Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Intelligent Design - The Modern Challenge to Darwinism

4,381 views

Published on

Explore the evidence of intelligent design in the earth and in the universe with Dr. Ken Boa as he looks and multiple new discoveries in science, mathematics, and information technology that point to the necessity of some sort of intelligent designer.

Published in: Spiritual, Technology
  • Be the first to comment

Intelligent Design - The Modern Challenge to Darwinism

  1. 1. Intelligent Design The Modern Challenge to Darwinism Dr. Kenneth Boa and Bill Ibsen © Dr. Kenneth Boa & Bill Ibsen 2010.  All Rights Reserved.
  2. 2. May 2005
  3. 3. July 2005
  4. 4. August 2005
  5. 5. ... implies a Designing Intelligence Design
  6. 6. D uses the scientific method to argue for an intelligent cause nature applied to the data of
  7. 7. Tangible signs of design by a preexisting intelligence
  8. 8. • Doesn’t define the designing intelligence • Not religious • Doesn’t specify the implications
  9. 9. Paley’s “Watchmaker,” 1802
  10. 10. Chance or Design?
  11. 11. Chance or Design?
  12. 12. Science versus Scientism • Scientism = Philosophy of Naturalism • “The cosmos is all that ever was, or is, or ever will be” - Astronomer Carl Sagan • A naturalistic rather than a scientific statement • Science = An empirical method of discovery • E.g., elliptical planetary orbits
  13. 13. Inferences to the Best Explanation Natural Causes Designed Designer Gutzon Borglum,Designer Gutzon Borglum, ca 1930ca 1930
  14. 14. Intelligent Design
  15. 15. Bioluminescent Pelagic Octopus 90% efficient Designed Intentional Purposeful Non-living Not designed Chance Purposeless Alive 10% efficient
  16. 16. Weighing Evidence Design No Design Mind Mindless Deliberate Accident Living Non-Living Purposeful Purposeless Intentional Randomness Reason Chance Order Chaos
  17. 17. Overview • Detecting Design: Irreducible Complexity • Design in Biochemistry • Detecting Design: Specified Complexity • Design in Genetics • Design in Paleontology • Design in Astronomy
  18. 18. Detecting Design: Irreducible Complexity
  19. 19. Jenga
  20. 20. Irreducible Complexity Spring Holding Bar Platform Hammer Catch A minimum number of parts must be present to function
  21. 21. Closely Matched Parts • Right size • Right proportion • Right strength • Right tolerances • Right materials • Right alignment • Right assembly instructions Structure-Function Relationships That Display DESIGN
  22. 22. Irreducible Complexity Cannot be Produced by Darwinism • A missing single component: non-functional • “Selected out” • No memory • Can’t save changes
  23. 23. Jellyfish Stinging Cells Are Irreducibly Complex barb poison
  24. 24. Bird Lungs are Irreducibly Complex
  25. 25. Charles Darwin Darwin’s Failure Criterion “If it could be demonstrated that any complex organ existed which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down” Charles Darwin, On the Origin of Species, Chapter VI “Difficulties with the Theory”
  26. 26. Absolute Break-Down of Darwin’s Theory • Must “choose” pre-functioning components •Cannot produce new components
  27. 27. Absolute Break-Down of Darwin’s Theory • Multi-component (irreducibly complex) systems cannot be produced gradually • Missing part > Non-Functioning
  28. 28. Design in Biochemistry
  29. 29. What Darwin Never Knew • 1850’s technology • No electron microscopes, X-ray crystallography, etc.
  30. 30. What Darwin Never Knew • No understanding of cell complexity • No knowledge of genetics or DNA • 99.9% fossils discovered after 1860
  31. 31. Bacteria Flagellum
  32. 32. Micro-Molecular Motors
  33. 33. Micro-Molecular Motors Stator Rotor Bushing
  34. 34. What’s it Got Under the Hood? • Acid-powered, liquid-cooled rotary motor • 100,000 rpm • Rotor, stator, u-joints, bushings, and propeller • Propeller reverse within 1/4 of a turn
  35. 35. What’s it Got Under the Hood? • Almost 100% efficiency • Sensory system for steering • Synchrony with multiple flagella • Irreducibly complex
  36. 36. Specifically Sequenced Toy Assembly Instructions
  37. 37. Assembly Instructions Included! Meaningful instructions are always a product of intelligence
  38. 38. Mom, I’ve Got a Motor in My Body! • 100+ molecular motors known to exist in human body • 8,000,000 machines can fit on the end of a human hair • Far exceeds the capacity of human technology
