Oligo:Ab conjugates
an application guide

© Innova Biosciences ltd. 2013. All rights reserved
Tom Speedy, Corporate Business Manager, Innova Biosciences (UK)
With an academic background in aquatic toxicology, Tom mov...
IDT Oligos + Thunder-Link® Conjugation Kit

© Innova Biosciences ltd. 2013. All rights reserved
Integrated  DNA  Technologies  (IDT)  is  the  world’s  largest  supplier  of  custom  
nucleic acids

Key Operating Stati...
IDT Facility Locations

Coralville, IA (Headquarters)
• 14,300 square meters
• Global Infrastructure, Production and
suppo...
How to Order an Oligo

© Innova Biosciences ltd. 2013. All rights reserved
How to Design an Oligo

Standard sequence motifs to avoid
• Minimize homopolymers (e.g. CCCCCCC)
• 5’  Amino  or  Thiol  m...
How to Synthesize an Oligo

5’  GCACTTCAGGCTCCTGGGCC  3’

© Innova Biosciences ltd. 2013. All rights reserved
How to Synthesize an Oligo

5’  GCACTTCAGGCTCCTGGGCC 3’
START HERE

100–175 µm
particle size
Electron microscope image

© ...
How to Synthesize an Oligo

5’  GCACTTCAGGCTCCTGGGCC  3ʹ′

Unmasking of growth
protecting
group

Coupling of
next base

Sy...
How to Synthesize an Oligo

5’  GCACTTCAGGCTCCTGGGCC  3ʹ′

Unmasking of growth
protecting
group

Coupling of
next base

Sy...
How to Synthesize an Oligo

5’  GCACTTCAGGCTCCTGGGCC  3ʹ′

Unmasking of growth
protecting
group

Coupling of
next base

Sy...
How to Synthesize an Oligo

5’  GCACTTCAGGCTCCTGGGCC  3ʹ′

Unmasking of growth
protecting
group

Coupling of
next base

Sy...
How to Synthesize an Oligo

5’  GCACTTCAGGCTCCTGGGCC  3ʹ′

Unmasking of growth
protecting
group

Coupling of
next base

Sy...
How to Synthesize an Oligo

5’  GCACTTCAGGCTCCTGGGCC  3ʹ′

Unmasking of growth
protecting
group

Coupling of
next base

Sy...
How to Synthesize an Oligo

5’  GCACTTCAGGCTCCTGGGCC  3ʹ′

Unmasking of growth
protecting
group

The synthesis cycle
requi...
How to Synthesize an Oligo

5’  GCACTTCAGGCTCCTGGGCC  3ʹ′

Unmasking of growth
protecting
group

Coupling of
next base

Sy...
How to Synthesize an Oligo

5ʹ′  GCACTTCAGGCTCCTGGGCC  3ʹ′

Unmasking of growth
protecting
group

Coupling of
next base

S...
How to Synthesize an Oligo

5ʹ′  GCACTTCAGGCTCCTGGGCC  3ʹ′

Unmasking of growth
protecting
group

A 20nt oligo can
be synt...
Coupling Efficiency vs. Full-Length Product
100%
90%

Full-Length Product (%)

80%
70%

60%
50%

99.25% - IDT Standard Oli...
Coupling Efficiency vs. Full-Length Product
100%
90%

Full-Length Product (%)

80%
70%

60%
50%

99.25% - IDT Standard Oli...
5ʹ′  ATCTGACTATGACTGACTGACTGACAGACTACTGACTGACTATCTGACTGA
TCTGCAACACGCAAGGTCGGCGAT-Amino  3ʹ′
Before HPLC Purification

Aft...
Amino and Thiol Modifiers

5ʹ′  Amino  Modifier

5ʹ′  Thiol  Modifier

© Innova Biosciences ltd. 2013. All rights reserved
Amino and Thiol Modifiers – Molecular Dust Mops
(Strong Nucleophiles)

5ʹ′  Amino  Modifier

5ʹ′  Thiol  Modifier

© Innov...
5ʹ′  Amino  – GTGGATCTGCGCACTTCAGGCTCCTGGGCA  3ʹ′
Before HPLC Purification

