Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Práctica n3 Cladística UCE

890 views

Published on

Esta es la guía de prácticas del taller de Cladística que doctamos en la Universidad Central del Ecuador - Junio 2017

Published in: Education
  • Be the first to comment

  • Be the first to like this

Práctica n3 Cladística UCE

  1. 1. Práctica N° 3 Manejo de programas para inferencia filogenética: TNT Por: PhD. Jonathan Liria Universidad Regional Amazónica IKIAM Ejercicios: 1.1.Verifique utilizando el bloc de notas (=notepad) el archivo que se exportó desde el programa Mesquite. La estructura del archivo debería ser similar al que se muestra a continuación: El formato reconocido por TNT posee los siguientes comandos: XREAD (lee una matriz), CNAMES (lee la lista de caracteres), y TREAD (lee un conjunto de árboles en notación parentética). Existen más comandos que se irán viendo a lo largo de la práctica. 1.2.Ejecute el programa TNT. Seguidamente vaya al menú File Open input file:
  2. 2. Busque y ejecute el archivo de datos con la matriz de parásitos hipotéticos. Utilice el menú Trees View para verificar los árboles que se almacenaron luego de la búsqueda con Mesquite: Utilice las teclas de función en su teclado: F1, F2, F3, F4, F5 y F6. Cada una de ellas tiene efecto sobre el árbol que se está graficando. Así por ejemplo, las teclas F3 y F4 expanden o comprimen el árbol en sentido horizontal. Si Ud desea cambiar la raíz del árbol, por ejemplo enraizando con las “Especie_X_X”, proceda de la siguiente seleccionando el menú Data Outgroup taxón En la pestaña, seleccione la especie deseada para enraizar los árboles. Luego pulse el botón “Ok”. Si los árboles no cambian, vaya al menú Tree Reroot y seleccione reenraizar (=reroot). ¿Por qué deben enraizarse las soluciones con respecto al taxón “X_X”? Mapeo de caracteres. Vaya al menú Optimize Synapomorphies Map synapomorphies:
  3. 3. Describa lo sucedido. Utilice esta opción para comparar cada uno de los árboles obtenidos en Mesquite con el que Ud. construyó mediante argumentación de Hennig. ¿Los resultados son iguales? Ahora utilice la opción Optimize Synapomorphies Map Common synapomorphies Describa lo sucedido. Explique porque al mapear las sinapomorfías comunes se obtuvo este resultado. Verificando estadísticos del árbol. Vaya al menú Optimize Tree length. Este comando permite calcular el largo de los arboles almacenados en memoria. Anote en su cuaderno esta información. Escriba el siguiente comando en la celda que se encuentra en la parte inferior de la ventana: minmax* luego presione enter
  4. 4. El comando (=minmax) devuelve en formato de tabla los pasos mínimos y máximos por carácter, para los árboles almacenados en memoria. ¿Qué estadístico puede deducirse a partir de dichas variables? Ejecutando macros para realizar procesos. Descargue, el macro stats.run en el siguiente enlace: http://phylo.wikidot.com/tntwiki El archivo descargado debe colocarse en el mismo lugar (carpeta o directorio) donde se encuentra la matriz de datos y árboles. Coloque en la línea de comando de TNT (parte inferior de la ventana) la siguiente instrucción: run stats.run; Presione enter, y describa que sucede. Anote los valores que se presenten en la tabla. Otra de las ventajas de TNT es que pueden realizarse distintos macros para procesos particulares. Así por ejemplo, existe un macro que permite hacer la recodificación de caracteres continuos a discretos usando el método de Gap-Weighting. 1.3.Realizando una corrida de datos bajo el método de enumeración implícita (=branch and bound). Seleccione el menú Analyze Implicit enumeration ; debe mostrarse otra ventana como:
  5. 5. Seleccione el botón ok. ¿Cuantos árboles se obtienen? Determine las estadísticas básicas: longitud, consistencia, y retención. Compare sus resultados con los obtenidos en Mesquite. 1.4.Efectuando una corrida de enumeración implícita con datos combinados del tipo continuo y discreto. Ejecute la matriz contin.tnt ; al realizar este proceso se le advertirá que los datos serán reemplazados por la nueva matriz. Acepte y vaya al menú Data Show matrix ; allí podrá apreciar los tipos de caracteres que posee la matriz “contin.tnt”. Esta matriz posee dos bloques de caracteres: Uno continuo (primer bloque) y otro discreto (segundo bloque). Seleccione el menú Data Character groups/blocks Create groups from data blocks El programa indica que se crearon dos bloques de datos. Realice una corrida con enumeración implícita, menú Analyze Implicit enumeration Describa sus resultados utilizando el visor de árboles, menú Trees View , realice una captura de pantalla de este árbol.
