Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Pcr polymerase chain_reaction

3,289 views

Published on

Bài này mình sưu tầm được, một số phần bị lỗi font. Mình thấy nó khá hay, và có thể giúp ng đọc hiểu được về cơ bản PCR là gì, và cách chạy PCR ra sao.
( Rất cảm ơn người làm bài present này)

  • Be the first to comment

Pcr polymerase chain_reaction

  1. 1. PCR (polymerase chain reaction)  Chương II
  2. 2. Taq polymerase Các bước PCR 1 phản ứng PCRNguyên tắc máy PCR Làm thế nào để phân lập được gen
  3. 3. I. Giới thiệu Kary Mullis 1985 Nobel 1993
  4. 4. Giới thiệu  PCR: phản ứng chuỗi trùng hợp  Là kỹ thuật tổng hợp nhân tạo các đoạn DNA với tốc độ nhanh, có độ chính xác cao, không cần sự hiện diện của tế bào  Phaûn öùng PCR cho pheùp khuyeách ñaïi moät ñoaïn DNA naèm giöõa 2 moài chuyeân bieät, nhôø men DNA polymerase
  5. 5. Nguyên tắc • Dựa trên sự hoạt động của emzyme • Sự hiện diện của mồi chuyên biệt • Khả năng nối dài mồi của taq polymerase • Các nu tự do trong môi trường
  6. 6. Máy PCR
  7. 7. Thực nghiệm  Phản ứng PCR là một chuỗi nhiều chu kỳ mỗi chu kỳ gồm 3 bước  Bước 1: Biến tính (denaturation)  94-98o C  2-5 phút  Bước 2: Gắn mồi (anneealing)  30-65o C  20s-2’  Bước 3: kéo dài (extending)  68-72o C  20s-5’
  8. 8. Thực nghiệm http://users.ugent.be/~avierstr/pdf/PCR.pdf
  9. 9. III. THỰC NGHIỆM http://users.ugent.be/~avierstr/principles/pcrani.html
  10. 10. III. THỰC NGHIỆM http://faculty.plattsburgh.edu/donald.slish/PCRmov.html
  11. 11. Moài (primers)Moài (primers) = oligonucleotide ñôn maïch (18-24 b) boå sung vôùi 2 vuøng treân trình töï DNA Moài xuoâi (sense primer hoaëc Forward) baét caëp vôùi maïch khuoân cuûa DNA vaø seõ keùo daøi theo chieàu phieân maõ Moài ngöôïc (anti sense primer hoaëc Reverse) baét caëp vôùi maïch maõ cuûa DNA vaø seõ keùo daøi ngöôïc theo chieàu phieân maõ 5’ 3’ 3’ 5’ 3’ 5’ 5’ 3’
  12. 12. THIẾT KẾ MỒI  Nguyên tắc  Trình tự của mồi được thiết kế sao cho không có sự bắt cặp giữa mồi xuôi và mồi ngược, kể cả cấu trúc kẹp tóc  Nhiệt độ gắn mồi của mồi xuôi và mồi ngược không được chênh lệch quá xa (Không nên quá nhiều G hoặc C nối tiếp nhau thường tỷ lệ G, C nằm trong khoảng 30%< G+C<70%))  Không nên nhiều bắt cặp sai với DNA khuôn  Các mồi được chọn phải đặc trưng cho trình tự DNA cần khuyếch đại không trùng với các trình tự lặp lại trên DNA  Trình tự nằm giữa mồi xuôi và mồi ngược không quá lớn (<3000 tốt nhất là dưới 1000)
  13. 13. THIẾT KẾ MỒI Cách thiết kế mồi:  Mồi xuôi: cùng trình tự với mạch mã  Mồi ngược: là trình tự ngược và bổ sung với mạch mã  Cách tính Tm (nhiệt độ gắn mồi) Tm = 4(G+C) + 2(A+T)
  14. 14. Polymerase chòu nhieätPolymerase chòu nhieät Taq-polymerase : töø Thermus aquaticus Nhieät ñoä toái öu : 72°C Coù hoaït tính 5'->3' polymerase Coù hoaït tính terminal transferase : theâm 1 Adenosine ôû ñaàu 3’ cuûa maïch DNA môùi. Khoâng coù khaû naêng söûa sai (2x10-5 , 0.25% sai sau 30 chu kyø) Sao cheùp ~ 2000b/min. Khoâng sao cheùp ñöôïc treân 3kb Pfu-polymerase : töø Pyrococcus furiosus Nhieät ñoä toái öu : 72°C Coù hoaït tính 5'->3' polymerase vaø 3’-> 5’ exonuclease Tyû leä cheùp sai thaáp (1.5x10-6 ) Sao cheùp ~ 500b/min