70.8% Target Sequence
© Innova Biosciences ltd...
5ʹ′ Amino – GTGGATCTGCGCACTTCAGGCTCCTGGGCA 3ʹ′
Before HPLC Purification

70.8% Target Sequence
© Innova Biosciences ltd. 2...
5ʹ′ Amino – GTGGATCTGCGCACTTCAGGCTCCTGGGCA 3ʹ′
Before HPLC Purification

Target Sequence

Blocked Amino Modifier

70.8% Ta...
5ʹ′ Amino – GTGGATCTGCGCACTTCAGGCTCCTGGGCA 3ʹ′ (MW=9394.1Da)
Electrospray Ionization Mass Spec (ESI-MS) – “Molecular  Rule...
5ʹ′ Amino – GTGGATCTGCGCACTTCAGGCTCCTGGGCA 3ʹ′
Before HPLC Purification

After HPLC Purification

70.8% Target Sequence

9...
IDT Oligos + Thunder-Link® Conjugation Kit

© Innova Biosciences ltd. 2013. All rights reserved
1. Introduction
2. Traditional Immunoassays
3. Improving on colorimetric assays
4. Conjugating oligonucleotides to antibod...
Introduction
2002

Founded, Cambridge UK

2004

Assay services (pharmaceuticals)

2005

Custom antibody labelling

2006

F...
4 main product categories:

Introduction

• Lightning-Link®: enables labeling of biomolecules, with
just 30 seconds hands-...
Traditional Immunoassays
1. Antibody specific for target antigen

SANDWICH
DIRECT

© Innova Biosciences ltd. 2013. All rig...
Traditional Immunoassays
1. Antibody specific for target antigen
2. Suitable visualisation method – e.g.
enzyme, fluoresce...
Traditional Immunoassays
ELISA

Lateral Flow

© Innova Biosciences ltd. 2013. All rights reserved
Traditional Immunoassays
ELISA
Detection Limits

µg to pg

Amount of starting
material required

µl

• Can be used to dete...
Improving on colorimetric detection

ELISA
Detection Limits
Amount of starting
material required

Oligo-linked immunosorbe...
Improving on colorimetric detection
Oligo-linked immunosorbent
assay
Detection Limits

pg to fg

Amount of
starting materi...
Conjugating oligonucleotides to antibodies
The quality and sensitivity of the assay is directly related to the quality of ...
Conjugating oligonucleotides to antibodies
To overcome these issues, the Thunder-Link® conjugation
system has been designe...
Conjugating oligonucleotides to antibodies

© Innova Biosciences ltd. 2013. All rights reserved
Conjugating oligonucleotides to antibodies
A

B

C

D

E

Non-Reduced antibody

Banding is more often seen
with mAbs than ...
Conjugating oligonucleotides to antibodies
Protein

DNA

Higher order
conjugates
H chain-oligo
conjugate
H

L

L chain-oli...
© Innova Biosciences ltd. 2013. All rights reserved
Applications using oligonucleotide:antibody conjugates
• ImmunoPCR assays
• Proximity Ligation Assays
• Proximity Extensio...
© Innova Biosciences ltd. 2013. All rights reserved
Applications using oligonucleotide:antibody conjugates
The number of publications discussing ImmunoPCR (Pubmed)

No of occ...
ImmunoPCR

Sano, T., Smith, C. and Cantor, C., 1992. Immuno-PCR: Very Sensitive Antigen
Detection by Means of Specific Ant...
A New Tool for Paleomicrobiology:
The Plague Paradigm

ImmunoPCR

• Degradation of DNA limits ability to detect
ancient in...
Proximity Ligation Assays

© Innova Biosciences ltd. 2013. All rights reserved
Proximity Extension Assays

© Innova Biosciences ltd. 2013. All rights reserved
Proximity Extension Assays

© Innova Biosciences ltd. 2013. All rights reserved
Proximity Extension Assays

Conventional immunoassays: cross-reactivity due to unspecific binding of antibodies
limits the...
Proximity Extension Assays

