Chapter 17 - Gene to Protein

8,454 views

Published on

Published in: Education, Technology
0 Comments
12 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
8,454
On SlideShare
0
From Embeds
0
Number of Embeds
150
Actions
Shares
0
Downloads
306
Comments
0
Likes
12
Embeds 0
No embeds

No notes for slide

Chapter 17 - Gene to Protein

  1. 1. From Gene to Protein How Genes WorkAP Biology 2007-2008
  2. 2. What do genes code for?  How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA proteins cells bodiesAP Biology
  3. 3. The “Central Dogma”  Flow of genetic information in a cell  How do we move information from DNA to proteins? DNA RNA protein trait DNA gets all the glory, replication but proteins do all the work!AP Biology
  4. 4. Metabolism taught us about genes  Inheritance of metabolic diseases  suggested that genes coded for enzymes  each disease (phenotype) is caused by non-functional gene product  lack of an enzyme Am I just the sum of my proteins?  Tay sachs  PKU (phenylketonuria)  albinismmetabolic pathway disease disease disease disease A  AP Biology enzyme 1 B  enzyme 2 C  enzyme 3 D  enzyme 4 E
  5. 5. 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act byAP Biology regulating definite chemical events"
  6. 6. Beadle & Tatum X rays or ultraviolet light Wild-type Neurospora create mutations Minimal asexual spores Growth on medium complete medium positive control spores Select one of the spores Test on minimal Grow on medium to confirm complete medium presence of mutation negative control Minimal media supplemented only with…experimentals Pyridoxine Choline Nucleic Arginine Riboflavin Minimalamino acid p-Amino Inositol acid Folic Niacin controlsupplements benzoic acid AP Biology acid Thiamine
  7. 7. a a From gene to protein a a nucleus cytoplasm a a a a a a a transcription translation a a DNA mRNA protein a a a a a a a a a ribosome traitAP Biology
  8. 8. Transcription from DNA nucleic acid language to RNA nucleic acid languageAP Biology 2007-2008
  9. 9. RNA  ribose sugar  N-bases uracil instead of thymine U : A C : G  single stranded  lots of RNAs  mRNA, tRNA, rRNA, siRNA… transcriptionDNAAP Biology RNA
  10. 10. Transcription  Making mRNA  transcribed DNA strand = template strand  untranscribed DNA strand = coding strand  same sequence as RNA  synthesis of complementary RNA strand  transcription bubble  enzyme coding strand  RNA polymerase A G A G C A T C G T A A 3 A 5 G T C T C T T C A T C A G T DNA G T A 3 A C T G C A U C G U T G 5 C unwinding 3 G T A G C A rewinding mRNA RNA polymerase template strand AP Biology 5build RNA 53
  11. 11. RNA polymerases  3 RNA polymerase enzymes  RNA polymerase 1  only transcribes rRNA genes  makes ribosomes  RNA polymerase 2  transcribes genes into mRNA  RNA polymerase 3  only transcribes tRNA genes  each has a specific promoter sequence it recognizesAP Biology
  12. 12. Which gene is read? Promoter region  binding site before beginning of gene  TATA box binding site  binding site for RNA polymerase & transcription factors Enhancer region  binding site far upstream of gene  turns transcriptionAP Biology on HIGH
  13. 13. Transcription Factors  Initiation complex  transcription factors bind to promoter region  suite of proteins which bind to DNA  hormones?  turn on or off transcription  trigger the binding of RNA polymerase to DNAAP Biology
  14. 14. Matching bases of DNA & RNA A  Match RNA bases to DNA C U G bases on one of the DNA G A strands U G C U U C G A A C U A AG C U 5 RNA A 3 A C C polymerase G T G G T A C A G C T A G T C A T CG T A C CG TAP Biology
  15. 15. Eukaryotic genes have junk!  Eukaryotic genes are not continuous  exons = the real gene introns  expressed / coding DNA come out!  introns = the junk  inbetween sequence intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequenceAP Biology
