Beyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNA

2,131 views

Published on

In addition to a standard gene synthesis service, IDT offers a novel, rapid, and reliable method to build and clone the genes you need at a fraction of the cost of full gene synthesis services. gBlocks® Gene Fragments are double-stranded, sequence-verified DNA blocks of length 125–750 bp. Their high sequence fidelity and rapid delivery time make gBlocks Gene Fragments ideal for a large range of synthetic biology applications. In this presentation, Dr Adam Clore reviews a variety of uses of gBlocks fragments, including CRISPR-based genome modification, qPCR and HRM controls, and the assembly of gene fragments using the Gibson Assembly® Method.

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
2,131
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
82
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Beyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNA

  1. 1. Beyond Cloning: 101 Uses of Synthetic, High-Fidelity, Double-Stranded DNA Integrated DNA Technologies Adam Clore, PhD
  2. 2. gBlocks® Gene Fragments Product Information  Double-stranded, linear, synthetic DNA fragments  200 ng DNA provided, dry  Typically shipped within 2–4 business days  Affordable for basic research needs  Designed and tested with the Gibson Assembly® method  Suitable for all purposes that require dsDNA
  3. 3. Making gBlocks® Gene Fragments  Assembled using IDT Ultramer® Oligonucleotides  Correctly assembled sequences are enriched using a proprietary, cloning-independent method  Each gBlocks Gene Fragment is verified  The result is high-fidelity, double-stranded DNA that is routinely cloned to yield >80% correct colonies Gene Assembly • Leverages IDT proprietary Ultramer® synthesis technology Assembly Selection • Process removes gene assemblies with deletions and/or substitutions Sequence Confirmation • Each gBlocks fragment is confirmed by three independent methods Ship Preparation • gBlocks fragements are amplified, normalized, packaged, and shipped
  4. 4. 3 Ways We Make Sure Your gBlocks are Correct  Capillary Electrophoresis  Mass Spectrometry  Sanger Sequencing
  5. 5. Cloning of gBlocks® Gene Fragments % WT/Full Coverage 120% 100% 80% 60% 40% 20% 0% 125bp 300bp 500bp Length of gBlocks Fragment 750bp
  6. 6. The Evolution of gBlocks® Gene Fragments — Cheaper, Faster, Better Feb 2014 Dec 2013 •gBlocks Libraries Nov 2013 Oct 2013 •750 bp for $149 •3–4 day TAT Jan 2012 •500 bp •4–7 day TAT •$99 • Mass Spec QC added •2–4 day TAT •$89/$129 •1 kb gBlocks fragments
  7. 7. gBlocks® Gene Fragments Libraries     Pools of gBlocks Gene Fragments with 1–18 N or K mixed bases Mixed bases need to be consecutive Mixed bases need to be 125 bp from either end Length of gBlocks libraries is between 251 and 500 bp At least 125 bp 1–18 bases At least 125 bp NNNNN….NNNNN Or NNKNN….NKNNK Top 4 Questions: - Can you make more complex libraries? Other mixed bases than N or K Multiple variable regions Variable regions within the first and last 125 bp of the gBlocks Specific codon substitutions (AlaΔSer) ……… - Why only 18 Ns? - Are your libraries biased? - Can I get a discount? Libraries @idtdna.com
  8. 8. How are gBlocks® Libraries Made and QCed?  How are they made?  This is proprietary, but the process is based on our capability for making very high quality oligos and gBlocks Gene Fragments.  How are they QCed?  The constant regions are gBlocks Gene Fragments and are QCed by size verification, capillary electrophoresis, and mass spec for sequence verification.  We rely on a validated process (by NGS) to ensure that >80% of DNA species are present in the final 200 ng of material shipped.
