Avanços e perspectivas em Bioinformática

3,162 views

Published on

Palestra ministrada na Semana Acadêmica da Computação da Universidade Federal do Ceará (dia 17/08/2012)

Published in: Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
3,162
On SlideShare
0
From Embeds
0
Number of Embeds
1,751
Actions
Shares
0
Downloads
64
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Avanços e perspectivas em Bioinformática

  1. 1. Avanços e perspectivas em BioinformáticaSemana Acadêmica da Computação Leandro Lima – 17/08/2012 www.ime.usp.br/~llima
  2. 2. Quem sou eu* Bacharel em Ciência da ComputaçãoUniversidade Federal do Ceará (2003-2006)* Mestre em Ciência da ComputaçãoUniversidade de São Paulo (2007-2009)* Doutorando em BioinformáticaUniversidade de São Paulo (2011- ????)Trabalhos atuais:* Hospital AC Camargo – Centro Internacional de Pesquisa e Ensino – Laboratório de Bioinformática e Bioestatística* FMU – Professor do curso de Ciência da Computação
  3. 3. Sumário- Um pouco de Biologia- Informação biológica: gerar, armazenar, analisar- Genômica- Sequenciamento de DNA- Aplicações / análises- Perspectivas / direcionamentos
  4. 4. Uma definição de Bioinformática“Uso da Computação e Estatística para gerar, armazenar e analisar dados biológicos”
  5. 5. Um pouco de Biologia (I) Gregor Mendel("Ensaios com plantas híbridas", 1865)
  6. 6. Um pouco de Biologia (II) Watson e Crick e a estrutura do DNA (1953)
  7. 7. Um pouco de Biologia (III) Imagem: http://pathology.jhu.edu/pc/BasicCauses.php
  8. 8. Dogma Central daBiologia Molecular
  9. 9. Geração de informação biológicaResultado da busca do site do NCBI (National Center for Biotechnology Information)
  10. 10. Geração de informação biológicaPubMed: catálogo dos artigos científicosTaxonomy: classificação de organismosGenome: sequências completas de genomasGene: informações de genesGEO Profiles: perfis de expressão gênicaProtein: banco de sequênciasSNP: variações genéticas curtasPubChem: banco de estruturas e interações químicas (drogas)
  11. 11. Exemplos de informações: gene BRCA1 (Homo sapiens)Localização: 17q21 (41196312..41277500)Tamanho: 81189 basesTranscritos: NM_007300.3, NM_007294.3, ...Interações: ABL1, MSH6, BRCA2, BRIP1, ...Alterações comuns: rs8176320, rs12516, rs34214126, ...Vias metabólicas: reparo de DNA, ciclo celular, …Sequência: GTACCTTGATTTCGTATTCTGAGAGGCTGCTGCT TAG... Fonte: http://www.ncbi.nlm.nih.gov/gene/672
  12. 12. Mais um pouco de Biologia
  13. 13. Mais um pouco de Biologia
  14. 14. O genoma é toda a informação hereditária de um organismo que está codificada em seu DNAEtapas de estudo:(1) Sequenciamento(2) Montagem (com ou sem referência)(3) Anotação
  15. 15. ABCDEFGHIJKLMNOPQRSTUVWXYZ Sequenciamento
  16. 16. ABCDEFGHIJKLMNOPQRSTUVWXYZ Montagem
  17. 17. ABCDEFGHIJKLMNOPQRSTUVWXYZ Anotação
  18. 18. Sequenciamento de DNA
  19. 19. Sequenciamento de DNA
  20. 20. Um pouco de História Projeto Genoma Humanoiniciado em 1990 – “concluído” em 2003 Hoje (2012): 2 dias para sequenciar Tamanho do genoma completo: ~3GB
  21. 21. Alguns tamanhos de genomas- HIV (vírus): 9.7kb- Haemophilus influenzae (bactéria): 1.8Mb- Arabidopsis thaliana (planta): 157Mb- Drosophila melanogaster (mosca): 130Mb- Mus musculus (rato): 2.7Gb- Homo sapiens (você): 3.2Gb- Polychaos dubium (ameba): 670Gb