  39. 39. Cellular Factory Consists of 10 million million atoms
  40. 40. Cell: High-Tech Factory • Artificial languages + decoding systems • Memory banks: info storage and retrieval • Control systems: regulating auto self- assembly • Assembly processes involving prefabrication and modular construction • Complete self-replication of its entire structure within a few hours!
  41. 41. Darwinian Evolution’s Audacious Claim • Evolution can produce highly sophisticated, highly compact, highly complex, highly ordered, self-replicating systems... • ... which the pinnacle of human technology and intelligence is incapable of replicating • With NO INTELLIGENCE at all
  42. 42. Detecting Design: Specified Complexity
  43. 43. WouldYou Believe This Happened by Chance?
  44. 44. Scrabble Tiles Set Randomly Dumped Randomness tends to produce nonsense
  45. 45. Four Possibilities for Information High ContentLow Content Not Complex Complex High Probability Low Probability Low Specificity High Specificity Specification = Conforms to an independently recognizable pattern
  46. 46. Ranges of Informational Possibilities Low Content High Content ComplexNot Complex
  47. 47. Informational Possibility #1 High ContentLow Content Not Complex Complex High Probability Low Probability Low Specificity High Specificity NDPOKNZMSVBWXLSRRE
  48. 48. JIMJIMJIMJIMJIMJIMJIMJIM High ContentLow Content Not Complex Complex High Probability Low Probability Low Specificity High Specificity Informational Possibility #2
  49. 49. High ContentLow Content Not Complex Complex High Probability Low Probability Low Specificity High Specificity PLCATVGETRUGAXRDJCOW Informational Possibility #3
  50. 50. High ContentLow Content Not Complex Complex High Probability Low Probability Low Specificity High Specificity OURNAMESAREKENANDBILL SPECIFIEDCOMPLEXITY Probability:1 in 1 billion quadrillion Informational Possibility #4
  51. 51. Definition of Information Complex High Content SPECIFIEDCOMPLEXITY INFORMATION = Content + Complexity High Specificity Low Probability
  52. 52. No Yes No Yes S.C. Indicates Design No Yes
  53. 53. Necessity, Chance or Design? Contingent, Complex, Specified?
  54. 54. Chance or Design?
  55. 55. Design in Genetics
  56. 56. Chances of This Simple Sentence? 2,810,000,000,000,000,000,000,000,000,000,000,000,000,000 1
  57. 57. The Improbability of Chance “Give me a million monkeys over a million years, and they’ll be able to write Shakespeare’s Tempest!” - George Bernard Shaw Shaw
  58. 58. The Improbability of Chance of writing a simplified first line ofTempest # of 4-Letter Words in Sequence 1 2 3 4 Time ~12 Seconds ~ 5 Days ~ 100 Years ~ 100 BillionYears
  59. 59. www.randomutation.com
  60. 60. Where Does Information Come From?
  61. 61. Information Transcends Matter & Energy
  62. 62. Information Transcends Matter & Energy
  63. 63. M.I.T. Mathematician Norbert Wiener Any materialism that fails to take account of this will not survive one day.” “Information is information; neither matter nor energy.
  64. 64. The lower cannot account for the larger
  65. 65. Atheist Riddle Show me a message that doesn’t come from a mind.
  66. 66. assembly of informationinformation in the known universe DNA is the most densely packed, most elaborately detailed
  67. 67. Continuous DNA Strand Ruptured Bacterial Cell
  68. 68. AGATGGTTCATTCTGACTTGGGTATCGAAGAACTTGATTCACCTGAATCCAGTCTAAATGGAAGTGAAGATATGGAGTCCAAGAGCAACCTGTACAGC GGGGCAGTGGTATTGTTACAAGATGTCCTCTTGTGCTGAGGCTGAAAAAACTTGGGAATGAAGACGAGTGGAAAGGCAAAGTCAGCTTCCTGGACAAA TCTAAATGGAAGTGAAGATATGGAGTCCAAGAGCAACCTGTA AGACGAGTGGAAAGGCAAAGTCAGCTTCCTGG Page 311 of 600 Volume917 Volume345 1000 600-page Books ...in the area 10,000x smaller than a pin head
  69. 69. Billy, your genome sequence is A, T, C, G, A, T, C, G, A, T, C, G, A, C, T, A, G .... Speak aloud 10 bases/second non-stop 24 hrs./day: 9.5 years Speak aloud 3 bases/second non-stop 40 hrs./week: 132 years
  70. 70. Confidence Against Random Generation of 20 Digits
  71. 71. DNA Fun Fact 3.2B letters of coding provides 103,480,000,000 possible combinations
  72. 72. How could specified, complex information get from an organism’s environment into an organism’s genome? Millions upon millions of beneficial mistakes? Seriously!
  73. 73. “If it looks, walks and quacks like a duck ....”
  74. 74. Design in Paleontology
