SlideShare a Scribd company logo
1 of 1
Download to read offline
Financial support from Department of Biotechnology, Government of India and CGIAR Generation Challenge Programme (GCP) is
gratefully acknowledged.
Manish Roorkiwal1,2, Spurthi Nayak1,3, Mahendar Thudi1, Hari Upadhyaya1,
Rajeev Varshney1,4,*, Prakash Sharma2
1International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Hyderabad, India;
2Guru Gobind Singh Indraprastha University, New Delhi, India; 3University of Florida, Florida, USA;
4CGIAR Generation Challenge Programme, c/o CIMMYT, Mexico DF, Mexico;
*Address for correspondence: r.k.varshney@cgiar.org
Chickpea is an important food legume crop, for the semi-arid regions including Indian subcontinent. Its productivity is
adversely affected by various biotic and abiotic stresses. Identification of candidate genes that are associated with
abiotic stress response will help breeding efforts aiming to enhance its productivity. With this objective, eleven abiotic stress
responsive candidate genes were selected on the basis of prior knowledge acquired from mutational, biochemical and linkage analysis
of the traits. These 11 genes were subjected to allele specific sequencing across chickpea reference set comprising of 300 genotypes
including 211 mini-core collection genotypes. In total, 1.3Mbp sequence data was generated. Multiple sequence alignment revealed 79
SNPs and 41 indels in ten candidate genes while, CAP2 gene was found to be conserved across all genotypes. Among ten candidate
genes, maximum number of SNPs (34) were observed in ASR gene, amongst which 22 transitions, 11 transversions and one tri-allelic
SNP. Nucleotide diversity varied from 0.0004 to 0.0029, while PIC values ranged from 0.01 (AKIN gene) to 0.43 (CAP2 promoter).
Association analysis using these candidate genes identified 6 SNPs in ASR, 3 SNPs in Dehydrin and 3 SNPs in DREB associated with
different traits like 100-seed weight, delta carbon, plant height, root surface area, root dry weight, pods per plant and yield. Identified
marker trait association after further validation may be useful for enhancing drought tolerance in chickpea through molecular breeding.
Abstract
Gene sequence alignment to identify SNPsBackground
ICC1882
ICC2210
ICC2990
ICC6263
ICC6811
ICC7184
ICC8195
ICC8261
ICC8621
ICC9848
ICC11378
ICC12328
ICC12537
ICC13816
ICC14402
Transition (C-T)
‘ATG’ deletion
b.
ICC9848 TATGGGACCCACAATACAC---GTGG
ICC11378 TATGGGACCTACAATACACATGGTGGICC9848
ICC11378
a.
GURU GOBIND SINGH
INDRAPRASTHA UNIVERSITY
Allelic diversity and association analysis for candidate abiotic
stress responsive genes with drought tolerance in chickpea
 Chickpea (Cicer arietinum L. 2n=16) is an important food legume
crop, which ranks third worldwide as a food legume crop
 India is the largest producer as well as largest importer of
chickpea; Yield and productivity are adversely affected by various
biotic and abiotic stresses
 Drought alone causes 40-50% reduction in the chickpea yield
globally
 A holistic approach, combining genomics with breeding and
physiology, termed as genomics-assisted breeding (Varshney et al.
2005 Trends Plant Sci 10:621-630) should be used
 Identification of abiotic stress responsive genes and determination
of genetic diversity among the mini core collection using SNPs
identified in these genes will lead to identification of superior
alleles of the gene present in chickpea germplasm
Sequence quality check using
DNA Baser V3.01 to compare the
SNP (C/T) and deletion of ATG
Candidate gene AKIN AMADH ASR CAP2 CAP2
promoter
DHN DREB ERECTA
_7
ERECTA
_8
Myb SPS
Genotypes with
successful sequences
208 209 193 227 137 198 191 79 147 200 236
Sequence length (bp) 772 932 621 367 629 381 776 921 1189 335 312
No. of Indels 2 3 2 0 0 7 23 1 0 2 1
Indel frequency 1/386.0 1/310.67 1/310.6 0 0 1/54.4 1/33.7 1/921.0 0 1/167.5 1/312.0
No. of SNPs 2 13 34* 0 1 7 14 13 20 6 3
Transition 2 6 22 0 0 5 8 9 10 1 2
Transversion 0 7 13 0 1 2 6 4 10 5 1
SNP frequency 1/386.0 1/71.7 1/18.3 0 1/629.0 1/54.4 1/55.4 1/70.9 1/69.5 1/55.8 1/104.0
Nucleotide Diversity
(Pi)
0.0004 0.002 0.0014 0 0 0.0022 0.0011 0.0029 0.0029 0.002 0.0011
Average PIC of SNP 0.01 0.04 0.1 0 0.43 0.17 0.14 0.27 0.1 0.04 0.01
No. of Haplotypes 3 9 4 1 2 6 33 4 3 6 4
Haplotype Diversity 0.019 0.326 0.833 0 0.438 0.426 0.879 0.372 0.324 0.256 0.034
PIC of Haplotypes 0.019 0.324 0.829 0 0.436 0.424 0.874 0.367 0.322 0.255 0.034
Sequence diversity analysis for biotic stress responsive genes
Methodology
Gene
sequences
EST
sequences
SNP
Identification
Allele diversity
analysis
Primer design
PCR
Amplification
Sequencing of
purified PCR products
Contigs showing
match with target
gene
Contigs
Confirmation
of gene
Chickpea
Reference set/
mini core
Gene
Amplification
Amplicons
sequencing
Gene
Amplification
Sequence similarity
based identification
and confirmation of
candidate genes in
chickpea
SNP identification
and allele
diversity analysis
in chickpea mini
core collection
Asia
M East
E Africa
Euro Asia
Europe
N Africa
N America
NE Africa
NW Africa
S America
SE Africa
W Africa
Unknown
Haplotype network of SPS gene Salient features
1. Eleven abiotic stress responsive candidate genes were
identified in chickpea based on sequence similarity
approach.
2. SNPs were identified for these eleven genes across 300
(211) accessions of chickpea reference set &/or mini
core collection
3. A total of 79 SNPs and 41 indels were identified in ten
candidate genes while, CAP2 gene was found to be
conserved across all genotypes
4. Diversity analysis reveals that ASR gene was most
variable with 34 SNPs amongst which 22 transitions, 11
transversions and one tri-allelic
5. PIC values ranged from 0.01 (AKIN gene) to 0.43 (CAP2
promoter)
Acknowledgements

