qPCR Design Strategies for Specific Applications

3,279 views

Published on

Species-Specific, Strain-Specific, and CNV Assay Design Considerations

Published in: Science, Technology
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
3,279
On SlideShare
0
From Embeds
0
Number of Embeds
584
Actions
Shares
0
Downloads
167
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide
  • Genes involved in development and stress regulation (temperature and salt responsive genes)
  • qPCR Design Strategies for Specific Applications

    1. 1. Integrated DNA Technologies Elisabeth Wagner Scientific Applications Specialist qPCR Design Strategies for Specific Applications Species-Specific, Strain-Specific, and CNV Assay Design Considerations
    2. 2. 1 Learning Outcomes  You will:  Understand the different types of design specifications for species and splice- form specific qPCR and CNV assays.  Identify design considerations for different experimental scenarios and adjust the basic qPCR design parameters accordingly  Learn how to do an alignment of sequences to discover both unique and similar regions  Learn how to design Copy Number Variations assays
    3. 3. 2 General Design Strategy Outline for Specific qPCR Design Parameters: 1. NCBI- sequence accession www.ncbi.nlm.nih.gov 2. Clustal O alignment www.ebi.ac.uk/Tools/msa/clustalo/ 3. Identify common or unique target regions 4. PrimerQuest® Tool www.idtdna.com/scitools 5. NCBI Blast http://blast.ncbi.nlm.nih.gov/Blast.cgi 6. OligoAnalyzer® Tool—for analysis of hairpins/dimers www.idtdna.com/scitools
    4. 4. 3 General Design Considerations
    5. 5. 4 Primer and Probe Design Criteria  Primers:  Tm: similar Tm (+/- 2°C), 60-62°C  Length: 18-30 bases  GC content: 35-65% (50% ideal), avoid runs of >4 G’s  Sequence: avoid hairpins, dimers (self and hetero)  Avoid SNPs (a single mismatch can alter Tm up to 8°C)  Avoid non-specific primers  Probe:  Tm: 4-10°C higher than primers  Length: <30bp for DLP, longer with ZEN™ (enhanced quenching)  GC content: 30-80%, minimize runs of G  Sequence: avoid G base at 5’ end  Location: sense or antisense  Amplicon:  ~70-200bp
    6. 6. 5 Know your Gene  Understand your gene of interest  Transcript variants  Exon organization  SNP locations  NCBI Gene database Your gene of interest here Tfrc
    7. 7. 6 Obtain Sequences in FASTA Format- NCBI Nucleotide  Go to NCBI:
    8. 8. 7 Obtain Sequences in FASTA Format- NCBI Nucleotide
    9. 9. 8 Sequence Alignment (i.e., Clustal Omega)  http://www.ebi.ac.uk/Tools/msa/clustalo/  ClustalO
    10. 10. 9 Analyze Alignment Output to Determine Optimal Design Regions Export alignment and save as a word document for easier manipulation
    11. 11. 10 Designing to Avoid Genomic DNA Amplification  Design primer across exon-exon junctions  Design primers within 2 adjacent exons spanning a large intron  DNase treatment to eliminate gDNA amplification Decoded 1.3
    12. 12. 11 Design Strategy 1: qPCR assay to differentiate between 2 similar genes
    13. 13. 12 Sample Design: qPCR Assay to Distinguish RCI2A vs. 2B in Arabidopsis Thaliana
    14. 14. 13 1. Clustal O Sequence Alignment: RCI2A vs. RCI2B 1. 2.