  75. 75. “... the number of intermediate and transitional links, between all living and extinct species, must have been inconceivably great. - Charles Darwin, On the Origin of Species But assuredly, if this theory be true, such have lived upon the earth.”
  76. 76. Macroevolution Transitionals
  77. 77. Era Period/Epoch Age (Millions of Years) Pleistocene 0.01 Pliocene 1.8 Miocene 5 Oligocene 25 Eocene 38 Palaeocene 55 Cretaceous 65 Jurassic 144 Triassic 248 Permian 286 Carboniferous 354 Devonian 412 Silurian 435 Ordovician 492 Cambrian 550 Precambrian 600 Beginning of Life ca. 3800 CenozoicMesozoicPalaeozoic
  78. 78. The Cambrian Explosion The Biological “Big Bang”
  79. 79. Burgess Shale Site, British Columbia
  80. 80. Anomalocaris
  81. 81. Hallucigenia
  82. 82. Pikaia
  83. 83. Opabina
  84. 84. Wiwaxia
  85. 85. Marella
  86. 86. “Natural selection acts only by taking advantage of slight, successive variations. She can never take a great and sudden leap, but must advance by short and sure, though slow steps” - Charles Darwin, On the Origin of Species
  87. 87. The absence of the fossil evidence was “the most obvious and gravest objection which can be urged against my theory.” “... the case at present must remain inexplicable and may be truly argued as a valid argument against the views here entertained.” - Charles Darwin, On the Origin of the Species
  88. 88. The Embarrassing Fossil Record Darwinian Theory Cambrian Fact Common Ancestor No Ancestor Partially Formed Fully Formed Gradual Appearance Sudden Appearance Numerous Transitional Intermediates No Transitional Intermediates Cambrian Fossils Followed by Gradual Change Cambrian Fossils Followed by Stasis
  89. 89. Living Fossils
  90. 90. “Old Fourlegs”- The Coelecanth
  91. 91. “The extreme rarity of transitional forms in the fossil record is ...the trade secret of paleontology” - Stephen Jay Gould, Evolutionary Biologist
  92. 92. Design in Astronomy
  93. 93. “The universe that we observe has precisely the properties we should expect if there is, at bottom no design, no purpose, no evil and no good, nothing but blind, pitiless indifference.” Oxford University Professor Richard Dawkins
  94. 94. Fine-Tuning of the Universe • Rare, unique and complex conditions required for sustaining life • Earth has a myriad of incredibly interconnected, interrelated life-support systems
  95. 95. Our Just-Right Galaxy EllipticalSpiral 20% 60% Only spiral galaxies provide any “safe zone” for life-sustaining planets Irregular 20%
  96. 96. Our Just-Right Galaxy • Milky Way is top 1-2% most luminous and massive galaxies • Gravitational mass attracts helium & hydrogen to build heavy elements • Low-mass galaxies unable to attract helium & hydrogen • ∼200 billion stars, but little likelihood of life-sustaining planets
  97. 97. Our Just-Right Planetary Orbits • Jupiter’s orbit: nearly circular • Similar gas-giant planets in other solar systems have highly elliptical orbits • Gravitational pull would upset Earth’s nearly circular orbit, subjecting it to deadly temperature variations • Creates steady temperatures and a predictable climate
  98. 98. Our Just-Right Neighbors • Jupiter is +300X mass of Earth • Gravitational pull acts as a shield to protect us from deadly comets • Saturn and Uranus comet- catch for us • Mars andVenus take asteroid hits for us
  99. 99. Moon Battle Scars
  100. 100. Our Just-Right Distance From the Sun • Too close: boil off the oceans • Too far: H₂0 and C0₂ freeze • C0₂ traps sun’s radiation, keeps H₂0 liquid • Complex animal life needs 0₂ • +/- 5% distance Circumstellar Habitable Zone (not to scale) +/- 5%
  101. 101. Our Just-Right Sun • Right mass: Yellow dwarf; 10% most massive stars • Right light: Emits a balance of red & blue allowing photosynthesis • Right composition: High metallicity for creating terrestrial planets • Right orbit: Nearly circular for temperature stability
  102. 102. Our Just-Right Sun • Right energy output: 0.01% variance on an 11-year cycle • Right type: Bachelor star (10% of all stars) • Right luminosity: Not too much particle radiation • Destroys the atmosphere • Destroys the ozone layer Binary Stars
  103. 103. Our Just-Right Moon • Stabilizes the tilt of the Earth’s axis @ 23.5° • Variation of ~1.5° giving mild seasons • Mercury, Mars,Venus have chaotic variations in tilt