Proseek Multiplex: unique DNA oligo sequences report only matched DNA-pairs (e.g.
1A+1B). Cros...
3DNA Technology in Lateral Flow
Highly biotinylated 3DNA is customized
with specific detection antibody-oligo
conjugates. ...
3DNA Technology in Lateral Flow
3DNA Assay

Reference Assay
40nm streptavidin-gold
nanoparticles bind to biotinylated
dete...
3DNA Technology in Cellular Staining
Fluorescent 3DNA customized with transferrin receptor antibodyoligonucleotide conjuga...
IDT Oligos + Thunder-Link® Conjugation Kit

© Innova Biosciences ltd. 2013. All rights reserved
Innova Biosciences Ltd.
Babraham Research  Campus,  
Cambridge, UK,
CB22 3AT

www.innovabiosciences.com
Lightning-Link® is...
Upcoming SlideShare
Loading in …5
×

Oligo:Antibody Conjugates—An Application Guide

2,982 views

Published on

In this joint slidedeck, oligonucleotide synthesis specialists Integrated DNA Technologies (IDT) join with bioconjugation experts Innova Biosciences to explain the importance of using top quality reagents when preparing oligonucleotide-antibody conjugates. Antibody-oligonucleotide conjugates are the next generation of tools in biomarker detection, overcoming sensitivity and linear range issues often encountered with standard antibody labels.

Published in: Technology, Business
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
2,982
On SlideShare
0
From Embeds
0
Number of Embeds
4
Actions
Shares
0
Downloads
77
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Oligo:Antibody Conjugates—An Application Guide