More Related Content

What's hot

Male sterility in vegetable crops
Male sterility in vegetable cropsMale sterility in vegetable crops
Male sterility in vegetable cropsMamtaChoudhary75
 
Development of biotic stress resistance technologies
Development of biotic stress resistance technologiesDevelopment of biotic stress resistance technologies
Development of biotic stress resistance technologiesMamtaChoudhary75
 
GENETIC ANALYSIS OF THE 2013/14 SAT2 FOOT-AND-MOUTH DISEASE (FMD) OUTBREAK IN...
GENETIC ANALYSIS OF THE 2013/14 SAT2 FOOT-AND-MOUTH DISEASE (FMD) OUTBREAK IN...GENETIC ANALYSIS OF THE 2013/14 SAT2 FOOT-AND-MOUTH DISEASE (FMD) OUTBREAK IN...
GENETIC ANALYSIS OF THE 2013/14 SAT2 FOOT-AND-MOUTH DISEASE (FMD) OUTBREAK IN...EuFMD
 
"Factors that determine whether biotechnologies can have positive impacts on ...
"Factors that determine whether biotechnologies can have positive impacts on ..."Factors that determine whether biotechnologies can have positive impacts on ...
"Factors that determine whether biotechnologies can have positive impacts on ...ExternalEvents
 
