 or at least 1 T-DNA border like sequences in the correct orientation. an origin of replication(ori) a selectable antibiotic gene segment 295/22/2015 MAHESH R HAMPANNAVAR

30. The P-DNA Approach • Rommens et al. in 2004. • A series of border specific degenerate primers, putative P-DNA’s were isolated from pooled DNA’s of 66 genetically diverse potato accessions by PCR. • The amplified fragment were sequenced. • And this information was used for inverse PCR with nested primers to determine the sequence of the border like regions. • This information allowed the identification of sequences with sufficient similarity to Agrobacterium T-DNA border sequences. 305/22/2015 MAHESH R HAMPANNAVAR

31. A T-DNA-like region assembled from Petunia hybrida (petunia) ESTs Source-Euphytica (2007) 154:341–353 315/22/2015 MAHESH R HAMPANNAVAR

32. • may horizontal gene transfer from bacteria • T-DNA border-like sequences – rice, tomato, potato, Arabidopsis • Replace - T-DNA for transformation 325/22/2015 MAHESH R HAMPANNAVAR

33. Disadvantages P-DNA • Found in some species only. • P-DNA • Probability of finding such features on a single relatively short fragment in a plant genome is extremely small. • Reduced frequencies of gene transfer.(Rommens et al.2005) Left boarder 1-2 kb apart / Restriction sites Right boarders 335/22/2015 MAHESH R HAMPANNAVAR

34. Origin of replication • The smallest known prokaryotic origins of replication are the 32-33bp • Helper plasmid-provide specific factor for replication . • The Col E- characterized by 2 direct repeat sequences of 7- 9bp separated by 5-8bp. • BLAST searches of plant ESTs with sequences similar to ColE2 or ColE3 identified in numerous species Bacteria Plasmid Ori of replication E.coli Colicin E2 ColE2 Shigella sp. Colicin E3 ColE3 345/22/2015 MAHESH R HAMPANNAVAR

35. Selectable Marker • Derived from plant sequences. • Mutant forms of the endogenous genes specific herbicides resistance. • Over expression of the endogenous Atwbc19 ABC transporter gene confers kanamycin resistance (Mentewab and Stewart 2005). • For easy to transform crops such as potato, selectable marker genes are unnecessary (de Vetten et al.2003) 355/22/2015 MAHESH R HAMPANNAVAR

36. Considerations for Proper Design of Intragenic Vectors • T-DNA not from regulatory(promoter) elements of plants • The DNA fragment should not derived from heterochromatic region. • Significant length of 1-2kb of intragenic DNA occurs outside the left border. • Small number of DNA fragments 365/22/2015 MAHESH R HAMPANNAVAR

38. •Improve the existing varieties with disease resistance •Stacking of multiple R genes – broad spectrum resistance 385/22/2015 MAHESH R HAMPANNAVAR

39. Materials and Methods • Plant materials • Potato varieties –Atlantic , Bintje , potae9 • Five Phytophthora infestans isolates and late blight resistance test IPO-C 90128 EC1 Pic99189 DHD11 European American Korean 395/22/2015 MAHESH R HAMPANNAVAR

40. Vector construction- • Resistance governing genes i. Rpi-vnt 1.1- S . venturii ii. Rpi-sto 1 - S. stoniliferum • pBINPLUS – binary vector • pBINAW2- modified form of pBINPLUS 405/22/2015 MAHESH R HAMPANNAVAR

42. Potato transformation Explants – 4 week-old in vitro grown plants Pre cultured on R3B medium supplemented with PACM- for two days Explants were inoculated with agrobacterium strain AGL1+VirG+Binary plasmid –Two days Explants transferred to GCVK medium for shoot regeneration Shoot were transferred to CK medium for root regeneration Three week later rooted plantlets were analyzed through PCR for desired R Gene 425/22/2015 MAHESH R HAMPANNAVAR

43. DNA extraction and polymerase chain reaction • Total genomic DNA was isolated from young leaves • PCR positive for both R genes , PCR negative for back bone integration • Reaction performed using DreamTaqTM • standard PCR program (94°C for 60 s followed by 30 cycles of 94°C for 30 s, 58°C for 60 s, 72°C for 90 s and a final extension time of 5 min at 72°C). 435/22/2015 MAHESH R HAMPANNAVAR

44. Gene ID Sequences (5'-3') Fragment size (bp) Detection of Rpi-vnt1.1 forward ATGAATTATTGTGTTTACAAGACTTG 1100 T-DNA reverse AGCATTGGCCCAATTATCATTAAC Rpi-sto1 forward ACCAAGGCCACAAGATTCTC 890 T-DNA reverse CCTGCGGTTCGGTTAATACA tetA forward CTGCTAGGTAGCCCGATACG 396 Vector backbone reverse CCGAGAACATTGGTTCCTGT trfA forward CGTCAACAAGGACGTGAAGA 146 Vector backbone reverse CCTGGCAAAGCTCGTAGAAC NPTIII forward GAAAGCTGCCTGTTCCAAAG 162 Vector backbone reverse GAAAGAGCCTGATGCACTCC ColE1 forward ATAAGTGCCCTGCGGTATTG 246 Vector backbone reverse GCAGCCCTGGTTAAAAACAA oriV forward TGCGGCGAGCGGTATCAG 1045 Vector backbone reverse CTTCTTGATGGAGCGCATGGG traJ forward ACGAAGAGCGATTGAGGAAA 260 Vector backbone reverse CAAGCTCGTCCTGCTTCTCT Primers used for PCR analysis of transformants 445/22/2015 MAHESH R HAMPANNAVAR