  1. 1. Oligo:Ab conjugates an application guide © Innova Biosciences ltd. 2013. All rights reserved
  2. 2. Tom Speedy, Corporate Business Manager, Innova Biosciences (UK) With an academic background in aquatic toxicology, Tom moved into the diagnostics industry as an R&D Scientist with a UK based forensic toxicology/drug testing company. He spent 7 years developing a number of successful products, including being part of the team that developed a saliva based drugs of abuse test for roadside and POC testing that won the Queens Award for Innovation. Tom now manages the corporate business for Innova Biosciences, working with diagnostics, pharma, biotech, R&D and contract research companies globally. Jessica Alexander, VP Specialty Manufacturing and Services Integrated DNA Technologies (Coralville, IA, USA) Ms. Alexander graduated with a B.S degree in Chemistry from the University of Iowa in 1997. Five days after her graduation she began working for IDT and has happily made oligos ever since. She oversees manufacturing operations for modified nucleic acids and GMP services. © Innova Biosciences ltd. 2013. All rights reserved
  3. 3. IDT Oligos + Thunder-Link® Conjugation Kit © Innova Biosciences ltd. 2013. All rights reserved
  4. 4. Integrated  DNA  Technologies  (IDT)  is  the  world’s  largest  supplier  of  custom   nucleic acids Key Operating Statistics          >80,000 active customers >42,000 oligos ordered per day >2,800 orders shipped per day >95% orders entered over the web > 270,000 web site visits per month (117,000 unique visitors) > 85,000 phone calls per year > 23,000 web chats per year 29 global sales professionals >750 Employees © Innova Biosciences ltd. 2013. All rights reserved
  5. 5. IDT Facility Locations Coralville, IA (Headquarters) • 14,300 square meters • Global Infrastructure, Production and support offices • ISO 9001:2008 certified • 3,100 square feet, ISO 13485:2003 and FDA-registered clean room Skokie, IL •Administrative and Financial Office Leuven, Belgium • 2,010 square meters • ISO 9001:2008 certified • Eurozone & Middle East Production and support San Diego, CA • 1,654 square meters • ISO:9001:2008 certified • Next Day production for Western United States Singapore • 560 square meters • Asia Market Production and Support © Innova Biosciences ltd. 2013. All rights reserved
  6. 6. How to Order an Oligo © Innova Biosciences ltd. 2013. All rights reserved
  7. 7. How to Design an Oligo Standard sequence motifs to avoid • Minimize homopolymers (e.g. CCCCCCC) • 5’  Amino  or  Thiol  modification  is  slightly   favored  over  3’  positions • Avoid G-quadruplexes © Innova Biosciences ltd. 2013. All rights reserved
  8. 8. How to Synthesize an Oligo 5’  GCACTTCAGGCTCCTGGGCC  3’ © Innova Biosciences ltd. 2013. All rights reserved
  9. 9. How to Synthesize an Oligo 5’  GCACTTCAGGCTCCTGGGCC 3’ START HERE 100–175 µm particle size Electron microscope image © Innova Biosciences ltd. 2013. All rights reserved
  10. 10. How to Synthesize an Oligo 5’  GCACTTCAGGCTCCTGGGCC  3ʹ′ Unmasking of growth protecting group Coupling of next base Synthesis Cycle Capping of coupling failures Oxidizing internucleotide bond © Innova Biosciences ltd. 2013. All rights reserved
  11. 11. How to Synthesize an Oligo 5’  GCACTTCAGGCTCCTGGGCC  3ʹ′ Unmasking of growth protecting group Coupling of next base Synthesis Cycle Cycle #1 Capping of coupling failures Oxidizing internucleotide bond © Innova Biosciences ltd. 2013. All rights reserved
  12. 12. How to Synthesize an Oligo 5’  GCACTTCAGGCTCCTGGGCC  3ʹ′ Unmasking of growth protecting group Coupling of next base Synthesis Cycle Cycle #1 Capping of coupling failures Oxidizing internucleotide bond © Innova Biosciences ltd. 2013. All rights reserved
  13. 13. How to Synthesize an Oligo 5’  GCACTTCAGGCTCCTGGGCC  3ʹ′ Unmasking of growth protecting group Coupling of next base Synthesis Cycle Cycle #1 Capping of coupling failures Oxidizing internucleotide bond © Innova Biosciences ltd. 2013. All rights reserved