  15. 15. Buffers  Có nhiều loại buffer sử dụng riêng cho từng loại enzyme.  Một số buffer chứa chất hoạt động bề mặt có thể ảnh hưởng đến các phản ứng  Nhiều loại buffer đã có sẵn ion Mg2+
  16. 16. Nồng độ Mg2+ và dNTP  Nồng độ ion Mg2+ cao: xuất hiện thêm các sản phẩm không đặc hiệu.  Nồng độ ion Mg2+ thấp: lượng sản phẩm PCR thấp.  Nồng độ ion Mg2+ phụ thuộc vào loại DNA polymerase, DNA mẫu và thành phần buffer  gradien nồng độ từ 0.5 đến 2 mM với các khoảng cách mỗi bước là 0.2 mM.  dNTPs là loại hóa chất kém bền  Lượng dNTP tối ưu là 200 µM of mỗi loại dNTP. Việc tăng dNTP không làm tăng đáng kể lượng sản phẩm PCR so với việc hiệu chỉnh các yếu tố khác
  17. 17. Chất khác  Đối với các DNA template lớn, giàu GC thì có thể sử dụng các chất biến tính như DMSO, formamide, glycerol, and betaine trong thành phần PCR.  Tăng lượng DMSO trong PCR sẽ cần giảm nhiệt bắt mồi xuống.  Dầu khoáng
  18. 18. CÁC CHỈ TIÊU ẢNH HƯỞNG ĐẾN PHẢN ỨNG PCR  1. DNA mẫu: (100ng-1µg)  2. Enzyme  3. Mồi và nhiệt độ gắn mồi (nhiệt độ lai)  4. dNTP: 20-200µM/ mỗi lọai nu  5. Nồng độ Mg++  6. Số lượng chu kỳ phản ứng  7. Thiết bị và dụng cụ cho phản ứng
  19. 19. Một số vấn đề thường gặp  Không có sản phẩm hoặc lượng sản phẩm quá thấp  Kiểm tra lại DNA mẫu, thao tác  Tăng thời gian kéo dài, số chu kỳ, nhiệt độ biến tính  Hạ nhiêt độ gắn mồi  Primer, buffer
  20. 20. Một số vấn đề thường gặp  Vệt smear kích thước lớn hơn sản phẩm mong muốn  Giảm DNA, thời gian kéo dài, số chu kỳ  Tăng nhiệt độ gắn mồi  Thay đổi nồng độ Mg2+  Tăng thời gian kéo dài nếu sp mear có kt nhỏ
  21. 21.  Băng sản phẩm phụ rõ nét với kích thước thấp hơn sản phẩm mong muốn  Tăng nhiệt độ bắt mồi 2°C và/hoặc tăng thời gian bắt mồi  Tăng thời gian kéo dài thêm 30s.  Giảm nồng độ DNA polymerase.  Tối ưu hóa nồng độ Mg2+.  Tinh sạch DNA template  Giảm nồng độ primer.  Thiết kế cặp primer mới. Một số vấn đề thường gặp
  22. 22. Real-time PCRReal-time PCR
  23. 23.  Moät maùy luaân nhieät  Moät heä thoáng phaùt vaø ñoïc tín hieäu huyønh quang
  24. 24. Quaù trình nhaân baûn saoQuaù trình nhaân baûn sao ADN trong moät phaûnADN trong moät phaûn öùng PCRöùng PCR Theàm phaùt hieän Pha log Pha bình nguyeân Pha chaäm SoálöôïngADN Trong pha Log : Qn = Q0 (E)n Qn = Soá baûn sao sau n chu kyø Q0 = Soá baûn sao khôûi ñaàu E = Hieäu suaát PCR n = soá chu kyø
  25. 25. PCR coå ñieån : keát quaû chæ ñöôïc bieát sau khi taát caû caùc voøng phaûn öùng ñaõ hoaøn thaønh . A-6 = 10-6 ng A-5 = 10-5 ng A-4 = 10-4 ng A-3 = 10-3 ng A-2 = 10-2 ng A-1 = 10-1 ng A1 = 1ng A-6 A-5 A-4 A-3 A-2 A-1 A1 Real-Time PCR : quaù trình nhaân baûn sao ADN ñöôïc theo doõi tröïc tieáp theo töøng chu kyø. Vôùi kyõ thuaät naøy, ADN ban ñaàu ñöôïc ñònh löôïng moät caùch chính xaùc.