Achieving sustainable leaf rust control in durum wheat: What have we...
Achieving  sustainable  leaf  rust  control  in  durum  wheat: What  have  we...Achieving  sustainable  leaf  rust  control  in  durum  wheat: What  have  we...
Achieving sustainable leaf rust control in durum wheat: What have we...Borlaug Global Rust Initiative
 
Marker-assisted introgression of waxy1 gene into elite inbreds for enhancemen...
Marker-assisted introgression of waxy1 gene into elite inbreds for enhancemen...Marker-assisted introgression of waxy1 gene into elite inbreds for enhancemen...
Marker-assisted introgression of waxy1 gene into elite inbreds for enhancemen...CIMMYT
 
Maize in Asia – Status, Challenges and Opportunities
Maize in Asia – Status, Challenges and OpportunitiesMaize in Asia – Status, Challenges and Opportunities
Maize in Asia – Status, Challenges and OpportunitiesCIMMYT
 
Heat stress tolerance in tropical maize
Heat stress tolerance in tropical maizeHeat stress tolerance in tropical maize
Heat stress tolerance in tropical maizeCIMMYT
 
Archives Of Agronomy Soil Science (49) 333 345
Archives Of Agronomy  Soil Science (49) 333 345Archives Of Agronomy  Soil Science (49) 333 345
Archives Of Agronomy Soil Science (49) 333 345Turlough Guerin
 
Genome Editing in Poultry - Mark Tizard
 Genome Editing in Poultry - Mark Tizard Genome Editing in Poultry - Mark Tizard
Genome Editing in Poultry - Mark TizardOECD Environment
 
Recent advances in African swine fever vaccine development at the Internation...
Recent advances in African swine fever vaccine development at the Internation...Recent advances in African swine fever vaccine development at the Internation...
Recent advances in African swine fever vaccine development at the Internation...ILRI
 
Ethical and bio-safety issues related to GM crops
Ethical and bio-safety issues related to GM cropsEthical and bio-safety issues related to GM crops
Ethical and bio-safety issues related to GM cropsMahammed Faizan
 
ASSESSMENT OF POTENCY AND EFFECTIVENESS OF HEPTA-VALENT FMD VACCINE OIL ADJUV...
ASSESSMENT OF POTENCY AND EFFECTIVENESS OF HEPTA-VALENT FMD VACCINE OIL ADJUV...ASSESSMENT OF POTENCY AND EFFECTIVENESS OF HEPTA-VALENT FMD VACCINE OIL ADJUV...
ASSESSMENT OF POTENCY AND EFFECTIVENESS OF HEPTA-VALENT FMD VACCINE OIL ADJUV...EuFMD
 
Breeding for improve nutritional quality traits in carrot
Breeding for improve  nutritional quality traits in carrotBreeding for improve  nutritional quality traits in carrot
Breeding for improve nutritional quality traits in carrotHemant Ghemeray
 
Application of biotechnology in pharmacy pwpnt presentaiton
Application of biotechnology in pharmacy pwpnt presentaitonApplication of biotechnology in pharmacy pwpnt presentaiton
Application of biotechnology in pharmacy pwpnt presentaitonRajib Ghose
 
Management of Insect Pests of Food Legumes in West and Central Asia and North...
Management of Insect Pests of Food Legumes in West and Central Asia and North...Management of Insect Pests of Food Legumes in West and Central Asia and North...
Management of Insect Pests of Food Legumes in West and Central Asia and North...ICARDA
 
Dr. Brian Payne - PCV2 Vaccine Cross-Protection: Identification of Sequences ...
Dr. Brian Payne - PCV2 Vaccine Cross-Protection: Identification of Sequences ...Dr. Brian Payne - PCV2 Vaccine Cross-Protection: Identification of Sequences ...
Dr. Brian Payne - PCV2 Vaccine Cross-Protection: Identification of Sequences ...John Blue
 

What's hot (20)