  16. 16. mRNA splicing  Post-transcriptional processing  eukaryotic mRNA needs work after transcription  primary transcript = pre-mRNA  mRNA splicing  edit out introns  make mature mRNA transcript intron = noncoding (inbetween) sequence ~10,000 baseeukaryotic DNA exon = coding (expressed) sequence pre-mRNAprimary mRNA transcript ~1,000 base AP Biology mature mRNA spliced mRNA transcript
  17. 17. 1977 | 1993 Discovery of exons/introns Richard Roberts Philip Sharp adenovirus CSHL MIT common cold beta-thalassemiaAP Biology
  18. 18. Splicing must be accurate  No room for mistakes!  a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|UAP Biology Met|Arg|Val|Arg|STOP|
  19. 19. Whoa! I think we just broke RNA splicing enzymes a biological “rule”!  snRNPs snRNPs  small nuclear RNA snRNA  proteins exon intron exon  Spliceosome 5 3  several snRNPs  recognize splice spliceosome site sequence 5 3  cut & paste gene lariat No, not smurfs! 5 3 “snurps” exon exon mature mRNA excisedAP Biology 5 3 intron
  20. 20. Alternative splicing  Alternative mRNAs produced from same gene  when is an intron not an intron…  different segments treated as exons Starting to get hard to define a gene!AP Biology
  21. 21. More post-transcriptional processing  Need to protect mRNA on its trip from nucleus to cytoplasm  enzymes in cytoplasm attack mRNA  protect the ends of the molecule  add 5 GTP cap  add poly-A tail  longer tail, mRNA lasts longer: produces more protein 3 A mRNA P P 5 G PAP Biology
  22. 22. a a From gene to protein a a nucleus cytoplasm a a a a a a a transcription translation a a DNA mRNA protein a a a a a a a a a ribosome traitAP Biology
  23. 23. Translation from nucleic acid language to amino acid languageAP Biology 2007-2008
  24. 24. How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? protein Met ArgVal AsnAla Cys Ala 20 How can you code for 20 amino acidsAP Biology with only 4 nucleotide bases (A,U,G,C)?
  25. 25. mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon AUGCGUGUAAAUGCAUGCGCC mRNA ? proteinAP Biology Met ArgVal AsnAla Cys Ala
  26. 26. 1960 | 1968 Cracking the code Nirenberg & Khorana  Crick  determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT  Nirenberg (47) & Khorana (17)  determined mRNA–amino acid match  added fabricated mRNA to test tube of ribosomes, tRNA & amino acids  created artificial UUUUU… mRNA  found that UUU coded for phenylalanineAP Biology
  27. 27. Marshall Nirenberg 1960 | 1968 Har KhoranaAP Biology
  28. 28. The code  Code for ALL life!  strongest support for a common origin for all life  Code is redundant  several codons for each amino acid  3rd base “wobble” Why is thewobble good?  Start codon  AUG  methionine  Stop codonsAP Biology  UGA, UAA, UAG
  29. 29. How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA 3 5 codon UAC tRNA GCA Met CAU anti-codon amino Arg acid ValAP Biology
  30. 30. a a From gene to protein a a nucleus cytoplasm a a a a a a a transcription translation a a DNA mRNA protein a a a a a a a a a ribosome traitAP Biology
  31. 31. Transfer RNA structure  “Clover leaf” structure  anticodon on “clover leaf” end  amino acid attached on 3 endAP Biology
  32. 32. Loading tRNA  Aminoacyl tRNA synthetase  enzyme which bonds amino acid to tRNA  bond requires energy  ATP  AMP  bond is unstable  so it can release amino acid at ribosome easily Trp C=O Trp C=O Trp OH H2O OH O O activating enzyme tRNATrp AC C anticodon UGG mRNA tryptophan attachedAP Biology to tRNATrp tRNATrp binds to UGG condon of mRNA
  33. 33. Ribosomes  Facilitate coupling of tRNA anticodon to mRNA codon  organelle or enzyme?  Structure  ribosomal RNA (rRNA) & proteins  2 subunits  large  small E P AAP Biology
  34. 34. Ribosomes  A site (aminoacyl-tRNA site)  holds tRNA carrying next amino acid to be added to chain  P site (peptidyl-tRNA site)  holds tRNA carrying growing polypeptide chain Met  E site (exit site)  empty tRNA leaves ribosome 5 U A C A U G from exit site 3 E P AAP Biology