  9. 9. Sequence Fidelity in the Constant Regions 5 NNK 6 NNK Looking for the error rates at each position in the constant region of the gene fragments
  10. 10. Base Distribution in Variable Region 115 bp 115 bp 1 NNK 2 NNK 3 NNK 4 NNK 5 NNK 6 NNK Count of reads by position Position Base mix A C G T 1 N 2502744 2183361 2124224 2761775 2 3 N K 2400917 2286 2088264 3160 2315143 4180965 2767780 5385693 Percentage of each base by position Position Base mix A C G T 1 N 26% 23% 22% 29% 2 N 25% 22% 24% 29% 3 K 0.02% 0.03% 44% 56% • Built 6 gene fragments with 1–6 NNK codons • Sequence-verified each by NGS: MySeq®, 250 bp reads, forward and reverse
  11. 11. Base Distribution in Variable Region 6 NNK
  12. 12. Examples of Orders/Applications • • • • • • NNK(1-18) NNM(1-18) Binding site engineering Catalytic site analysis Antibody engineering Vaccine development DNA binding analysis Promoter optimization NNK • Systematic codon replacement NNK(1-9) NNK(1-9) NNM(1-9) • Introducing multiple variable regions NNM(1-9) Libraries@idtdna.com
  13. 13. Pricing and Delivery Time Mixed Base >1 billion sequence variants for = $1,439 TAT: 10–15 Business Days # of Ns Diversity NNKs Diversity Price USD 0 1 0 1 $ 89.00 1 4 4 $ 239.00 2 16 16 $ 239.00 3 64 1 32 $ 314.00 4 256 128 $ 389.00 5 1,024 512 $ 464.00 6 4,096 2 1,024 $ 539.00 7 16,384 4,096 $ 614.00 8 65,536 16,384 $ 689.00 9 262,144 3 32,768 $ 764.00 10 1,048,576 131,072 $ 839.00 11 4,194,304 524,288 $ 914.00 12 16,777,216 4 1,048,576 $ 989.00 13 67,108,864 4,194,304 $1,064.00 14 268,435,456 16,777,216 $1,139.00 15 1,073,741,824 5 33,554,432 $1,214.00 16 4,294,967,296 134,217,728 $1,289.00 17 17,179,869,184 536,870,912 $1,364.00 18 68,719,476,736 6 1,073,741,824 $1,439.00
  14. 14. Remember the Carlson Curve?  Compares the cost of reading DNA to the cost of writing DNA • You get up to 418 combinations in a tube = about 68 billion gene fragments • For $1,439 • That is $0.000 000 021 per gene fragment • Or 0.000 000 0042 ¢/base (for a 500 bp library) 1.0E-09 IDT
  15. 15. Biosecurity  IDT is one of the five founding members of the International Gene Synthesis Consortium (IGSC)  Screens the sequence of every gene/gBlocks Gene Fragment order  To ensure safety and regulatory conformance  IDT reserves the right to refuse any order that does not pass this analysis  For more information about the IGSC and the Harmonized Screening Protocol, please visit the website at http://www.genesynthesisconsortium.org/Home.html. In October of 2010, the United States government issued final Screening Framework Guidance for Providers of Synthetic Double-Stranded DNA, describing how commercial providers of synthetic genes should perform gene sequence and customer screening. IDT and the other IGSC member companies supported the adoption of the Screening Framework Guidance, and IDT follows that Guidance in its application of the Harmonized Screening Protocol. For more information, please see 75 FR 62820 (Oct. 13, 2010), or http://federalregister.gov/a/2010-25728. 
  16. 16. How are Researchers Using gBlocks® Gene Fragments? Gene Construction and Modification Genome Modification qPCR and SNP Detection Controls New Technologies
  17. 17. How are Researchers Using gBlocks® Gene Fragments? Gene Construction and Modification Genome Modification qPCR and SNP detection controls New Technologies
  18. 18. 3 Ways to Assemble Genes Ultramer® Oligos Product Description gBlocks® Gene Fragments Custom Gene Synthesis Single-stranded custom oligo Double-stranded linear fragment Double-stranded product delivered in a vector/BAC 200 pmol 200 ng >4μg 45–120 bases 125–750 bp 25 – 2M bp 2–3 business days 2–4 business days Variable Mass Spec Sanger Sequencing Sanger Sequencing (or NGS for long constructs) 50–80% 85–90% 100% 288 oligos 1 fragment 1 gene Delivery Amount Length Turnaround Time Quality Control Estimated Purity Minimum Order Size Sequence Fidelity $ Cost Delivery time $$$
  19. 19. Gene Construction Case Study #1: An alternative to site-directed mutagenesis Direct cloning & mutagenesis gBlocks® Gene Fragments gBlocks® Gene Fragments used as an alternative to site-directed mutagenesis to introduce 18 mutations spread over the 1039 nt exon 7 of the gene JARID2 in order to verify that C-rich consensus sites with a central invariant CA dinucleotide are important for the in splicing of large exons >1000 nt.
