Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

precisionFDA

408 views

Published on

Presenting precisionFDA for the first time at the Precision Medicine Coalition in Washington, DC on February 24, 2016

Any views or opinions expressed here do not necessarily represent the views of the FDA, HHS, or any other entity of the United States government. Furthermore, the use of any product names, trade names, images, or commercial sources is for identification purposes only, and does not imply endorsement or government sanction by the U.S. Department of Health and Human Services.

Published in: Health & Medicine
  • Be the first to comment

  • Be the first to like this

precisionFDA

  1. 1. Joint work with many colleagues at FDA precision.fda.gov | precisionFDA@fda.hhs.gov | @precisionFDA Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics Officer Director, FDA’s Office of Health Informatics David Litwack, PhD Policy Advisor FDA’s Center for Devices and Radiological Health Elaine R. Johanson Deputy, FDA Chief Health Informatics Officer Deputy Director, FDA’s Office of Health Informatics
  2. 2. Genetic test (upstream) Clinician orders test/services for patient, collects sample Sample preparation and sequencing Core processing (Mapping, Variation Calling) Special processing (Annotation, Filtering, Interpretation) + (downstream) Clinician discusses outcome with patient NGS-based Genetic Test (end-to-end product)
  3. 3. Initial Focus Genotype Location 9: C → G mutation ... File with variants (VCF) " You are at risk for X outcome. " Report Predicted Outcome Analytical Benchmark Clinical Benchmark
  4. 4. Initial Focus – Analytic Benchmarking •Assess reproducibility of a test •Assess accuracy using reference samples •Assess agreement with other methods •Assess test performance on synthetic data
  5. 5. Features Private or community areas Data Apps Comparisons Notes
  6. 6. https://github.com/FDA
  7. 7. >930 members from >450 organizations
  8. 8. precision.fda.gov
  9. 9. Thank You! precision.fda.gov | precisionFDA@fda.hhs.gov | @precisionFDA
  10. 10. Backup Slides precision.fda.gov | precisionFDA@fda.hhs.gov | @precisionFDA
  11. 11. … AGCATCGATGCAGAAGATTACAAGACGATCCGCTC … DNA Gene
  12. 12. We are all unique … AGCATCGATGCAGAAGATTACAACATAAAAAGATTACACGCGATCCGCTC … … AGCATCGATGCATAAGATTACAAGATAAAAAGATTACACGCGATCCGCTC … … AGCATCGATGCATAAGATTACAACATAAAAAGATTACATGCGATCCGCTC … … AGCATCGCTGCAGAAGATTACAACATAAAAAGATTACATGCGATCCGCTC … reference David Taha Elaine
  13. 13. The Internet Cloud
  14. 14. Community Assurance
  15. 15. Add new Feature (Discussion) New Feature

×