  35. 35. Building a polypeptide  Initiation  brings together mRNA, ribosome subunits, initiator tRNA  Elongation  adding amino acids based on codon sequence  Termination  end codon 3 2 1 Leu Val release Ser factor Met Met Met Met Leu Leu Leu Ala Trp tRNA U AC UAC GAC U A C GA C AA U A C G A C AA U5 C UGAA U 5 A U G C U GA A U 5 A U G C UG U 5 AU G C U G 3mRNA A U G 3 3 3 A CC U GG U A A E P A 3 AP Biology
  36. 36. Destinations: Protein targeting  secretion  nucleus  Signal peptide  mitochondria  chloroplasts  address label  cell membrane  cytoplasm start of a secretory pathway  etc…AP Biology
  37. 37. RNA polymerase DNA Can you tell amino acids the story? exon intron tRNA pre-mRNA 5 GTP cap mature mRNA aminoacyl tRNA poly-A tail synthetase large ribosomal subunit 3 polypeptide 5 tRNA small ribosomal subunit E P AAP Biology ribosome
  38. 38. The Transcriptional unit (gene?)enhancer translation translation 1000+b start exons stop 20-30b3 TAC transcriptional unit (gene) ACT 5 RNA TATA polymerase DNA DNA UTR UTR introns promoter transcription transcription start stop 5 3 pre-mRNA 5 3 AP Biology GTP mature mRNA AAAAAAAA
  39. 39. Bacterial chromosome Protein Transcription Synthesis in mRNA Prokaryotes Psssst… no nucleus! Cell membrane Cell wallAP Biology 2007-2008
  40. 40. Prokaryote vs. Eukaryote genes  Prokaryotes  Eukaryotes  DNA in cytoplasm  DNA in nucleus  circular  linear chromosome chromosomes  naked DNA  DNA wound on histone proteins  no introns  introns vs. exons introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequenceAP Biology
  41. 41. Translation in Prokaryotes Transcription & translation are simultaneous in bacteria  DNA is in cytoplasm  no mRNA editing  ribosomes read mRNA as it is being transcribedAP Biology
  42. 42. Translation: prokaryotes vs. eukaryotes  Differences between prokaryotes & eukaryotes  time & physical separation between processes  takes eukaryote ~1 hour from DNA to protein  no RNA processingAP Biology
  43. 43. MutationsAP Biology 2007-2008
  44. 44. Mutations  Point mutations  single base change  base-pair substitution  silent mutation  no amino acid change  redundancy in code  missense  change amino acid  nonsense  change to stop codon When do mutations affect the nextAP Biology generation?
  45. 45. Point mutation leads to Sickle cell anemiaWhat kind of mutation? Missense!AP Biology
  46. 46. Sickle cell anemia  Primarily Africans  recessive inheritance pattern  strikes 1 out of 400 African Americans hydrophilic hydrophobicAP Biology amino acid amino acid
  47. 47. Mutations  Frameshift  shift in the reading frame  changes everything “downstream”  insertions  adding base(s)  deletions  losing base(s) Where would this mutation cause the most change: beginning or end of gene?AP Biology
  48. 48. Cystic fibrosis  Primarily whites of European descent  strikes 1 in 2500 births  1 in 25 whites is a carrier (Aa)  normal allele codes for a membrane protein that transports Cl- across cell membrane  defective or absent channels limit transport of Cl- (& H2O) across cell membrane  thicker & stickier mucus coats around cells  mucus build-up in the pancreas, lungs, digestive tract & causes bacterial infections  without treatment children die before 5; with treatment can live past their late 20sAP Biology
  49. 49. Chloride channel transports chloride through Effect on Lungs protein channel out of cellnormal lungs airway Osmotic effects: H2O follows Cl- Cl- Cl- channel H 2O cells lining lungscystic fibrosis Cl- H 2O bacteria & mucus build up thickened mucus hard to secrete AP Biology mucus secreting glands
  50. 50. Deletion leads to Cystic fibrosis delta F508 loss of one amino acidAP Biology
  51. 51. What’s the value of mutations?AP Biology 2007-2008

×