  20. 20. Gene Construction Case Study #2: Immune Response After Flu Vaccination DECODED 2.4 (October 2012): Using gBlocks® Gene Fragments to Generate Antibody Variable Regions Francois Vigneault, PhD Church Lab at Harvard University now Abvitro, Inc Each domain (VL, VH, CL, CH) is ≈ 100 aa or ≈ 400 nt So each domain = 1 gBlocks fragment
  21. 21. Identifying Rare Antibodies 1. 2. 3. 4. 5. 6. Patient vaccination Identification and quantification of all mRNAs by NGS (multiple data points)— thousands of antibody sequences Select the very few VL and VH domains that are highly expressed Build the potentially best antibodies by combining a small selection of VL domains and gBlocks Gene Fragments coding for the VH domains Selection of the strongest binding antibodies by phage display and surface plasmon resonance (Georgiou lab at University of Texas, Austin) Verify when the best antibodies are produced using NGS data
  22. 22. Making Gene Synthesis More Affordable Assume 1200 bp gene; what is the price differential for 8 genes with one variable region? Assume $0.35/bp Genes gBlocks® Gene Fragments 1 3’ 1 5’ 2 3’ 2 5’ 3 3’ 3 5’ 4 3’ 4 5’ 5 3’ 5 5’ 6 3’ 6 5’ 7 3’ 7 5’ 8 3’ 8 5’ 8 Genes = $3,360 10 gBlocks fragments = ~$890
  23. 23. Assembling Multiple gBlocks® With the Gibson Assembly® Method • • • Gibson Assembly™ Master Mix
  24. 24. Gibson Assembly® Method How Isothermal Assembly of gBlocks® Gene Fragments Works Step 1: gBlocks Gene Fragments are designed with 30 bp overlaps on the 3’ strand for use in the reaction with the following steps. Step 2: A mesophilic exonuclease briefly cleaves bases from the 5’ end of the double-stranded DNA fragments, before being inactivated by the 50°C reaction temperature. Step 3: The newly generated, complementary, single-stranded 3’ ends anneal. Step 4: A high fidelity DNA polymerase fills in any single-stranded gaps. Step 5: Finally, a thermophilic DNA ligase covalently joins DNA segments.
  25. 25. How are Researchers Using gBlocks® Gene Fragments? Gene Construction and Modification Genome Modification qPCR and SNP Detection Controls New Technologies
  26. 26. How are Researchers Using gBlocks® Gene Fragments? Gene Construction and Modification Genome Modification qPCR and SNP Detection Controls New Technologies
  27. 27. CRISPR — Easy Genome Modification  Clustered Regularly Interspaced Short Palindromic Repeat  A prokaryotic defense mechanism that screens for and cleaves specific DNA sequences  Can be used to create targeted changes to the genomes of bacteria, archaea, and eukaryotes
  28. 28. The 3 Stages of CRISPR Resistance ● Stage 1: CRISPR Adaptation – ● Stage 2: CRISPR Expression – ● Foreign DNA is incorporated in the CRISPR array. CRISPR RNAs (crRNAs) are transcribed from CRISPR locus. Stage 3: CRISPR Interference – Foreign nucleic acid complementary to the crRNA is neutralized.
  29. 29. Utilizing CRISPR for Genome Modification  We need 3 components: 1. CRISPR Associated Gene 9 (CAS9) 2. RNA with CRISPR repeats (crRNA) 3. Trans-acting RNA (tracrRNA) * 2 and 3 can be combined into a single sequence called a single guide RNA (sgRNA) Zhang lab: http://www.genome-engineering.org
  30. 30. CRISPR-Cas9 System in Mammals
  31. 31. gBlocks® Gene Fragments for CRISPR
  32. 32. gBlocks® Gene Fragments for CRISPR
  33. 33. Genome Editing Case Study #1: CRISPR Mediated Deletions Non Homologus End Joining (NHEJ) Error prone Leads to indels and rearrangements
  34. 34. Gene Fragments Used in CRISPR Research • gBlocks U6-gRNA • gBlocks T7-gRNA for IVT 4 gBlocks for Cas9 codon optimization
  35. 35. Genome Engineering Case Study #2: CAS9 as a Homing device  Multiple, tuned, gene activation with nuclease-dead CAS9/gene promoter fusion proteins  Promoter gene and sgRNA were gBlocks fragments
