Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

How to cluster and sequence an ngs library (james hadfield160416)

6,648 views

Published on

A presentation for people intersted in understanding how Illumina adapter ligation, clustering ands SBS sequencing work. Follow core-genomics http://core-genomics.blogspot.co.uk/

Published in: Science
  • Be the first to comment

How to cluster and sequence an ngs library (james hadfield160416)

  1. 1. ‘How to prepare, cluster and sequence an NGS library’ AN OVERVIEW OF NGS IN THE GENOMICS CORE – Introduction – Understanding library prep – Understanding clustering and sequencing – Understanding instruments – NGS QC – NGS applications
  2. 2. A potted history of Illumina sequencing 200Gb 500Gb1Gb 25Gb 1000Gb 1500Gb 1998 20142007 2010 2011 20152004 2006 2012 1994
  3. 3. Understanding library prep Adapter ligation Adenylation BioAnalyser qPCR
  4. 4. Understanding library prep PCR BioAnalyserqPCR Fragment DNA
  5. 5. Understanding library prep Ligate adaptersEnd-repair PCR BioAnalyserqPCR Fragment DNA Adenylate
  6. 6. Understanding library prepFragment DNA Quant DNA Ligate adaptersEnd-repair BioAnalyserqPCR PCR Adenylate
  7. 7. Understanding library prepFragment DNA Quant DNA Size select Ligate adaptersEnd-repair Fragment RNA 2ndstrand dUTP UNG BioAnalyser 1ststrand qPCR Ribozero deplete OligodT enrich PCR Adenylate
  8. 8. Understanding library prepFragment DNA Quant DNA Sizeselect Size select Ligate adaptersEnd-repair Adenylate Tagment Quant DNA 2ndPCR 1stcapture 2ndcapture Strand displace Sizeselect Circularise &exo Bead purify Shear 5’ligaon Reverse transcribe 3’ligaon Gelpurify Fragment RNA 2ndstrand dUTP UNG BioAnalyser 1ststrand qPCR Ribozero deplete OligodT enrich PCR
  9. 9. Understanding library prepFragment DNA Quant DNA Sizeselect Size select Ligate adaptersEnd-repair Adenylate Tagment Quant DNA 2ndPCR 1stcapture 2ndcapture Strand displace Sizeselect Circularise &exo Bead purify Shear 5’ligaon Reverse transcribe 3’ligaon Gelpurify Fragment RNA 2ndstrand dUTP UNG BioAnalyser 1ststrand qPCR Ribozero deplete OligodT enrich Library synthesis Ampliy &Index Template preparaon QCBioAnalyser QTqPCR PCR
  10. 10. Understanding library prep TSCA TruSeq stranded mRNANextera XT TruSeq PCR-free TruSeq sRNANextera TruSeq Nano Nextera Rapid Exome TruSeq Ribozero Nextera Mate-PairTruSeq ChIP-seq TREX Thruplex Fragment DNA Quant DNA Sizeselect Size select Ligate adaptersEnd-repair Adenylate Tagment Quant DNA 2ndPCR 1stcapture 2ndcapture Strand displace Sizeselect Circularise &exo Bead purify Shear 5’ligaon Reverse transcribe 3’ligaon Gelpurify Fragment RNA 2ndstrand dUTP UNG BioAnalyser 1ststrand qPCR Ribozero deplete OligodT enrich Library synthesis Ampliy &Index Template preparaon QCBioAnalyser QTqPCR PCR
  11. 11. Understanding library prep
  12. 12. Understanding library prep 6 hours to 3 days dependant on actual sample type, not high- throughput or 96well
  13. 13. Understanding library prep – Text Adapter liga on, PCR and sequencing A P OH T Read1 P5 P7 BC Read2 P5 P7 BC Read1P5 Read2 P7BC
  14. 14. Illumina adaptersask for Illumina letter! CTCTTCCGATCT ADAPTER PCR PRIMER SEQ PRIMER CTCTTCCGATC T CTCTTCCGATCT Insert DNA CTCTTCCGATCT InsertDNA A |||||||||| InsertDNAACTCGTATGCCGTCTTCTGCTT G P- GATCGGAAGAG CTCTTCCGATCT T |||||||||| CTCGTATGCCGTCTTCTGCTT G P-GATCGGAAGAG CTCTTCCGATC T T |||||||||| Oligonucleotide sequences © Illumina, Inc. All rights reserved.
  15. 15. Understanding library prep
  16. 16. The library prep spike [DNA] Illumina Processing
  17. 17. Understanding library prep – Nextera! – Text a c R1P5 BC1 R2 P7BC2 b
  18. 18. Understanding cluster generation (2500 etc)
  19. 19. Understanding cluster generation (2500 etc) A) Diluted & denatured libraries are annealed to lawn oligos at their 3’ end, and a polymerase creates a covalently attached copy of the library molecule. B) The original strand is removed by denaturation with NaOH. C) In non-denaturing conditions the library molecule bends and hybridises to a lawn oligo complementary to the 5’ end, and a polymerase creates a second covalently attached molecule. This amplification is repeated to create a cluster with around 1000 copies of the original library molecule. A B C