  14. 14. How to Synthesize an Oligo 5’  GCACTTCAGGCTCCTGGGCC  3ʹ′ Unmasking of growth protecting group Coupling of next base Synthesis Cycle Cycle #1 Capping of coupling failures Oxidizing internucleotide bond © Innova Biosciences ltd. 2013. All rights reserved
  15. 15. How to Synthesize an Oligo 5’  GCACTTCAGGCTCCTGGGCC  3ʹ′ Unmasking of growth protecting group Coupling of next base Synthesis Cycle Cycle #1 Capping of coupling failures Oxidizing internucleotide bond © Innova Biosciences ltd. 2013. All rights reserved
  16. 16. How to Synthesize an Oligo 5’  GCACTTCAGGCTCCTGGGCC  3ʹ′ Unmasking of growth protecting group The synthesis cycle requires between 3 and 8 minutes. Coupling of next base Synthesis Cycle Cycle #1 Capping of coupling failures Oxidizing internucleotide bond © Innova Biosciences ltd. 2013. All rights reserved
  17. 17. How to Synthesize an Oligo 5’  GCACTTCAGGCTCCTGGGCC  3ʹ′ Unmasking of growth protecting group Coupling of next base Synthesis Cycle Cycle #2 Capping of coupling failures Oxidizing internucleotide bond © Innova Biosciences ltd. 2013. All rights reserved
  18. 18. How to Synthesize an Oligo 5ʹ′  GCACTTCAGGCTCCTGGGCC  3ʹ′ Unmasking of growth protecting group Coupling of next base Synthesis Cycle Cycle #3 Capping of coupling failures Oxidizing internucleotide bond © Innova Biosciences ltd. 2013. All rights reserved
  19. 19. How to Synthesize an Oligo 5ʹ′  GCACTTCAGGCTCCTGGGCC  3ʹ′ Unmasking of growth protecting group A 20nt oligo can be synthesized in one hour. Coupling of next base Synthesis Cycle Cycle #19 Capping of coupling failures Oxidizing internucleotide bond © Innova Biosciences ltd. 2013. All rights reserved
  20. 20. Coupling Efficiency vs. Full-Length Product 100% 90% Full-Length Product (%) 80% 70% 60% 50% 99.25% - IDT Standard Oligos 40% 98.5% - Industry Standard 30% 20% 10% 0% 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100 Oligo Length (nt) © Innova Biosciences ltd. 2013. All rights reserved
  21. 21. Coupling Efficiency vs. Full-Length Product 100% 90% Full-Length Product (%) 80% 70% 60% 50% 99.25% - IDT Standard Oligos 40% 98.5% - Industry Standard 30% 20% 10% 0% 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100 Oligo Length (nt) © Innova Biosciences ltd. 2013. All rights reserved
  22. 22. 5ʹ′  ATCTGACTATGACTGACTGACTGACAGACTACTGACTGACTATCTGACTGA TCTGCAACACGCAAGGTCGGCGAT-Amino  3ʹ′ Before HPLC Purification After HPLC Purification 62.7% Target Sequence 98.4% Target Sequence © Innova Biosciences ltd. 2013. All rights reserved
  23. 23. Amino and Thiol Modifiers 5ʹ′  Amino  Modifier 5ʹ′  Thiol  Modifier © Innova Biosciences ltd. 2013. All rights reserved
  24. 24. Amino and Thiol Modifiers – Molecular Dust Mops (Strong Nucleophiles) 5ʹ′  Amino  Modifier 5ʹ′  Thiol  Modifier © Innova Biosciences ltd. 2013. All rights reserved
  25. 25. 5ʹ′  Amino  – GTGGATCTGCGCACTTCAGGCTCCTGGGCA  3ʹ′ Before HPLC Purification 70.8% Target Sequence © Innova Biosciences ltd. 2013. All rights reserved
  26. 26. 5ʹ′ Amino – GTGGATCTGCGCACTTCAGGCTCCTGGGCA 3ʹ′ Before HPLC Purification 70.8% Target Sequence © Innova Biosciences ltd. 2013. All rights reserved
  27. 27. 5ʹ′ Amino – GTGGATCTGCGCACTTCAGGCTCCTGGGCA 3ʹ′ Before HPLC Purification Target Sequence Blocked Amino Modifier 70.8% Target Sequence 8.8% Blocked Amino Modifier © Innova Biosciences ltd. 2013. All rights reserved
  28. 28. 5ʹ′ Amino – GTGGATCTGCGCACTTCAGGCTCCTGGGCA 3ʹ′ (MW=9394.1Da) Electrospray Ionization Mass Spec (ESI-MS) – “Molecular  Ruler” Target Sequence Mass(Da) 9394.2 9421.8 9447.5 Intensity Delta Mass %Relative 9.27E+04 0 100 9.58E+03 27.6 10.32 2.19E+03 53.3 2.36 %Total 88.74 9.16 2.1 Identity Target Mass Blocked Amino Blocked Amino Blocked Amino Modifier © Innova Biosciences ltd. 2013. All rights reserved
  29. 29. 5ʹ′ Amino – GTGGATCTGCGCACTTCAGGCTCCTGGGCA 3ʹ′ Before HPLC Purification After HPLC Purification 70.8% Target Sequence 94.4% Target Sequence © Innova Biosciences ltd. 2013. All rights reserved
  30. 30. IDT Oligos + Thunder-Link® Conjugation Kit © Innova Biosciences ltd. 2013. All rights reserved