  6. 6. Haga el mapeo de caracteres, menú Optimize Characters Character mapping , con el botón enter puede avanzar por cada carácter: ¿Qué sucede cuando llega a los caracteres discretos (segundo bloque)? Proceda a desactivar el bloque de caracteres continuos. Utilice el menú Data Characters settings Seleccione la opción “inactive” y luego pulse el botón “GROUPS”. Proceda a inactivar el Block_1:
  7. 7. El Block_1 debe pasar al lado de la columna “Select”. Seguidamente pulse el botón “OK”, y nuevamente el botón “OK”. Repita una corrida con enumeración implícita, y compare el/los nuevo(s) árbol(es) con el realizado a partir de ambos bloques de datos. ¿Difieren? ¿En que grupos? 1.5.Análisis de datos más complejos (mayor número de taxa y caracteres). Abra la matriz “zilla.tnt” con el menú File Open input file Realice una corrida tradicional, con el menú Analyze Traditional search La ventana de búsquedas tradicionales presenta varias alternativas:
  8. 8. Cambie los siguientes parámetros, repls. (numbers of add.seqs.) = 50 tres to save per replication = 25 Pulse el botón “Search” , y observe que sucede. ¿Cuánto tiempo tardó el programa en realizar el análisis? ¿Cuantos árboles se obtuvieron? ¿qué longitud presentan? Fíjese que aparece un mensaje de advertencia. El programa le indica que debe aumentar la memoria del buffer de árboles, porque actualmente está en 100. Para ello, vaya al menú Settings Memory Cambie el parámetro Max Trees = 10000
  9. 9. Repita la corrida de búsquedas tradicionales con los valores indicados. Anote sus observaciones. Repita la corrida de búsqueda tradicional, pero altere los parámetros: repls. (numbers of add.seqs.) = 100 tres to save per replication = 25 ¿Obtuvo árboles menores a los de la corrida anterior? ¿Cómo interpreta el mensaje “some replications overflowed”? Realice otra corrida, pero altere los parámetros: repls. (numbers of add.seqs.) = 100 tres to save per replication = 50 Anote sus observaciones. Como se puede apreciar, esta matriz de datos debido a sus dimensiones debería analizarse con algoritmos adicionales.
  10. 10. Tomado de: The Parsimony Ratchet, a New Method for Rapid Parsimony Analysis Según este artículo (Figura 1), a los noventa minutos el autor (Nixon, 1999) encuentra árboles de longitud 16218 pasos. 1.6.Análisis de datos más complejos con algoritmos más agresivos. Realice una corrida con nuevas tecnologías, con el menú Analyze New Technology search Como puede apreciarse, la venta desplegada de New Technology search muestra muchas opciones:
  11. 11. Selecciones todas las opciones de “Use…” Deben marcarse las búsquedas sectoriales, Ratchet, Drift, y Tree Fusing. Los algoritmos utilizados aquí están descritos en: Analysing large data sets in reasonable time: solutions for composite optima Techniques for analysing large data sets Realice una búsqueda con los parámetros por defecto. Pulse el boto “Search”. ¿Cuántos arboles obtiene? ¿Qué longitud presentan? Compare sus resultados con las otras corridas realizadas con los algoritmos tradicionales. Repita la búsqueda con nuevas tecnologías, pero modifique los siguientes parámetros: Drive search = 10 Find min. length = 3 Importante: Siempre verifique que se están utilizando los cuatro algoritmos de búsqueda. Anote sus observaciones. Es importante que observe la información de “Total rearrengements examined”. Repita la búsqueda con nuevas tecnologías, pero modifique sólo este parámetro: Check level every = 3 Anote sus observaciones. 1.7.Pesado de caracteres. Abra la matriz “example.tnt” con el menú File Open input file
  12. 12. Realice una corrida tomando en cuenta el número de taxa que posee la matriz. Utilice el macro “stats.run” para verificar los índices de consistencia y retención. Anote sus observaciones. Vaya al menú Settings Implied weighting Basic settings Para discusión sobre la aplicación del pesado de caracteres, puede consultar: Weighting against homoplasy improves phylogenetic analysis of morphological data sets En la ventana que se despliega seleccione la opción, “using implied weighting”:
  13. 13. Se indica que la constante de concavidad utilizada será K=3. Pulse Ok, y realice una corrida con los mismos parámetros que realizó con base a pesos iguales. ¿Nota alguna diferencia? ¿Cuántos árboles se obtienen? Una forma de visualizar la información, grupos monofiléticos, en los árboles es mediante un consenso estricto. Para ello vaya al menú Trees Consensus Se despliega una ventana con varias opciones: Por defecto ya está seleccionada la opción “Strict (=Nelsen)”, pulse el botón Ok y realice una captura de pantalla. Recuerde usar los comandos que comprimen el árbol (Ej.: las teclas F3 y F4 expanden o comprimen el árbol en sentido horizontal). También puede usar pulsar la tecla “m” en el teclado y se guardará un archivo de Windows metafile:
  14. 14. Guarde el consenso estricto de la corrida con K=3. Desactive los pesos (menú Settings Implied weighting Basic settings), repita la corrida, y realice un consenso estricto. Finalmente efectué una captura de pantalla de este consenso y guarde el archivo en formato metafile. En equipos de tres personas, realice corridas con distintos valores de K, y complete la siguiente tabla: Concavidad Longitud de los árboles Número de árboles Grupos monofiléticos Sin pesos K=1 K=2 K=3 K=4 K=5 K=6 1.8.Análisis de datos morfogeométricos (=landmarks). Abra la matriz “Landmark_example.tnt” con el menú File Open input file , utilice la opción de ver la matriz. Una vez finalizada la corrida, realice el mapeo de los caracteres o configuraciones de puntos anatómicos (=landmarks). Menú Characters Map landmarks
  15. 15. ¿Porqué existen configuraciones en grises? Verifique la matriz original (use el bloc de notas para ver los datos de los taxa 1, 3 y 11). En el modo de vista de configuraciones, Usted puede pulsar la techa “h” para recibir ayuda de algunos comandos de visualización:
  16. 16. Utilice algunos de los comandos. Puede crear bloques de caracteres (menú Data Character groups/blocks Create groups from data blocks), para desactivar las configuraciones que desee y repetir corridas. Es una forma de ver el efecto de cada configuración sobre el análisis combinado. 1.9.Análisis de datos moleculares. Ingrese en el portal de NCBI (https://www.ncbi.nlm.nih.gov/genbank/) y coloque los siguientes códigos de acceso a secuencias: Especie Marcador Código GenBank Tapirus indicus Cytb JX014331.1 Tapirus bairdii Cytb JF718880.1 Tapirus pinchaque Cytb JF718878.1 Tapirus terrestris Cytb JF718879.1
  17. 17. Descargue cada secuencia en formato Fasta, y utilizando el bloc de notas cree un archivo similar a este: >Tapirus_indicus CCCCCCCCCCCCCCCCGGGGGGGGGGGGCCCGGCCGGGTTTTTGGGGGTTAAACGCGCGCGTAAAAAGCA >Tapirus_bairdii GGGCCCCCGGGGCCCCCCATTATTCCCCCCCGGGGGTTTTTTTAAACGCGCGTCCCGGGCG >Tapirus_pinchaque GGGGGGCCCCCCCCCCGGGGGCAAAATTGCCGGGTTTTTCCCCCTTAAACGCGCGTGGGGGGCG >Tapirus_terrestris AAAAGGCCCAACCCCGGGGGCAAAATTGCCGGGTTTTTCCCCCTTAAACGCGCGTGGGGG Guarde este archivo como Tapirus_no_alineado.fas Utilice el programa ClustalX2 para abrir este archivo (File Load Sequences), y realizar un alineamiento:
  18. 18. Al abrir el archivo se debería apreciar algo como: Con las cuatro secuencias; nótese que no están alineadas. Modifique las opciones de salida, con la opción: Alignment Output Format Options , seleccione sólo la opción FASTA. Realice un alineamiento múltiple con el menú: Alignment Do complete alignment
  19. 19. Cambie el nombre del archivo de salida por: Tapirus_alineado.fas Una vez alineado, se debería apreciar algo como: Recuerde que se utilizaron los parámetros por defecto, para realizar este alineamiento. Cierre el programa, y ejecute TNT para importar los datos moleculares. Utilice el menú File Merge / Import data Read a Fasta file
  20. 20. Utilice el menú para ver la matriz de datos y constatar que la importación se realizó correctamente, y los datos son considerados como moleculares. Reenraíce con el taxón Tapirus indicus, y seguidamente realice una corrida con enumeración implícita. Compare los resultados de la filogenia obtenida con otros análisis filogenéticos en especies de Tapirus. ¿Concuerdan los resultados? • Phylogeography of the Mountain Tapir (Tapirus pinchaque) and the Central American Tapir (Tapirus bairdii) and the Origins of the Three Latin-American Tapirs by Means of mtCyt-B Sequences. • Molecular phylogeny and evolution of the Perissodactyla. Repita el procedimiento, pero agregue dos secuencias adicionales de Cytb para las especies: Tapirus_bairdii, Tapirus_pinchaque, y Tapirus_terrestris. Realice una tabla donde coloque los códigos de acceso de estas secuencias adicionales. 1.9.1 Estudios empíricos demuestran que Muscle y otros programas producen mejores alineamientos que Clustal: Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput Nucleic Acids Res. 32(5):1792-1797. Edgar, R.C. (2004) MUSCLE: a multiple sequence alignment method with reduced time and space complexity BMC Bioinformatics, (5) 113. Abra el bloc de notas (=notepad) y escriba la siguiente línea de comando: muscle -in Tapirus_no_alineado.fas -out Tapirus_alineado_Muscle.txt -maxiters 15 -gapopen 10 - gapextend 1 -cluster2 neighborjoining -maxtrees 15 -tree1 upgma1 -tree2 nj2
  21. 21. Guarde este archivo como: Tapirus.bat Para guardar en formato BAT debe seleccionar la opción todos los archivos: En la carpeta donde fue instalado el programa Muscle, deben moverse todos los archivos: Tapirus.bat y Tapirus_no_alineado.fas Una vez realizado, proceda a hacer doble clic en el archivo BAT. Debería aparecer el archivo Tapirus_alineado_Muscle.txt Verifique que se encuentra en formato fasta. Importe este archivo en TNT (recuerde renombrar el archivo de TXT a FAS) y realice una corrida, comparando los resultados (cladogramas) con el alineamiento de Clustal.

×