  20. 20. Understanding cluster generation (2500 etc) D E C G H D) Clusters are linearized by cleavage at the 3’ end of the original library molecule, and denaturation leaves the single stranded DNA which will be sequenced. A sequencing primer is hybridised* and sequencing-by-synthesis generates the first read in your fastq file. -) For single-end indexing the the SBS template is removed by denaturation, and the index 1 sequencing primer is hybridised ready to generate index1 (i7). Dual-indexing is complicated and differs on single- or paired-end flowcells but the process is essentially the same to generate index two (i5). E-G) For paired-end sequencing the SBS template is removed by denaturation, the cluster is re-amplified for several cycles, cleaved at the 5’ end the paired-end sequencing primer hybridised ready to generate read 2. *Beware: if you create new adapters let us know if you need a custom sequencing primer
  21. 21. Understanding cluster generation (X Ten & 4000) Exclusion Amplification The same hybridisation and solid-surface amplification occurs but in an all-in-one phase called “exclusion amplification” (ExAmp). Once a library molecule “lands” in a well it should occupy it completely.
  22. 22. Understanding cluster generation (X Ten & 4000) Exclusion Amplification
  23. 23. Understanding sequencing
  24. 24. Understanding sequencing: Sanger-seq
  25. 25. Understanding sequencing: Pyro-seq
  26. 26. Understanding sequencing: Sequencing-by-synthesis
  27. 27. Understanding “sequencing by synthesis”
  28. 28. Understanding “sequencing by synthesis” Instrument “colours” HiSeq, MiSeq 4-colour SBS NextSeq 2-colour SBS Firefly 1-colour SBS?
  29. 29. Instruments explained – HiSeq 2500 & 4000
  30. 30. Different sequencing configurations 2500 Rapid 150M reads SE 50bp 85%Q30 PE 250bp 75%Q30 PE 150 2 days 2500 High output 250M reads SE 50bp 85%Q30 PE 125bp 80%Q30 PE 125 6 days 4000 High output 312M reads SE 50bp 85%Q30 PE 150bp 75%Q30 PE 150 3 days
  31. 31. HiSeq 4000 considerations CLUSTERING IS VERY DIFFERENT FROM 2500 – PE150 - >125 is not great* – %Q30 “passes Illumina spec”* – ExAmp duplicates* – Need to consider how you handle duplicates – RNA-seq is fine – Exome-seq is fine – Genomes are fine
  32. 32. Instruments explained - MiSeq ~600bp fragments +/- 50bp overlap 300bp reads
  33. 33. Instruments explained - NextSeq
  34. 34. NGS QC – library prep QUALITY CONTROL OF LIBRARIES IS IMPORTANT. TITRATION FLOWCELLS AND FAILED RUNS ARE EXPENSIVE. TRY TO IDENTIFY ISSUES BEFORE RUNNING ANY LANES. QC IS SPECIFIC TO YOUR SAMPLES. QUANTITATION OF LIBRARIES IS IMPORTANT. SOME QC CAN ONLY BE DONE ONCE YOU HAVE GENERATED DATA Good Bad Bioanalyser qPCR Analysis
  35. 35. NGS QC – FastQC
  36. 36. NGS QC – MGA
  37. 37. NGS QC – MGA LIBRARY QC – CONTAMINANT DETECTION SAMPLE 100,000 READS FROM FASTQ READS TRIMMED TO 36BP ALIGN TO MULTIPLE GENOMES USING BOWTIE LIBRARY QC – ADAPTER DETECTION SAMPLE 100,000 READS FROM FASTQ READS CONVERTED TO FASTA ALIGN TO “ADAPT-OME” USING EXONERATE LIBRARY QC- YIELD COUNT NUMBER OF READS (SINGLE-END ONLY) DISPLAY NUMBER ON A PRE-DEFINED SCALE DISPLAY LANES IN FLOWCELL CONFIGURATION
  38. 38. NGS QC – MGA
  39. 39. NGS QC – MGA
  40. 40. The Genomics Core sequencing services James Hadfield NEB March 2016
  41. 41. The Genomics Core sequencing services
  42. 42. The Genomics Core sequencing services This Tweet is 6 hours old There are 13 samples in the queue It will take about 1 week to sequence your sample There is 1x paired-end 125bp sample in the queue This is driven by our Genologics LIMs Sequencing is on our Illumina sequencers
  43. 43. Service metrics Jan 2016 – TAT has been 2-3 weeks (often as little as 1 week) – Most sequencing works very well, but…
  44. 44. The Genomics Core sequencing services
  45. 45. The Genomics Core sequencing services
  46. 46. NGS methods
  47. 47. A genomic case report
  48. 48. A genomic case report NFKBIA S32G SIFT: deleterious(0) PolyPhen: probably_damaging(0.979)

×