  31. 31. 1. Introduction 2. Traditional Immunoassays 3. Improving on colorimetric assays 4. Conjugating oligonucleotides to antibodies 5. Applications using oligonucleotide:antibody conjugates © Innova Biosciences ltd. 2013. All rights reserved
  32. 32. Introduction 2002 Founded, Cambridge UK 2004 Assay services (pharmaceuticals) 2005 Custom antibody labelling 2006 First Lightning-Link® conjugation kit launched 2009 Oligonucleotide  conjugation  systems  (‘Proactive’) 2010 Nanoparticle R&D projects initiated 2012 InnovaCoat® Gold kit launched; ISO9001 achieved 2013 Thunder-Link® kit launched © Innova Biosciences ltd. 2013. All rights reserved
  33. 33. 4 main product categories: Introduction • Lightning-Link®: enables labeling of biomolecules, with just 30 seconds hands-on time, to a wide range of enzymes, fluorescent dyes, biotin & streptavidin • InnovaCoat®: range of gold nanoparticle conjugation kits including different particle sizes and surface chemistries • Thunder-Link®: facilitates conjugation of oligonucleotides to antibodies, proteins or gold nanoparticles • Phosphate detection: non-radioactive colorimetric assays with unparalleled stability © Innova Biosciences ltd. 2013. All rights reserved
  34. 34. Traditional Immunoassays 1. Antibody specific for target antigen SANDWICH DIRECT © Innova Biosciences ltd. 2013. All rights reserved
  35. 35. Traditional Immunoassays 1. Antibody specific for target antigen 2. Suitable visualisation method – e.g. enzyme, fluorescent dye, nanoparticle SANDWICH DIRECT © Innova Biosciences ltd. 2013. All rights reserved
  36. 36. Traditional Immunoassays ELISA Lateral Flow © Innova Biosciences ltd. 2013. All rights reserved
  37. 37. Traditional Immunoassays ELISA Detection Limits µg to pg Amount of starting material required µl • Can be used to detect a variety of protein and hapten targets • Linear signal and endpoint detection • Established technology • Tolerates a variety of sample matrices and contaminants © Innova Biosciences ltd. 2013. All rights reserved
  38. 38. Improving on colorimetric detection ELISA Detection Limits Amount of starting material required Oligo-linked immunosorbent assay µg to pg pg to fg µl pl Combines the specificity of antibodies with the amplification power of PCR © Innova Biosciences ltd. 2013. All rights reserved
  39. 39. Improving on colorimetric detection Oligo-linked immunosorbent assay Detection Limits pg to fg Amount of starting material required pl • Combines the specificity of antibodies and the benefits of immunoassay technology, with the amplification power of qPCR • Exponential signal and real time detection • High sensitivity requires high quality reagents • Tolerates a variety of sample matrices and contaminants © Innova Biosciences ltd. 2013. All rights reserved
  40. 40. Conjugating oligonucleotides to antibodies The quality and sensitivity of the assay is directly related to the quality of the reagents, therefore: • Oligonucleotide based assays require high quality oligonucleotides • The conjugate must NOT contain fragments of oligonucleotide • The conjugate must NOT contain unbound oligonucleotide Traditional techniques for conjugating antibodies to oligonucleotides are costly, time consuming and require expert knowledge Several methods have been developed although they tend to be very complex, unreliable and often result in the cross linking © Innova Biosciences ltd. 2013. All rights reserved
  41. 41. Conjugating oligonucleotides to antibodies To overcome these issues, the Thunder-Link® conjugation system has been designed to facilitate the generation of antibody-oligonucleotide conjugates Furthermore: • The inclusion of positive controls enables the end user to confirm that the conjugation chemistry is working correctly. • Technology is unidirectional and thus only allows formation of antibody-oligonucleotide complexes and never antibody-antibody or oligonucleotide-oligonucleotide. © Innova Biosciences ltd. 2013. All rights reserved
  42. 42. Conjugating oligonucleotides to antibodies © Innova Biosciences ltd. 2013. All rights reserved
  43. 43. Conjugating oligonucleotides to antibodies A B C D E Non-Reduced antibody Banding is more often seen with mAbs than pAbs © Innova Biosciences ltd. 2013. All rights reserved