  36. 36. 2013 Citations of CRISPR/Cas Genome Editing with gBlocks® First author Affiliation Journal Chen UCSF Cell Malina McGill Genes Dev. Mali Harvard Med School (Church lab) Science Mali Harvard Med School (Church lab) Nature Biotech Friedland Harvard Med School (Church lab) Nature Methods Perez-Pinera Duke Nature Methods Dickinson Univ. North Carolina Nature Methods Gilbert UCSF Cell Cheng Whitehead/MIT Cell Research Waaijers Univ. Utrecht Genetics Gratz Univ. Wisconsin Genetics Bassett Oxford Biology Open
  37. 37. How are Researchers Using gBlocks® Gene Fragments? Gene Construction and Modification Genome Modification qPCR and SNP Detection Controls New Technologies
  38. 38. How are Researchers Using gBlocks® Gene Fragments? Gene Construction and Modification Genome Modification qPCR and SNP Detection Controls New Technologies
  39. 39. Synthetic Template Case Study #1: gBlocks® Gene Fragments as DNA Standards  Zymo Research Decoded 3.3 (July 2013) • gBlocks Gene Fragments as truly un-methylated DNA standards • PrimeTime® qPCR Assays for multiplex analysis
  40. 40. Synthetic Template Case Study #2: gBlocks® Gene Fragment as Synthetic Template in Multiplex PCR A single DNA source for 4 different standard curves. ACVR2B-LIMK1-ACVR1B-CDK7 wt TCATACCTGCATGAGGATGTGCCCTGGTGCCGTGGCGAGGGCCACAAGCCGTCTATTGCCCA CAGGGACTTTAAAAGTAAGAATGTATTGCTGAAGAGCGACCTCACAGCCGTGCTGGCTGACT TTGGCTTGGGAACATCATCCACCGAGACCTCAACTCCCACAACTGCCTGGTCCGCGAGAACA AGAATGTGGTGGTGGCTGACTTCGGGCTGGCGCGTCTCATGGTGGACGAGAAGACTGTATGT GATCAGAAGCTGCGTCCCAACATCCCCAACTGGTGGCAGAGTTATGAGGCACTGCGGGTGAT GGGGAAGATGATGCGAGAGTGTTGGTATGGATGTATGGTGTAGGTGTGGACATGTGGGCTGT TGGCTGTATATTAGCAGAGTTACTTCTAAGGGTTCCTTTTTTGCCAGGAGATTCAGACCTTG ATCAGCTAACAgcggccgc • Equimolar ratios of the four samples are always perfect
  41. 41. gBlocks® Gene Fragments as Quadruplex Standards Cq Values gBlocks Fragments as Standards 40.0 35.0 30.0 25.0 20.0 15.0 10.0 5.0 0.0 Fourplex Reaction Conditions Hs LIMK1 Hs CDK7 Hs ACVR1B Hs ACVR2B 2.00E+06 2.00E+04 Copies 2.00E+02 Reagent 10X buffer 100 mM dNTPs 50 mM MgCl2 25 µM Forward Primer 1 25 µM Reverse Primer 1 12.5 µM Probe 25 µM Forward Primer 2 25 µM Reverse Primer 2 12.5 µM Probe 25 µM Forward Primer 3 25 µM Reverse Primer 3 12.5 µM Probe 25 µM Forward Primer 4 25 µM Reverse Primer 4 12.5 µM Probe Immolase polymerase H2O Template Final Conc. 1X 800 nM 3 mM 500 nM 500 nM 250 nM 500 nM 500 nM 250 nM 500 nM 500 nM 250 nM 500 nM 500 nM 250 nM 0.8 U ----
  42. 42. Synthetic Template Case Study #3: Using gBlocks® Gene Fragments As Modified Standards While both template sequences contain the primers and probe binding sites, by altering the length of one, the modified amplicon can be distinguished from the endogenous one. Hs.PT.51.4056836 LIMK1 Hs LIMK1 Forward GAACATCATCCACCGAGACC Hs LIMK1 Reverse AGTCTTCTCGTCCACCATGA HS LIMK1 Probe CCAGCCCGAAGTCAGCCACC Hs LIMK1 endogenous amplicon sequence GAACATCATCCACCGAGACCTCAACTCCCACAACTGCCTGGTCCGCGAGAACAAGAATGTGGTGGTGG CTGACTTCGGGCTGGCGCGTCTCATGGTGGACGAGAAGACT Hs LIMK1 –10 GAACATCATCCACCGAGACCTCAACTCCCACAACTGCCTAACAAGAATGTGGTGGTGGCTGACTTCGGG CTGGCGCGTCTCATGGTGGACGAGAAGACT
  43. 43. SYBR® Green Dye Dissociation Curve gBlocks fragment (endogenous ) By deleting or adding bases, a unique standard can be used that is distinguishable from the endogenous sequence. gBlocks fragment (–10 bases) If you have trouble with contamination, you will always be able to distinguish the standard from the endogenous amplicon.
  44. 44. How are Researchers Using gBlocks® Gene Fragments? Gene Construction and Modification Genome Modification qPCR and SNP Detection Controls New Technologies
  45. 45. How are Researchers Using gBlocks® Gene Fragments? Gene Construction and Modification Genome Modification qPCR and SNP Detection Controls New Technologies
  46. 46. New Uses for gBlocks® Gene Fragments in 2014  Gene variant libraries  Promoter variation  Gene insertion without homologous recombination
  47. 47. Synthetic Biology Partners New England BioLabs Gibson Assembly™ Master Mix IDT and SGI are working together to develop further enabling tools for the SynBio community. Gene constructs from 5 kb to 2 Mb

×