45. Results Var/ strains IPO-C 90128 EC1 pic99189 DHD11 Atlantic S S S S S Bintje S S S S S potae9 S R R S S Dethatched leaf assay conducted for testing varieties 455/22/2015 MAHESH R HAMPANNAVAR

46. • Selection and validation of cisgenic potato plant with two late blight R genes 200 stem explants from each variety 1515 shoots were collected and screened by PCR with Rpi-vnt1.1 , Rpi-sto 1 primers 27 PCR positive But 25 containing both Rpi- vnt1.1 , Rpi-sto 1 gene 19 events are vector back bone free transformation 14 plants were tested for agroinfiltration 8 plants responded for to both Avrvnt 1 , Avrsto1 infiltration Cisgenic plant 465/22/2015 MAHESH R HAMPANNAVAR

48. Detached leaf assays for cisgenic transformant H43-7. 485/22/2015 MAHESH R HAMPANNAVAR

50. WHY APPRECIATE THIS TECHNIQUE? 535/22/2015 MAHESH R HAMPANNAVAR

51. • Conclusion of case study cisgenesis C.M. ROMMENS 2007 545/22/2015 MAHESH R HAMPANNAVAR

52. Comparable with traditional introgression resistance breeding using same gene pool. Enhance the breeding speed to obtain durable multigenic resistance linkage drag free. How cis/intragenic can overcome problems of introgression breeding? Conventional breeding 555/22/2015 MAHESH R HAMPANNAVAR

53. How cis/intragenic plants can overcome problems of transgenic plants? No change in fitness No need sequence information of other species No alter in gene pool No additional traits in recipient spp. Transgenesis 565/22/2015 MAHESH R HAMPANNAVAR

55. Potential of these concept • Improving traits with limited natural allelic variation • Higher expression level of a trait • Hybrid gene & silencing constructs. • US and Europe, acceptable to a greater number of people than transgenic crops 585/22/2015 MAHESH R HAMPANNAVAR

56. Regulatory guidelines 595/22/2015 MAHESH R HAMPANNAVAR

57. •Comparison hazards with other technique ( conventional, transgenic) • The Panel concluded that- (i). Similar hazards can be associated with cisgenic and conventionally bred plants while (ii). Novel hazards can be associated with intragenic and transgenic plants. (iii). No new guidelines for risk assessment. 605/22/2015 MAHESH R HAMPANNAVAR

58. • All of these breeding methods can produce - unintended effects. • Unintended effect assessed case by case • The risk to human and animal health and the environment will depend on exposure factor(cultivation and consumption) • For cis and intragenesis less event-specific data are needed for the risk assessment EFSA journal 2012 615/22/2015 MAHESH R HAMPANNAVAR

59. Global overview of consequences of different new plant breeding techniques for the environment and for food and feed safety. 625/22/2015 MAHESH R HAMPANNAVAR

61. Limitation of the two concepts • Traits outside the sexually compatible gene pool cannot be introduced. • Additional expertise and time • Not clearly define • Less transformation efficiency. 645/22/2015 MAHESH R HAMPANNAVAR

62. Objection and clarification Objection I. Random insertion of gene II. Mutation caused in plant Clarification I. Translocation breeding , Transposable element II. 2500 mutant varieties growing all around world in different crops 655/22/2015 MAHESH R HAMPANNAVAR

63. Current status of cis/intragenic crops • In most countries, the release of cisgenic or intragenic crops currently falls under the same regulatory guidelines as transgenic crops • The greatest expression of interest for less stringent regulations of these crops has been within the EU, the USA and New Zealand 665/22/2015 MAHESH R HAMPANNAVAR

64. Intragenic/cisgenic crops developed or currently under development 675/22/2015 MAHESH R HAMPANNAVAR

66. Field trials with intragenic/cisgenic crops 695/22/2015 MAHESH R HAMPANNAVAR

67. Future trends • generation and commercialization of intragenic and cisgenic crops will depend on willingness to apply less stringent regulation to these crops worldwide 705/22/2015 MAHESH R HAMPANNAVAR

68. • Manipulate crop within gene of same species • Overcome existing methods in some aspects Strengths • Low transformation efficiency • Detail sequence study of crops Weaknesses • Transgenic opposition • consumer preference Opportunities • Use of biotechnical tools • questionable biosafety measures Threats SWOT Analysis of Cis/intragnic 715/22/2015 MAHESH R HAMPANNAVAR

70. Discussion 735/22/2015 MAHESH R HAMPANNAVAR

71. 745/22/2015 MAHESH R HAMPANNAVAR mahi5295@gmail.com

cisgenesis and intragenesis

Mahesh Hampannavar

cisgenesis and intragenesis