  44. 44. Conjugating oligonucleotides to antibodies Protein DNA Higher order conjugates H chain-oligo conjugate H L L chain-oligo conjugate Reducing gel © Innova Biosciences ltd. 2013. All rights reserved
  45. 45. © Innova Biosciences ltd. 2013. All rights reserved
  46. 46. Applications using oligonucleotide:antibody conjugates • ImmunoPCR assays • Proximity Ligation Assays • Proximity Extension Assays • 3DNA Technology in Lateral Flow • 3DNA Technology in Cellular Targeting © Innova Biosciences ltd. 2013. All rights reserved
  47. 47. © Innova Biosciences ltd. 2013. All rights reserved
  48. 48. Applications using oligonucleotide:antibody conjugates The number of publications discussing ImmunoPCR (Pubmed) No of occurrences 100 75 50 25 0 2003 2005 2007 2009 2011 2013 Year © Innova Biosciences ltd. 2013. All rights reserved
  49. 49. ImmunoPCR Sano, T., Smith, C. and Cantor, C., 1992. Immuno-PCR: Very Sensitive Antigen Detection by Means of Specific Antibody-DNA Conjugates. Published by the American Association for the Advancement of Science. © Innova Biosciences ltd. 2013. All rights reserved
  50. 50. A New Tool for Paleomicrobiology: The Plague Paradigm ImmunoPCR • Degradation of DNA limits ability to detect ancient infections • ImmunoPCR against Yersinia pestis can detect protein conc. 70 times lower than standard ELISA (0.74ng compared to 50ng cutoff) • 34 teeth from mass graves of plague victims and 10 negative teeth were tested • ELISA detected 3 of 34 +ves (1 false +ve) • PCR detected 10 of 34 +ves • iPCR detected 14 of 34 +ves Malou N, Tran T-N-N, Nappez C, Signoli M, et al. (2012) Immuno-PCR - A New Tool for Paleomicrobiology: The Plague Paradigm. PLoS ONE 7(2): e31744. doi:10.1371/journal.pone.0031744 http://www.plosone.org/article/info:doi/10.1371/journal.pone.0031744 © Innova Biosciences ltd. 2013. All rights reserved
  51. 51. Proximity Ligation Assays © Innova Biosciences ltd. 2013. All rights reserved
  52. 52. Proximity Extension Assays © Innova Biosciences ltd. 2013. All rights reserved
  53. 53. Proximity Extension Assays © Innova Biosciences ltd. 2013. All rights reserved
  54. 54. Proximity Extension Assays Conventional immunoassays: cross-reactivity due to unspecific binding of antibodies limits the degree of multiplexing. © Innova Biosciences ltd. 2013. All rights reserved
  55. 55. Proximity Extension Assays Proseek Multiplex: unique DNA oligo sequences report only matched DNA-pairs (e.g. 1A+1B). Cross-reactive events are not detected. © Innova Biosciences ltd. 2013. All rights reserved
  56. 56. 3DNA Technology in Lateral Flow Highly biotinylated 3DNA is customized with specific detection antibody-oligo conjugates. Materials are dried in a Lateral flow Point-of-Care Test. 3DNA Figure 2: 3DNA® Dendrimer with multiple targeting antibodies and hundreds of labels © Innova Biosciences ltd. 2013. All rights reserved
  57. 57. 3DNA Technology in Lateral Flow 3DNA Assay Reference Assay 40nm streptavidin-gold nanoparticles bind to biotinylated detection antibody SA SA SA SA SA Multiple 40nm streptavidin-gold nanoparticles bind to ~1000 biotin labels on 3DNA with detection antibody conjugates SA SA SA SA SA SA SA SA SA © Innova Biosciences ltd. 2013. All rights reserved
  58. 58. 3DNA Technology in Cellular Staining Fluorescent 3DNA customized with transferrin receptor antibodyoligonucleotide conjugates used for HepG2 cell staining Cy3 3DNA (no targeting; no cell staining) Cy3 3DNA hybridized with transferrin receptor antibody-oligo conjugate (lovely cell staining) © Innova Biosciences ltd. 2013. All rights reserved
  59. 59. IDT Oligos + Thunder-Link® Conjugation Kit © Innova Biosciences ltd. 2013. All rights reserved
  60. 60. Innova Biosciences Ltd. Babraham Research  Campus,   Cambridge, UK, CB22 3AT www.innovabiosciences.com Lightning-Link® is a registered trademark of Innova Biosciences DyLight® is a registered trademark of Thermo Fisher Scientific Inc. and its subsidiaries © Innova Biosciences ltd. 2013. All rights reserved

×