    15. 15. 14 Target Sequence Entry into PrimerQuest®
    16. 16. 15 PrimerQuest® Assay Details: • BLAST each primer pair for target specificity • Check for SNP’s (if applicable/annotated, not necessary here) • OligoAnalyzer- Check primers and probes for dimers/hairpins
    17. 17. 16 RCI2B Specific Design Strategy:
    18. 18. 17 PrimerQuest® Tool 2. Enter Region of Interest into PrimerQuest® Tool
    19. 19. 18 PrimerQuest® Assay Details:
    20. 20. 19 PrimerQuest® Assay Details:
    21. 21. 20 qPCR Assay to Distinguish RCI2A vs. 2B in Arabidopsis Thaliana • BLAST each primer pair for target specificity, select highly specific assay • Check for SNP’s (if applicable/annotated, not necessary here) • OligoAnalyzer- Check primers and probes for dimers/hairpins RCI2A: Primer F: GAGAGCGTTGGTTTGTACTTTG Tm:62°C Primer R: TGGTTAATGGTGGTCCTGT Tm: 62°C Probe: TGGAAATTGTGTTGCCTTGGTGGA Tm: 68°C RCI2B Primer F: GGTTATCTTCCCGGAATCCTTTA Tm : 62°C Primer R: AATCAGTCCCAAAGGGAGAAG Tm : 62°C Probe: TTTCCTCTTGCTCCTCGAAGAACAGC Tm : 68°C
    22. 22. 21 Design Strategy 2: qPCR Assay to Distinguish Between 2 Homologous Microbial Sequences
    23. 23. 22 Strain Specific qPCR Design for 2 Helicoverpa NPV Strains Helicoverpa zea single nucleopolyhedrovirus strain—virus that infects earworm, which feeds on plants/crops Obtain sequences of interest from NCBI  >Helicoverpa_zea  CGCCCAAAAATAACGTACTTTTAAACTGGTCTTGGATCATTTCGTTCGAAACGGGCCGTGATCTTTTGTTTCGCTTCGTGACCCAAAAAAAACAAATTACGTCATCGACCAAA GTAAAAATTCTTGCGCATGTTTAAACTAGTCTTGGATATTTTCGTTCGAAACGGGCCGTGATCTTTTGTTTCGCTTCGTGACCCAAAAAAACAAATTACGTCATTCGTTTAAAA TATTGCATCATCTTTAAATTCGAAACCCGCCCGCGCTTTCATATGAAACCGTCGGCGAAGATCGATAAATTTTGTTCTAGAACGTTCGATGGTTTGACCCAAAAAACAAATGA CGTCATATAGCGTGCGTCCAATCACAACACGAATCACGCCTTGTCTAAAGATAACATTTCCCGCGCATGTTTAAACTAATCTTGGATCTTTTCGTTCGAAACGGGCCGTGATC TTTTGTTTCAATTCATGATTTAGAAAAAAACGAACATAAAATTTTACCGCGCATTTTTAAACTAGTGTTGGATTTTTTTTGTTTGAAACGAGCCGTGATCTTTTCGTTCGAAAC GGGCCGTGATCTTTTCGTTCGAAACGGGCCGTGATCTTTTGTTTCGCTGACTCGTGACCCAAAAAAACAAATCACGTCATTCGTTTAGAATATTGCATCATCTTTAAATTCGA AACTCGCCCGCGCTTTCATACGAAACCGCCGGCAAAGATCGGTAAAATTTGTTCTAGAACTTTCCACGGCTTGACCCAAAAAAACAAATGACGTCATATGGCGTGATTTTAA ATCTATTTAATCGTCTCTGGCGTACAAAAGTAAATTACACACGAAACGTGCCATGTTAAGTTTGTTTACAATGAAACTGATTGTGTCGATTTTAATATGGACATAAGATTTTT GCAAAAAAATTCCATTAATCGAACGAATGCGACAATAAACAGTTCGTTTGTTATACCAAATCGAAATGCGTTTGTATATTATTCACAATCCATCAATTCAAAACATGCCTCGT CGACGTCGTTCGCGTACGCATAATTATAATGATCGAACAATTGTTTCAATGAAGTGAAACCGGTT  >Helicoverpa_armigera  AACTGTCTGATCTTTGTTGAAACGGGCCGTGATCTTGTTCGACTCGTGACCAAAAAACAAATGACATCATCGACCAAAAATCCCGCGCATGTTTAAACTAGTCTTGGATCTTT CGTTCAAAACATGACGTAATCTTTCGTTCTACTCGTGACCCAAAAAAACAAATTACGTCATTTGTTTAAATTATTGCATCATCTTTAAATTCAAAACTCGCCCGCGCTTTCATAT AAAACCGTCGGCGAAGATCGATAAAATTTGTTTTAGAACATTCCACGGCTTGACCCAAAAAAACAAATGACGTCATATAGCGTGATTTGAAAATCGTCCAATCACAACACGA ATCACGCCTTGTCTAAAGATAACATTTCCCGCGCATGTTTAAAATAGTCTTGGATCTTTTCGTTCGAAACGGGCCGTGATCTTTTGTTTCGACTTATGATTTAGAAAAAAACG AACATAAAATTTTACCGCGCATTTTTAAACTAGTCTAGGATCTTTTCGTTCAAAACGGGCCGTAATCTTTTGTTCAAAACGGGCCGTAATCTTTTCGTTCGAAACGGGCCGTG ATCTTTTGTTTCGCTGACTCGTGACCCAAAAAAACAAATCACGTCATCCGTTTAGGATATTGCATCATCTTTAAATTCAAAACCCGCCCGCGCTTTCATATGAAACCGTCGGC AAAGATCGGTAAAATTTGTTCTAGAACGTTCCACGGCTTGACCCAAAAAACAAATGACGTCATATGGCGTTTAATCAATCTTTGGCGTACAAAAGTAAATTACACACGAAAC GTGCCATGTTAAGTTTGTTTACAATGAAACTGATTGTGTCGATTTTAATATGGACATAAGATTTTTGCAAAAAAATTCCATTAATCGAACGAAAGCGACAATAAACAGTTCGT TTGTTATACCAAATCGAAATACGTTTGTATATTATTCACAATCCATCAATTCAAAACATGCCTCGTCGACGTCGTTCGCGTACGCATAATTATAATGATCGAACAATTGTTTCA ATGAAGTGAAACCGGTT
