Chapter Four
Genetics and Evolution
Exam One Results
• Your grade is
posted on “My
Grades” in e-
campus
• Any questions???
Service Learning Opportunity
• Don’t forget that you can substitute one of
your exam grades by participating in service
le...
Natural Selection
 Natural selection
– introduced by
Darwin in The
Origin of Species in
1859
 Features and the
environme...
Genetic Mechanisms
 Chromosomes, Genes, and DNA
 30,000 genes
• http://youtu.be/uN82GLQYAUQ
• Genes and environment
Ques...
Skin pigmentation is one example of a
continuous trait. (Nature vs. Nurture)
Two important terms...
Phenotype: The outlook of an organism
Genotype: The genetic information written in DNA
ATGTTTCCACCT...
The Science of Sex Appeal Video
Groups: What factors make us attracted to others?
Get into groups and try to brainstorm at...
Mating Patterns
Differential parental investment theory
 Polygyny: One male with multiple females
 Polyandry: One female...
Color Blind Test
• Just a shortened form:
• http://colorvisiontesting.com/online%20t
est.htm
• An evolutionary advantage?
Genetic Mechanisms
Some of the reasons….
• better health care (less serious illnesses that can delay or
damage brain development, less exposu...
(Nature vs. Nurture Debate)
TWIN STUDIES
 Reared separately ~ Career choice, food preferences,
facial expressions, medica...
Fallacies
 Social Darwinism
 Deterministic fallacy
Homework
• Read Chapter Five
Psyc 2301 chapter four powerpoint(2)
Psyc 2301 chapter four powerpoint(2)
Psyc 2301 chapter four powerpoint(2)
Upcoming SlideShare
Loading in …5
×

Psyc 2301 chapter four powerpoint(2)

161 views

Published on

Published in: Education, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
161
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
5
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Psyc 2301 chapter four powerpoint(2)

  1. 1. Chapter Four Genetics and Evolution
  2. 2. Exam One Results • Your grade is posted on “My Grades” in e- campus • Any questions???
  3. 3. Service Learning Opportunity • Don’t forget that you can substitute one of your exam grades by participating in service learning • Click on the “Service Learning” button in e- campus to learn more about getting enrolled
  4. 4. Natural Selection  Natural selection – introduced by Darwin in The Origin of Species in 1859  Features and the environment
  5. 5. Genetic Mechanisms  Chromosomes, Genes, and DNA  30,000 genes • http://youtu.be/uN82GLQYAUQ • Genes and environment Ques: Can you think of a disorder that may be affected by the environment for which you may have a genetic predisposition?
  6. 6. Skin pigmentation is one example of a continuous trait. (Nature vs. Nurture)
  7. 7. Two important terms... Phenotype: The outlook of an organism Genotype: The genetic information written in DNA ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTCC CACTTTCAAGCTCGGCCCCTT TCAACTCAGAGAGGCGGCTA GACACCCAGAGACCTCAAGT GACCATGTGGGAACGGGATG TTTCCAGTGACAGGCAG GCCAAGAATGGCTCCCACCT GGCTCTCAGACATTCCCCTGG TCCAACCCCCAGGCCATCAAG ATGTCTCAGAGAGGCGGCTAG ACACCCAGAGACCTCAAGTGA CCATGTGGGAACGGGATGTTT CCAGTGACAGGCA Genotype Phenotypes Genotype
  8. 8. The Science of Sex Appeal Video Groups: What factors make us attracted to others? Get into groups and try to brainstorm at least 10 factors that affect attraction. What connections can be made to biological and environmental factors? Smell • http://youtu.be/s_y8NTaPNQY Facial Attractiveness • http://youtu.be/MVhKSzSpXMA Walk • http://youtu.be/gwdlq95Tnqc
  9. 9. Mating Patterns Differential parental investment theory  Polygyny: One male with multiple females  Polyandry: One female with multiple males  Monogamy: One male with one female  Polygynandry: Multiple males with multiple females
  10. 10. Color Blind Test • Just a shortened form: • http://colorvisiontesting.com/online%20t est.htm • An evolutionary advantage?
  11. 11. Genetic Mechanisms
  12. 12. Some of the reasons…. • better health care (less serious illnesses that can delay or damage brain development, less exposure to toxins such as lead, smog, food poisoning, etc.) • better nutrition (better availability of fresh foods, proteins, fats, vitamins, minerals such as iron and iodine, etc. that are necessary to build and support the brain) • higher levels of education • higher cognitive stimulation by an increasingly complex environment
  13. 13. (Nature vs. Nurture Debate) TWIN STUDIES  Reared separately ~ Career choice, food preferences, facial expressions, medical conditions, similar speech rhythms, etc.  Monozygotic (identical) ~ 80% concordance rate in their sense of happiness  Dizygotic (fraternal) ~ no concordance in their sense of happiness  Identical ~ if one has schizophrenia, the other has a 50% chance of developing the condition  Fraternal ~ 27% chance of developing the disorder ADOPTION STUDIES Intelligence is more similar to their biological parents than to their adoptive parents
  14. 14. Fallacies  Social Darwinism  Deterministic fallacy
  15. 15. Homework • Read Chapter Five

×