  26. 26. Tín hieäu huyønh quang ñöôïc ño sau giai ñoaïn keùo daøi cuûa moãi chu kyø PCR Öu ñieåm : reû, ñôn giaûn Nhöôïc ñieåm : khoâng ñaëc hieäu Phöông phaùp taïo huyønhPhöông phaùp taïo huyønh quang duøngquang duøng SYBRGreenSYBRGreen SYBRGreen phaùt huyønh quang khi cheøn giöõa 2 maïch cuûa ADN Kích thích 490nm Phaùt quang 530nm
  27. 27. Aùp duïng cuûa PCRAùp duïng cuûa PCR Taïo doøng DNA Tìm hieåu möùc bieåu hieän cuûa gen (Reverse Transcription PCR) Chaån ñoaùn beänh (cuûa ngöôøi, suùc vaät, caây coái) Phaùt hieän ñoät bieán Kieåm tra chaát löôïng (thöïc phaåm, GMO, oâ nhieãm nöôùc…) Phaùt hieän khaùc bieät giöõa caùc boä gen (Ña daïng gen):
  28. 28. TÓM TẮT QUY TRÌNH THỰC HIỆN MỘT PHẢN ỨNG PCR 1. Thiết kế mồi 2. Chuẩn bị mẫu DNA 3. Pha mix với các thành phần theo thứ tự sau:  H2O tiệt trùng  Buffer  dNTP tổng số  mồi xuôi  mồi ngược  taq polymerase  DNA mẫu 1. Cho vào máy lập chương trình chạy phù hợp 2. Kiểm tra sản phẩm PCR trên gel agarose với sự có mặt của thang chuẩn 3. Phân tích kết quả
  29. 29. RAPD (Random Amplified Polymorphic DNA)
  30. 30. Escherichia coli : 4 x 106 Saccharomyces cerevisiae : 1,4 x 107 Drosophila melanogaster : 1,6 x 108 Caenorhabditis elegans : 108 Homo sapiens : 3,4 x 109 Arabidopsis thaliana : 108 Oryza sativa 4,3 x 108 Phaseolus vulgaris (đậu) : 2 x 109 Triticum vulgare (lúa mì) 7 x 109 Tulipa 3,5 x 1010 Kích thöôùc boä gen cuûa moät vaøiKích thöôùc boä gen cuûa moät vaøi sinh vaätsinh vaät (pb)(pb)
  31. 31. Arabidopsis thaliana Drosophila melanogaster Tulipa Caenorhabditis elegans
  32. 32. Giới thiệu Là phương pháp phân tích đa dạng DNA khuyếch đại ngẫu nhiên, kỹ thuật này được phát hiện vào năm 1990 (Welsh và McClelland; William và ctv.). Dùng nghiên cứu sự khác biệt di truyền của những loài khác nhau. Kỹ thuật RAPD dựa trên kỹ thuật PCR, bằng cách sử dụng những primer ngắn (khoảng 10 nucleotide) có trình tự biết trước, bắt cặp và nhân bản ngẫu nhiên những đoạn DNA có trình tự bổ sung với trình tự của các primer
  33. 33. Primer RAPD  Là đoạn ngắn oligonucleotide đơn (10mer) được tổng hợp một cách ngẫu nhiên  Để tìm sự khác biệt giữa các loài người ta thường sử dụng một số lượng lớn các mồi ngẫu nhiên  Trên thị trường hiện nay có rất nhiều mồi ngẫu nhiên được tổng hợp nhân tạo
  34. 34. Nguyên tắc  Dùng kỹ thuật PCR, sử dụng mồi là các sợi oligonucleotide đơn gồm 10 mer có trình tự sắp xếp ngẫu nhiên  SV cùng loài sẽ có kiểu gen hoàn toàn giống nhau, sẽ khuyếch đại các đoạn DNA có kích thước giống nhau khi sử dụng bất kỳ mồi ngẫu nhiên nào để chạy PCR.  SV khác nhau ít nhiều về kiểu gen _ đa dạng về sinh hoc, thì với một số mồi ngẫu nhiên nào đó các đoạn DNA được khuyếch đại sẽ có kích thước khác nhau.
  35. 35. Ứng dụng  Nghiên cứu đa dạng di truyền  Phát hiện sự liên kết giữa gen với tính trạng  Thiết lập bản đồ di truyền  Phát hiện đột biến