Male sterility in vegetable crops
Male sterility in vegetable cropsMale sterility in vegetable crops
Male sterility in vegetable crops
 
Development of biotic stress resistance technologies
Development of biotic stress resistance technologiesDevelopment of biotic stress resistance technologies
Development of biotic stress resistance technologies
 
Biosafety of gm crops
Biosafety of gm cropsBiosafety of gm crops
Biosafety of gm crops
 
GENETIC ANALYSIS OF THE 2013/14 SAT2 FOOT-AND-MOUTH DISEASE (FMD) OUTBREAK IN...
GENETIC ANALYSIS OF THE 2013/14 SAT2 FOOT-AND-MOUTH DISEASE (FMD) OUTBREAK IN...GENETIC ANALYSIS OF THE 2013/14 SAT2 FOOT-AND-MOUTH DISEASE (FMD) OUTBREAK IN...
GENETIC ANALYSIS OF THE 2013/14 SAT2 FOOT-AND-MOUTH DISEASE (FMD) OUTBREAK IN...
 
"Factors that determine whether biotechnologies can have positive impacts on ...
"Factors that determine whether biotechnologies can have positive impacts on ..."Factors that determine whether biotechnologies can have positive impacts on ...
"Factors that determine whether biotechnologies can have positive impacts on ...
 
Eds pakistan
Eds pakistanEds pakistan
Eds pakistan
 
Achieving sustainable leaf rust control in durum wheat: What have we...
Achieving  sustainable  leaf  rust  control  in  durum  wheat: What  have  we...Achieving  sustainable  leaf  rust  control  in  durum  wheat: What  have  we...
Achieving sustainable leaf rust control in durum wheat: What have we...
 
Marker-assisted introgression of waxy1 gene into elite inbreds for enhancemen...
Marker-assisted introgression of waxy1 gene into elite inbreds for enhancemen...Marker-assisted introgression of waxy1 gene into elite inbreds for enhancemen...
Marker-assisted introgression of waxy1 gene into elite inbreds for enhancemen...
 
Maize in Asia – Status, Challenges and Opportunities
Maize in Asia – Status, Challenges and OpportunitiesMaize in Asia – Status, Challenges and Opportunities
Maize in Asia – Status, Challenges and Opportunities
 
Heat stress tolerance in tropical maize
Heat stress tolerance in tropical maizeHeat stress tolerance in tropical maize
Heat stress tolerance in tropical maize
 
Archives Of Agronomy Soil Science (49) 333 345
Archives Of Agronomy  Soil Science (49) 333 345Archives Of Agronomy  Soil Science (49) 333 345
Archives Of Agronomy Soil Science (49) 333 345
 
Genome Editing in Poultry - Mark Tizard
 Genome Editing in Poultry - Mark Tizard Genome Editing in Poultry - Mark Tizard
Genome Editing in Poultry - Mark Tizard
 
Recent advances in African swine fever vaccine development at the Internation...
Recent advances in African swine fever vaccine development at the Internation...Recent advances in African swine fever vaccine development at the Internation...
Recent advances in African swine fever vaccine development at the Internation...
 
Ethical and bio-safety issues related to GM crops
Ethical and bio-safety issues related to GM cropsEthical and bio-safety issues related to GM crops
Ethical and bio-safety issues related to GM crops
 
Tamindžić et al. 2016
Tamindžić et al. 2016Tamindžić et al. 2016
Tamindžić et al. 2016
 
ASSESSMENT OF POTENCY AND EFFECTIVENESS OF HEPTA-VALENT FMD VACCINE OIL ADJUV...
ASSESSMENT OF POTENCY AND EFFECTIVENESS OF HEPTA-VALENT FMD VACCINE OIL ADJUV...ASSESSMENT OF POTENCY AND EFFECTIVENESS OF HEPTA-VALENT FMD VACCINE OIL ADJUV...
ASSESSMENT OF POTENCY AND EFFECTIVENESS OF HEPTA-VALENT FMD VACCINE OIL ADJUV...
 
