Advertisement
Development of brown midrib (BMR) 6 and 12 hybrid parents through marker-assisted backcrossing (MABC) in sorghum
Upcoming SlideShare
Advancement of mutant populationAdvancement of mutant population
Loading in ... 3
1 of 1
Advertisement

More Related Content

Similar to Development of brown midrib (BMR) 6 and 12 hybrid parents through marker-assisted backcrossing (MABC) in sorghum(20)

More from ICRISAT(20)

Advertisement

Recently uploaded(20)

Development of brown midrib (BMR) 6 and 12 hybrid parents through marker-assisted backcrossing (MABC) in sorghum

  1. DEVELOPMENT OF BROWN MIDRIB (bmr) 6 AND 12 HYBRID PARENTS THROUGH MARKER-ASSISTED BACKCROSSING (MABC) IN SORGHUM ABSTRACT Production of renewable fuels, especially from plant biomass are gaining importance due to high energy balance and reduced greenhouse gas emissions. However, lignocellulose based ethanol production is still in pilot scale, as the pre-treatment cost is high due to the presence of lignin that confers mechanical strength to the cell wall. Low lignin feed stocks are not only useful in biofuel sector, but also preferable as fodder as they are more palatable and possess high in vitro organic matter digestibility. In this context, natural mutants with altered expression of genes involved in lignin biosynthesis pathway are highly desirable. Allelic studies in sorghum have revealed four different loci bmr2, bmr6, bmr12 and bmr19 that contribute to the bmr phenotype. Brown midrib (bmr) is a visible marker associated with the reduction of lignin. In this study we have successfully transferred bmr phenotype (bmr6 and bmr12) into high biomass-low lignin sorghum cultivars through marker-assisted backcrossing (MABC) using KASPar assays. These introgressed bmr cultivars could be highly amenable to biofuel production due to their altered lignin content. Subhasini V Reddy 1, 2, Santosh P Deshpande1, B V S Reddy 1, D Manohar Rao 2, A Ashok, Kumar 1* 1 International Crops Research Institute for the Semi-Arid Tropics, Telangana, India 2 Osmania University, Hyderabad, Telangana, India, * Corresponding author email: a.ashokkumar@cgiar.org MATERIALS AND METHODS Parent Materials Donor parents (♀) bmr 6: IS 23789; bmr 12 : N 593 and N 595 Recurrent parents (♂) High biomass lines: IS 8813, IS 13762 and IS 21893 Selection of molecular markers for foreground selection Two KASPar SNP markers present on target bmr region on chromosomes SBI-04 (bmr 6) (Gorthy et al 2013) and SBI-07 (bmr 12) (Saballos et al 2008) (Table 1) were used for foreground selection across donor-recurrent parent combination (Fig-2). KASPar assays for the targeted SNPs were carried out at KBioscience, UK. Marker-assisted Background selection Background screening of the bmr6 and bmr 12 introgressed lines will be carried out using SSR markers to select the plants with higher recurrent parent genome recovery. RESULT AND DISCUSSION ACKNOWLEDGEMENTS We are thankful for the study was funded by the Department of scientist and Technology (DST), Reference No: DST No: SR/WOS-A/LS-408/2012 (G), New Delhi, India and Department of Biotechnology funded Joint Clean Energy Research and Development Center (JCERDC) project, ICRISAT. Chromosome number Marker names (Primer ID) SNP position Allele in IS 23789, N 593 and N 595 Allele in IS 8813, IS 13762 and IS 21893 The sequence used for primer designing SBI-04 bmr6_39_3699 3699 CAD gene G C AAAGGCCTTTGGGCTGACGGCCCCAGG CTCCGCGGTGGCATCGTGGGCCTGGGC [G/C] GCGTGGGCCACATGGGCGTGAAGGTGG CGAAGGCCATGGGCCACC SBI-07 bmr12_691 691 COMT gene T C CACCCCTAACGAGGACGGCGTCTCCATG GCCGCCCTCGCGCTCATGAAC [C/T] AGGACAAGGTCCTCATGGAGAGCTGGT GAGTAGTCGTCGTCAGAGCACA Table 2 Details of genotyping, selection for foreground (FGS) selection and crossing of lines in different generations during marker-assisted backcrossing for bmr 6 and 12 introgression. Crosses for bmr6 and bmr12 No of Kaspar SNPs used for FGS No of plants and True hybrids observed in each generation F1s BC1F1s BC2F1s BC2F2s No of plant s True hybrids No of plants True hybrids No of plants True hybrids No of plants True hybrids IS 23789 x IS 8813 1 6 3 66 29 24 11 568 284 N 593 x IS 13762 1 6 4 8 6 11 7 430 215 N 595 x IS 21893 1 6 2 21 7 7 4 1310 655 Fig. 1 Graphical representation (chromatogram) on Hybridity screening of BC2F2s for bmr6 & bmr12 with Kaspar SNPs, analyzed through infiniteF200PRO. The dots show polymorphism at a locus on chromosomes SBI 04 and SBI 07. The Red spots denotes homozygous allele from donor parents IS 23789 (bmr6) and N 593 (bmr12), N 595 (bmr12) and green spots is heterozygous allele from both parents whereas blue spots denotes the homozygous allele from High biomass Recurrent parent i.e., IS 8813, IS 13526, and IS 21893 CONCLUSION In this study, we successfully developed three high biomass lines with brown midrib trait using marker assisted backcrossing. • The two KASPar SNPs present in the candidate genes CAD and COMT have been validated and can be used for marker-assisted selection of bmr introgressed lines. • The CAD and COMT alleles in introgression lines might reduce the activity of the CAD2 enzyme due to G-to-C (G191R) substitution in the CAD2 protein sequence and C-to-T at 691 of COMT gene thus leading to the bmr phenotype. • Three improved low lignin, high biomass sorghum introgression lines were IS 8813, IS 13762 and IS 21893 have a practical breeding value and can be used to increase the conversion efficiency of biomass into ethanol. Table 1 List and details of KASPar markers used for undertaking the foreground selection in marker-assisted backcrossing programs to transfer to the bmr region for high biomass sorghum. INTRODUCTION High biomass (energy) sorghum produces higher biomass with greater dry matter yields than non-bmr and bmr forage sorghums. The brown midrib mutation with altered lignin content is associated with an increase in the accumulation of fermentable sugars and improved digestibility. Mutations in cinnamyl alcohol dehydrogenase (CAD2) and caffeic O-methyltransferase (COMT) genes contribute to the phenotype of bmr6 and bmr12 groups, respectively. In the present study, the marker-assisted backcross technique was applied to introgress bmr6 and bmr12 associated genes from bmr sources to high biomass elite lines. Foreground screening was done using KASPar markers for the target bmr regions of bmr 6 (Chr. SBI-04) and bmr 12 (Chr. SBI-07) lines in high biomass lines. These traits are useful to improve the conversion efficiency of the biomass during fermentation and forage digestibility for livestock. KASPar assays designed and SNP validation Kompetitive Allele Specific PCR (KASP) assays were developed and tested for all the identified SNPs using bmr introgression phenotypes. Two SNPs, IS 23789 for bmr 6 in (bmr 6_39_3699, Chr-4, G-to-C at 3699 of CAD gene) N 593 and N 595 for bmr 12 in (bmr 12_691, Chr-7, C-to-T at 691 of COMT gene), were then selected for marker validation (Table-1). Introgression lines (BC2F2s)Parent 1 (Recurrent) Parent 2 (Donor) × =
Advertisement