  36. 36. Ưu điểm  Dễ thực hiện và dễ thành công do không cần biết trước trình tự bộ gene của đối tượng cần nghiên cứu, thao tác đơn giản  Chất lượng DNA khuôn không cần độ tinh sạch cao. Thời gian thực hiện nhanh. Khả năng nhân bản cao  Chi phí thực hiện thấp.  sử dụng kết hợp với những kỹ thuật cao cấp khác để đánh giá đa dạng di truyền và nhận diện chỉ thị phân tử có độ tin cậy cao
  37. 37. Hạn chế  Kỹ thuật RAPD có độ chính xác không cao, không ổn định  Khả năng nhân bản trong phản ứng PCR cao nhưng khả năng xuất hiện đa hình thấp và độ tin cậy không cao  Khả năng nhận diện chỉ thị phân tử thấp và có độ tin cậy không cao
  38. 38. Secuencia N° de bandas Partidor nucleotídica (5’-3’) totales OPA-13 CAGCACCCAC 19 OPB-04 GGACTGGAGT 26 OPB-07 GGTGACGCAG 21 OPB-12 CCTTGACGCA 21 OPB-17 AGGGAACGAG 20 OPF-04 GGTGATCAGG 21 OPF-06 GGGAATTCGG 12 OPF-08 GGGATATCGG 12 OPF-09 CCAAGCTTCC 19 OPF-12 ACGGTACCAG 10 OPF-18 TTCCCGGGTT 13 OPF-14 TGCTGCAGGT 19 OPI-04 CCGCCTAGTC 14 OPI-07 CAGCGACAAG 29 OPI-10 ACAACGCGAG 28 OPI-13 CTGGGGCTGA 17 OPI-14 TGACGGCGGT 22 OPI-20 AAAGTGCGGG 21
  39. 39. Sản phẩm điện di RAPD
  40. 40. Hãy thiết kế mồi để khuyếch đại đoạn DNA sau, tính Tm của mồi?  5’aagcgtattgatgttcagaataatgaaaccactaattcaagagtattgtgtgtatgccttgttatttcttcatgatcc aagggtttctcgcgtcaacagtatgttctgagctttttgttgttgtcatatctacttattcatgtttggaatgaaatgtcaa ttgtctcatcttcctaaagtgtatacaagtttttgttctacaatagaactctacaacagctgaatataatgataaaaat agatattttcttggctctttttttcattttacttttcttgacttctcatatggaaccacctccagcaacaaacggacctgtt attgcaggttactttgctaattggtaacattgcataacaaaggcaaaaggggagcttaactcaactaactagaat gtaataggggaatctacgatagaaaatacaatgttgttgatgtagctactcaagccaataagttgactcatatttta tatgcatttgctaatgtccaaccggatggtcaagttgttcttggggtagtataaattattgcaagatatagaatataa taataataattataaatataggacgcttatgcagatattgaaaagcattttccagcaagtaaaaaaataataata aacaaatataaaacctctccctaattcatacataatatgtagaccaagcagtcaaccgaaaagaagatggatg gaatgatccaggcaagaacctttacggtaactttaagcagttctatttactcaagcaacaacaccgtcatctcaa agtgtcgcttagcattggcggatatacatggtccactcattttggcccggttgcgcgtgatcctcagaaacgcag attgtttgtagatagcagcatcaaacacctagccaacttgggtctggacgggctagatattgactgggagtaccc caaagatgatgaggaagcgttttattatgtgcatctgctctatgagttgcgactggcgcttgacagatatcaacaa cagtgccaacaactgattcagtcgcgactattactcacagtagccgtgccttgtggccctgaccattatcgtaaat tgagattgaccgaaatgcaaccttacgtggacctattttacctcatggcatacgactatgctggttcatgggattctt tcgcagatcatcaagcggctgtttatggtggcagattgaatacagaacaagcagtacagcactatatcgcctgt ggtatccctccatataagctagtcgtaggcatgcctttatatggtcgaggattctgcaatacggcggggccaggt catcctttccaaggactgcctcgcggtacctgggaagagggtcaatttaattacaagacattgccaaaaccgg gcgctgtagaataccacgactttaatcgactagcctcatggtcttatgaccctcaggctcgtgaatttatcacctat gatactacgagatacattaacgt 3’
  41. 41. kết quả  Mồi xuôi: 5’ AAG CGT ATT GAT GTT CAG 3’  Mồi ngược: 5’ ACG TTA ATG TAT CTC GTA 3’  Tm (mồi xuôi) = 4x 7 + 2 x 11 = 50  Tm (mồi ngược) = 4x 6 + 2 x 12 = 48

×