  22. 22. Alinhamento de sequências
  23. 23. Um exemplo usandoprogramação dinâmica Alinhar as sequências GAATTCAGTTA GGATCGA
  24. 24. ResultadoG _ A A T T C A G T T A| | | | | |G G _ A _ T C _ G _ _ A Score = 6
  25. 25. Outros estudos- Single-nucleotide polymorphism (SNP, do inglês polimorfismo em único nucleotídeo)
  26. 26. Outros estudos (II)- Copy-number variation(CNV, do inglês variaçãono número de cópias)
  27. 27. Dogma Central daBiologia Molecular Expressão gênica (mRNA)
  28. 28. Medida de expressão gênica (ex: microarrays) Figuras: http://www.chrisdellavedova.com http://www.har.mrc.ac.uk/services/MPC/microarray/
  29. 29. Númerosgene Am1 Am2 Am3 Am4 Am5 … A 2.5 1.5 5 6.3 3.4 … B 3.2 5.6 4.4 4 7 … C 4.5 10.3 1.2 5.5 5 … D 1.5 3.2 4.5 3.4 4.5 … E 3.5 6.7 2.6 2.5 2.5 … … … … … … … …
  30. 30. Padrões de expressão
  31. 31. Clustering analysis(análise de agrupamento)
  32. 32. Funções biológicas
  33. 33. Redes biológicas
  34. 34. Redes biológicas
  35. 35. Redes droga-alvos(drug-target networks)
  36. 36. Diseasome (rede das doenças)
  37. 37. Exemplo de uma análise usando expressão gênica1 - Dada uma doença X, coletamos (os biólogos, na verdade) amostras de tecido de 20 pessoas doentes e 20 pessoas sem a doença
  38. 38. Exemplo de uma análise usando expressão gênica2 – Após verificar que a qualidade dos dados está boa, analisamos o padrão de expressão dos genes nos dois grupos e tentamos identificar quais tiveram uma padrão diferente (chamamos esses genes de diferencialmente expressos)
  39. 39. Exemplo de uma análise usando expressão gênica
  40. 40. Exemplo de uma análise usando expressão gênica3 – Identificar as funções biológicas relacionadas a esses genes diferencialmente expressos (tanto os super-expressos quanto os sub- expressos)
  41. 41. Exemplo de uma análise usando expressão gênica
  42. 42. Exemplo de uma análise usando expressão gênica4 – Identificar a rede de genes relacionados a essa lista e identificar os mais importantes usando informações topológicas (exemplos: grau do vértice; centralidade; participação em comunidades; é ponte?)
  43. 43. Exemplo de uma análise usando expressão gênica
  44. 44. O que estudar?Computação - programação/análise de algoritmos - mineração de dados/reconhecimento de padrões - teoria dos grafos - programação paralela e distribuída - bancos de dadosBiologia - Biologia molecular/celularEstatística - análise de gráficos - inferência/teste de hipótese
  45. 45. Linguagens mais usadas
  46. 46. Pós-graduações no Brasil- Programa Interunidades de Pós-Graduação em Bioinformática-USPhttp://www.ime.usp.br/posbioinfo/- Programa de Pós-Graduação em Bioinformática-UFPRhttp://www.bioinfo.ufpr.br- Programa de Pós-Graduação em Bioinformática-UFMGhttp://www.pgbioinfo.icb.ufmg.br/
  47. 47. Onde trabalhar- Hospitais- Universidades- Instituições de pesquisa (agropecuária, biomédica, etc.)- Farmacêuticas- Prestadoras de serviços
  48. 48. Outras dicas- Comece a estudar cedo- Procure um grupo de Bioinformática (Computação, Biologia, Matemática, Farmácia, Medicina)- Estude inglês- Use Linux- Siga blog / perfis do Twitter relacionados a Bioinfo- Pense sobre passar um tempo fora (do Ceará, do Brasil)
  49. 49. Broad Institute of MIT and Harvard (junho de 2012)
  50. 50. Broad Institute of MIT and Harvard (junho de 2012)
  51. 51. Perguntas?

×