iGEM Progress Using High Quality Gene Fragments
•
1 like•989 views
Dr Adam Clore discusses uses for gBlocks® Gene Fragments in the context of the 2015 iGEM competition. Dr Clore also describes how iGEM teams can register to receive 20 kb of free gBlocks Gene Fragments for their projects.
Recommended
Recommended
More Related Content
What's hot
What's hot (20)
Similar to iGEM Progress Using High Quality Gene Fragments
Similar to iGEM Progress Using High Quality Gene Fragments (20)
More from Integrated DNA Technologies
More from Integrated DNA Technologies (9)
Recently uploaded
Recently uploaded (20)
iGEM Progress Using High Quality Gene Fragments
- 1. Engineering genetic machines with gBlocks® Gene Fragments gBlocks® Gene Fragments GEMs 1
- 2. • Founded in 1987 by Dr Joseph Walder • Largest custom oligonucleotide manufacturer worldwide • >840 employees in 6 locations • >95% of ordered products are manufactured and shipped in less than 24 hours Integrated DNA Technologies 2
- 3. Key operating statistics: • >82,000 activecustomers • >44,000 oligos ordered per day • >2500 orders shipped per day • >91% of orders through the web • >270,000websitevisits per month (108,000 uniquevisitors) • >85,000 phonecalls per year • >23,000 web chatsper year The World’s Largest Supplier of Custom Nucleic Acids 3
- 4. 4 IDT Offers More Than Just Primers 4
- 5. Creating long and accuratesynthetic DNA without cloning • High qualityDNA fragments • 125–2000bp in length • Sequence-verified • Short delivery time and low price • 200 ng provided, dry • Mixed bases can be included! gBlocks® Gene Fragments 5
- 6. gBlocks® Gene Fragments—Formats and Pricing 6
- 7. 20 kb of DNA as gBlocks® Gene Fragments free of charge to each iGEM 2015 team! 280 registered teams This is about 5.6 Mbp of DNA! 2015 IDT iGEM Sponsorship 7 Courtesy of iGEM Team Freiburg
- 8. The Many Uses of gBlocks® Gene Fragments 8
- 9. • Customized BioBrick™ parts What Can be Built With gBlocks® Gene Fragments? 9
- 10. • Customized BioBrick™ parts • Codon optimized components What Can be Built With gBlocks® Gene Fragments? 10
- 11. • Customized BioBrick™ parts • Codon optimized components • Complete circuits What Can be Built With gBlocks® Gene Fragments? 11
- 12. • Customized BioBrick™ parts • Codon optimized components • Complete circuits • Anything else! Important: The iGEM rules for parts construction states that your parts sequences must not contain the restriction sites of the BioBrick prefix and suffix: EcoRI, XbaI, SpeI, PstI. What Can be Built With gBlocks® Gene Fragments? 12
- 13. • gBlocks Gene Fragments with 20–40 bp overlaps designed by the researcher or by IDT specialists • gBlocks Gene Fragments and vector are assembled using the Gibson Assembly® Method • Construct is transformed and screened for the correct sequence Isothermal Assembly of Multiple gBlocks® Gene Fragments 13
- 14. How Isothermal Assembly of gBlocks® Gene Fragments Works Step 1: gBlocks Gene Fragments are designed with 30 bp overlaps on the 3ʹ′ strand. Step 2: A mesophilic exonuclease cleaves bases from the 5ʹ′ end of the double-stranded DNA fragments, before being inactivated by the 50°C reaction temperature. Step 3: The newly generated, complementary, single- stranded 3ʹ′ ends anneal. Step 4: A high fidelity DNA polymerase fills in any single-strandedgaps. Step 5: Finally, a thermophilic DNA ligase covalently joins the DNA segments. The Gibson Assembly® Method 14
- 15. The Many Uses of gBlocks® Gene Fragments 15
- 16. gBlocks® Gene Fragments for CRISPR 16
- 17. gBlocks® Gene Fragments for Homology Directed Repair 17
- 18. gBlocks® Gene Fragments for CRISPR CRISPR gBlocks® fragment, 364 bp, expression cassette includes a 265 bp U6 promoter driving transcription of a 99 bp sgRNA AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATA ATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAG TTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCT TTATATATCTTGTGGAAAGGACGAAACACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAA AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT • www.idtdna.com/CRISPR 18 Red = U6 promoter Black = 20 bp guide sequence Green = sgRNA (tracrRNA fusion)
- 19. gBlocks® Gene Fragments as gRNAs—Two Methods 19 1. Clone gBlocks Gene Fragments into an expression plasmid
- 20. gBlocks® Gene Fragments as gRNAs—Two Methods 20 1. Clone gBlocks Gene Fragments into an expression plasmid 2. Directly transform gBlocks Gene Fragments into cells without cloning • www.idtdna.com/CRISPR • http://www.addgene.org/static/cms/fil es/hCRISPR_gRNA_Synthesis.pdf Current Protocols in Molecular Biology (2014) 31.1.1–31.1.17.
- 21. CRISPR gBlocks® gRNAs in the HPRT gene (HEK 293 cells) 38094 S 38095 S 38115 S 38129 S 38231 S 38239 S 38256 S 38338 S 38371 S 38448 S 38478 S 38509 S 38510 S 38574 S 38626 S + 18% 27% 39% 19% 0% 22% 20% 47%0% 0%26% 5% 26% 19%0% 2% Agarose gel Fragment Analyzer™ >400 sites tested in HPRT and EMX; more genes in progress Note: sequence analysis shows 30% cleavage in T7E1 assay = 60–75% real change
- 22. Predicted CRISPER Activity vs. Actual Activity
- 23. gBlocks® Gene Fragments Outperform IVT sgRNAs 23 • IVT RNA was treated with phosphatase to remove 5′-ppp. Even so, these RNAs were very toxic using lipid transfection, triggering innate immune responses even in HEK293 cells.
- 24. The Many Uses of gBlocks® Gene Fragments 24
- 25. Adding mixed bases to gBlocks Gene Fragments: • Basic designs can be ordered directly from the web, if they meet the criteria described at www.idtdna.com/gblocks Uses of gBlocks Gene Fragment libraries: • Binding site engineering • Catalytic site analysis • Antibody engineering • Vaccine development • DNA binding analysis gBlocks® Gene Fragments Libraries 25 Questions? genes@idtdna.com
- 26. www.idtdna.com/CRISPR • Webinars • CRISPR articles • Peer-reviewed publications • FAQs • Much more! Find More CRISPR Information 26
- 27. gBlocks® Gene Fragments Custom Design Requests Examplesof the types of requests we have assisted with: • 1900 bp sequence, no C bases on one strand, no G bases on the other • Generate codon usage tables given uniquesequencing data • Minimize CpG dinucleotides, but at same time maximizeG/C in the 3rd codon position What other custom requests do you have? For anyquestions regarding IDT gene synthesis products, please email genes@idtdna.com 27
- 28. iGEM sponsorship • www.IDTDNA.com/iGEM CRISPR resources • www.idtdna.com/CRISPR Informationfor gBlocks® Gene Fragments • www.idtdna.com/gBlocks Help with design, experimental issues, and ordering • Genes@idtdna.com Other educational resources at www.IDTDNA.com DECODED newsletter(www.idtdna.com/DECODED) • Video library • Frequentlyasked questions • Much More! Additional Resources 28 4 Manufacturing Locations: • Coralville, IA • San Diego, CA • Leuven, Belgium • Singapore
- 29. Synthetic biology made simple gBlocks® Gene Fragments 29
- 30. Questions? 30