  104. 104. Our Just-Right Moon • Increases our tides (Moon = 68.5% and Sun = 31.5%) • Flushes out nutrients from continents to oceans • Single moon (Jupiter 63; Saturn 33; Uranus 26; Neptune 13; Mars 2) • Otherwise: chaotic, deadly tides & seasons • Circulates ocean water, regulating temperatures • Size: more massive > tidal and rotation effects
  105. 105. Our Just-Right Core/Engine • Radioactive decay helps drive convection of liquid iron surrounding core • Creates a dynamo generating magnetic field • Shields us from low-energy cosmic rays • Prevents solar winds from degrading our atmosphere
  106. 106. Our Just Right Earth-Mass • Terrestrial planets must have a minimum mass to retain an atmosphere • Atmosphere : keeps the good in and the bad out • Oxygen-rich atmosphere to support large-brained creatures (20%) • Minimum mass to retain heat • E.g., Mars
  107. 107. Our Just-Right Observation Position • Earth located between spiral arms • Fewer stars • Less gas and dust • Offers great visibility of the universe • Earth is best planet to view total solar eclipses
  108. 108. Probability of 200 finely-tuned parameters occurring by chance: 1010-215-215
  109. 109. . 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000 00000000000000000000001 10 -215 is: What Are the Chances? Get heads 50X in a row: 1 chance in a million billion “Not a chance.” “Not a chance.”
  110. 110. Combination Lock 60 dials
  111. 111. Summary “... numerous, successive, slight modifications”
  112. 112. Summary Irreducible complexity makes Darwin’s theory “absolutely break down” “... numerous, successive, slight modifications”
  113. 113. Summary Biochemistry describes intricate molecular machines that are irreducibly complex Evolution, by definition, can never account for the existence of irreducibly complex systems
  114. 114. Summary Specified complexity identifies information-rich sources belying their intelligent cause Darwinism is incapable of accounting for the origination of information
  115. 115. Summary Genetics uncovers the highest levels of information in the universe Complex information cannot originate by chance, natural processes
  116. 116. Summary “She can never take a sudden leap... but must advance by short, slow, though sure steps”
  117. 117. Summary Paleontology shows abrupt appearance and stasis--incompatible with Darwinism “She can never take a sudden leap... but must advance by short, slow, though sure steps”
  118. 118. Summary Astronomy reveals the amazing fine-tuning of the universe- a product of intelligence +/- 5% . 0000000000000000000000000000000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000000000000000000000000001 chance occurrence of 200 fine-tuned parameters
  119. 119. Summary • Necessity (it had to be there) • Chance (a tornado blew it there) • Design (someone put it there)
  120. 120. Why Isn’t ID Widely Published? • Problem of censorship for dissenting opinions • Scientific journals have referees who eliminate any papers which imply design or a designer • “Darwin Industry” • Thousands of competent scientists now in the ID camp (and growing)
  121. 121. Extra-Scientific Implications • Metaphysical issues • “The ones who oppose the theory of design most vociferously do so for religious reasons” -Michael Behe, Biochemist • Darwinism tends to be off-limits for criticism
  122. 122. Weighing Evidence Design No Design Mind Mindless Deliberate Accident Living Non-Living Purposeful Purposeless Intentional Randomness Reason Chance Order ChaosIntelligent Design Darwinism
  123. 123. Conclusion •The momentum of the empirical evidence will predictably continue to grow in the direction of elegance, complexity, and information. •The neo-Darwinian account of naturalistic processes is already hopelessly outmoded and inadequate in its explanatory power • The increasing momentum of empirical evidence will only make this inadequacy even more obvious with every passing year.
  124. 124. The End
  125. 125. Books About I.D. • Evolution: ATheory in Crisis by Michael Denton • Darwin’s Black Box by Michael Behe • Intelligent Design by William Dembski • The Design Revolution by William Dembski • Icons of Evolution by Jonathan Wells • A Case for the Creator by Lee Stroebel • Darwin onTrial by Phillip Johnson • The Privileged Planet by Guillermo Gonzalez
  126. 126. KenBoa.org Resources Reflections - A free monthly teaching letter KenBoa.org website - Daily Growth email and free text and audio resources
  127. 127. www.KenBoa.org

×