Using phylogenetic metadata for large-scale phylogeny synthesis

409 views

Published on

Talk given at iEvoBio 2013 on phylogenetic metadata

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
409
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
10
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Using phylogenetic metadata for large-scale phylogeny synthesis

  1. 1. Using phylogenetic metadata inlarge-scale phylogenetic synthesisKaren Cranston @kcranstnElliot Hauser @hauspoorHilmar Lapp @hlappand @opentreeoflife
  2. 2. thermore, a paraphyletic relationship of phorids and syrphidswould support the hypothesis that their shared special mode ofextraembryonic development (dorsal amnion closure) (26)evolved in the stem lineage of Cyclorrhapha and preceded theorigin of the schizophoran amnioserosa.To test this hypothesis, we used a relatively recent phylogenomicmarker: small, noncoding, regulatory micro-RNAs (miRNAs).miRNAs exhibit a striking phylogenetic pattern of conservationacross the metazoan tree of life, suggesting the accumulation andmaintenance of miRNA families throughout organismal evolutionFig. 1. Combined molecular phylogenetic tree for Diptera. Partitioned ML analysis of combined taxon sets of tier 1 and tier 2 FLYTREE data samples (−lnL =344155.6169) calculated in RAxML. Circles indicate bootstrap support >80% (black/bp = 95–100%, gray/bp = 88–94%, white/bp = 80–88%). Nodes with im-proved bootstrap values resulting from postanalysis pruning of unstable taxa are marked by stars (black/bp = 95–100%, gray/bp = 88–94%, white/bp = 80–88%). Colored squares on terminal branches indicate the presence, in at least one species of a family, of ecological traits as shown to lower left. The numberof origins of each trait was estimated with reference to the phylogeny, the distribution of each trait among genera within a family, and the known biology ofthe organisms.Wiegmann et al. PNAS Early Edition | 3 of 6ACGTTCGATACGTTCGATACGTTCGATACGTTCGAT⋮CC-BY-SA: http://www.flickr.com/photos/drewlite/Photo by DAVID ILIFF. License: CC-BY-SA 3.0?Wiegmann et al, 2011, PNAS
  3. 3. thermore, a paraphyletic relationship of phorids and syrphidswould support the hypothesis that their shared special mode ofextraembryonic development (dorsal amnion closure) (26)evolved in the stem lineage of Cyclorrhapha and preceded theorigin of the schizophoran amnioserosa.To test this hypothesis, we used a relatively recent phylogenomicmarker: small, noncoding, regulatory micro-RNAs (miRNAs).miRNAs exhibit a striking phylogenetic pattern of conservationacross the metazoan tree of life, suggesting the accumulation andmaintenance of miRNA families throughout organismal evolutionFig. 1. Combined molecular phylogenetic tree for Diptera. Partitioned ML analysis of combined taxon sets of tier 1 and tier 2 FLYTREE data samples (−lnL =344155.6169) calculated in RAxML. Circles indicate bootstrap support >80% (black/bp = 95–100%, gray/bp = 88–94%, white/bp = 80–88%). Nodes with im-proved bootstrap values resulting from postanalysis pruning of unstable taxa are marked by stars (black/bp = 95–100%, gray/bp = 88–94%, white/bp = 80–88%). Colored squares on terminal branches indicate the presence, in at least one species of a family, of ecological traits as shown to lower left. The numberof origins of each trait was estimated with reference to the phylogeny, the distribution of each trait among genera within a family, and the known biology ofthe organisms.Wiegmann et al. PNAS Early Edition | 3 of 6EVOLUTIONWiegmann et al, 2011, PNAS=?
  4. 4. thermore, a paraphyletic relationship of phorids and syrphidswould support the hypothesis that their shared special mode ofextraembryonic development (dorsal amnion closure) (26)evolved in the stem lineage of Cyclorrhapha and preceded theorigin of the schizophoran amnioserosa.To test this hypothesis, we used a relatively recent phylogenomicmarker: small, noncoding, regulatory micro-RNAs (miRNAs).miRNAs exhibit a striking phylogenetic pattern of conservationacross the metazoan tree of life, suggesting the accumulation andmaintenance of miRNA families throughout organismal evolutionFig. 1. Combined molecular phylogenetic tree for Diptera. Partitioned ML analysis of combined taxon sets of tier 1 and tier 2 FLYTREE data samples (−lnL =344155.6169) calculated in RAxML. Circles indicate bootstrap support >80% (black/bp = 95–100%, gray/bp = 88–94%, white/bp = 80–88%). Nodes with im-proved bootstrap values resulting from postanalysis pruning of unstable taxa are marked by stars (black/bp = 95–100%, gray/bp = 88–94%, white/bp = 80–88%). Colored squares on terminal branches indicate the presence, in at least one species of a family, of ecological traits as shown to lower left. The numberof origins of each trait was estimated with reference to the phylogeny, the distribution of each trait among genera within a family, and the known biology ofthe organisms.Wiegmann et al. PNAS Early Edition | 3 of 6EVOLUTIONWiegmann et al, 2011, PNAS=
  5. 5. Goal: synthesize a draft treeof life from publishedphylogenies
  6. 6. one treetwo trees
  7. 7. http://vimeo.com/67870035
  8. 8. Open Tree of Liferesolving the hairball of life......with phylogenetic metadata!

×