Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.
Leukocyte Sirtuin 1 mRNA overexpression is associated
with Gestational Diabetes Mellitus (GDM)
Iga A. Turek
Department of ...
Presentation overview
1. Introduction
– Gestational Diabetes Mellitus (GDM)
– Sirtuin 1 (SIRT1)
1. Project aims
2. Methodo...
Introduction
Slide 3 from 11
 GDM (Gestational Diabetes Mellitus)
 glucose intolerance with onset during
pregnancy.
 pr...
Project aims:
to determine SIRT1 mRNA expression in leukocytes of GDM women
at 24-33 weeks of pregnancy
to correlate cha...
Methodology
Slide 5 from 11
RNA isolation
leukocytes separation
GDM (the HAPO criteria)
n=135
control group (NGT)
n=52
ven...
Results
SIRT1 expression
 leukocyte SIRT1 mRNA expression was 1.7-fold higher in GDM vs.
NGT pregnant women
Slide 7 from 11
Correlations of SIRT1 expression
Positive correlations of SIRT1 expression with:
A.glucose concentration at 2 h of OGTT in...
Results:
 increased leukocyte SIRT1 mRNA expression in the GDM women
 association of leukocyte SIRT1 overexpression with...
Conclusions:
 association of GDM with a change in leukocyte SIRT1 expression at its
gene level
 leukocyte SIRT1 expressi...
Thank you
for your attention
Upcoming SlideShare
Loading in …5
×

Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

286 views

Published on

  • Be the first to comment

  • Be the first to like this

Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

  1. 1. Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM) Iga A. Turek Department of Structural Biology Medical University of Lodz Supervisor: Prof. Lucyna A. Woźniak Co-supervisor: Dr Marzena Wójcik
  2. 2. Presentation overview 1. Introduction – Gestational Diabetes Mellitus (GDM) – Sirtuin 1 (SIRT1) 1. Project aims 2. Methodology 3. Results 4. Conclusions Slide 2 from 11
  3. 3. Introduction Slide 3 from 11  GDM (Gestational Diabetes Mellitus)  glucose intolerance with onset during pregnancy.  prevalence: up to 17%  SIRT1 (Sirtuin 1)  NAD+ -dependent histone deacetylase  maintenance of glucose and lipid homeostasis  regulation of insulin secretion  over 20 known substrates
  4. 4. Project aims: to determine SIRT1 mRNA expression in leukocytes of GDM women at 24-33 weeks of pregnancy to correlate changes in leukocyte SIRT1 expression with clinical characteristics of subjects Slide 4 from 11
  5. 5. Methodology Slide 5 from 11 RNA isolation leukocytes separation GDM (the HAPO criteria) n=135 control group (NGT) n=52 venous blood leukocytes RNA RBC lysis buffer in hypotonic conditions qRT-PCR SIRT1 Primer sequence 5’→3’ cDNA amplicon size Reverse: TGTGACAGAGAGATGGCTGG 142Forward: GCTCGCCTTGCTGTAGACTT
  6. 6. Results
  7. 7. SIRT1 expression  leukocyte SIRT1 mRNA expression was 1.7-fold higher in GDM vs. NGT pregnant women Slide 7 from 11
  8. 8. Correlations of SIRT1 expression Positive correlations of SIRT1 expression with: A.glucose concentration at 2 h of OGTT in the whole study group (NGT + GDM) B.HDL-cholesterol in NGT group Slide 8 from 11
  9. 9. Results:  increased leukocyte SIRT1 mRNA expression in the GDM women  association of leukocyte SIRT1 overexpression with hyperglycemia in diabetic subjects  positive correlation between leukocyte SIRT1 expression and HDL- cholesterol in health pregnant women Slide 9 from 11
  10. 10. Conclusions:  association of GDM with a change in leukocyte SIRT1 expression at its gene level  leukocyte SIRT1 expression is related to hyperglycemic conditions  potential protective role of leukocyte SIRT1 against CVD in healthy pregnancy Slide 10 from 11
  11. 11. Thank you for your attention

×