    24. 24. 23 qPCR Assay to Distinguish Related Viral Strains 11
    25. 25. 24 Input the Targeted Design Area into PrimerQuest® Tool PrimerQuest® Tool
    26. 26. 25 Adjust Parameters for qPCR (Probe Assay)
    27. 27. 26 Use the Custom Design Parameters to Target Probe Area Target the probe region using the Excluded Region List
    28. 28. 27 Analyze Potential Assays: • BLAST each primer pair for target specificity, select highly specific assay • Check for SNP’s • OligoAnalyzer- Check primers and probes for dimers/hairpins
    29. 29. 28 Probe Specificty- Amigera Strain Specific Design TGGCGTGATTTTAAATCTATTTAA |||| | ||| |||||| TGGCGTTTAATCAATCTTTGGCGT Probe mismatch: Probe won’t be able to bind
    30. 30. 29 Repeat Process to Obtain Zea Strain Specific Design Zea (top sequence) Identify unique target region for design
    31. 31. 30 Analyze Potential Assays
    32. 32. 31 Zea Strain Specific Design In this example, the probe again won’t bind, but also the forward primer has multiple mismatches • BLAST each primer pair for target specificity, select highly specific assay • Check for SNP’s • OligoAnalyzer- Check primers and probes for dimers/hairpins
    33. 33. 32 Copy Number Variation (CNV) Assays
    34. 34. 33 Designing Assays for Copy Number Variation Estivill and Armengol, (2007) PLOS Genetics  Copy Number Variations (CNVs) are important polymorphisms that can influence the expression of genes within and close to a rearranged region.  This allows for transcription levels to be higher or lower than those that can be achieved by control of transcription of a single gene copy.  CNVs are being associated more and more with genetic diseases such as cancer, neurological disorders, and immune diseases.  PrimeTime® qPCR Assays can be designed to specifically evaluate the copy number of genomic DNA targets.
    35. 35. 34 Important Considerations for CNV Designs  1. Design an assay that is within a single exon of the gene of interest  Obtain sequence information for a single exon in NCBI Nucleotide  By accession number or BLAST  Exon information also available in NCBI Gene
    36. 36. 35 • BLAST each primer pair for target specificity, select highly specific assay • Use OligoAnalyzer® Tool to check primers and probes for dimers/hairpins • Check for SNPs Input Sequence for a Single Exon Using PrimerQuest® Tool
    37. 37. 36 Single Copy Reference- Important for CNV Assays Commonly used examples:  Human- RNaseP Primer F: AGATTTGGACCTGCGAGCG Primer R: GAGCGGCTGTCTCCACAAGT Probe: 5’Hex/TTCTGACCT/ZEN/GAAGGCTCTGCGCG/3IABkFQ/  Mouse- TFRC (or TERT) Primer F: CTAAGTCTACAGTGGCTGTATTCC Primer R: GATCATTGATTTCCCTCATGACAAA Probe: /5HEX/TCGTGGAGA/ZEN/CTACTTCCGTGCTACT/3IABkFQ
    38. 38. 37  Questions?

    ×