Breeding for improve nutritional quality traits in carrot
Breeding for improve  nutritional quality traits in carrotBreeding for improve  nutritional quality traits in carrot
Breeding for improve nutritional quality traits in carrot
 
Application of biotechnology in pharmacy pwpnt presentaiton
Application of biotechnology in pharmacy pwpnt presentaitonApplication of biotechnology in pharmacy pwpnt presentaiton
Application of biotechnology in pharmacy pwpnt presentaiton
 
Management of Insect Pests of Food Legumes in West and Central Asia and North...
Management of Insect Pests of Food Legumes in West and Central Asia and North...Management of Insect Pests of Food Legumes in West and Central Asia and North...
Management of Insect Pests of Food Legumes in West and Central Asia and North...
 
Dr. Brian Payne - PCV2 Vaccine Cross-Protection: Identification of Sequences ...
Dr. Brian Payne - PCV2 Vaccine Cross-Protection: Identification of Sequences ...Dr. Brian Payne - PCV2 Vaccine Cross-Protection: Identification of Sequences ...
Dr. Brian Payne - PCV2 Vaccine Cross-Protection: Identification of Sequences ...
 

Viewers also liked

Role of the pearl millet Aquaporin genes in abiotic stress tolerance
Role of the pearl millet Aquaporin genes in abiotic stress toleranceRole of the pearl millet Aquaporin genes in abiotic stress tolerance
Role of the pearl millet Aquaporin genes in abiotic stress toleranceICRISAT
 
Isolation and characterization of stress inducible promoters from Pennisetum ...
Isolation and characterization of stress inducible promoters from Pennisetum ...Isolation and characterization of stress inducible promoters from Pennisetum ...
Isolation and characterization of stress inducible promoters from Pennisetum ...ICRISAT
 
Mapping and association mapping
Mapping and association mappingMapping and association mapping
Mapping and association mappingFAO
 
Genetic engineering for abiotic stress tolerance
Genetic engineering for abiotic stress toleranceGenetic engineering for abiotic stress tolerance
Genetic engineering for abiotic stress toleranceSachin Ekatpure
 
Drought n heat abiotic stress in plants
Drought n heat abiotic stress  in plantsDrought n heat abiotic stress  in plants
Drought n heat abiotic stress in plantsDr. Kirti Mehta
 
Lecture 6 candidate gene association full
Lecture 6 candidate gene association fullLecture 6 candidate gene association full
Lecture 6 candidate gene association fullLekki Frazier-Wood
 
Credit seminar abiotic stress tolerance in cucurbits
Credit seminar abiotic stress tolerance in cucurbitsCredit seminar abiotic stress tolerance in cucurbits
Credit seminar abiotic stress tolerance in cucurbitsPrabhat Singh Sikarwar
 
Seminar abiotic stress
Seminar abiotic stressSeminar abiotic stress
Seminar abiotic stressAkula Dinesh
 
Abiotic stress resistance @ sid
Abiotic stress resistance @ sidAbiotic stress resistance @ sid
Abiotic stress resistance @ sidsidjena70
 
Plant response to stress
Plant response to stressPlant response to stress
Plant response to stressfloradelaterra
 

Viewers also liked (15)

Role of the pearl millet Aquaporin genes in abiotic stress tolerance
Role of the pearl millet Aquaporin genes in abiotic stress toleranceRole of the pearl millet Aquaporin genes in abiotic stress tolerance
Role of the pearl millet Aquaporin genes in abiotic stress tolerance
 
Isolation and characterization of stress inducible promoters from Pennisetum ...
Isolation and characterization of stress inducible promoters from Pennisetum ...Isolation and characterization of stress inducible promoters from Pennisetum ...
Isolation and characterization of stress inducible promoters from Pennisetum ...
 
Mapping and association mapping
Mapping and association mappingMapping and association mapping
Mapping and association mapping
 
Genetic engineering for abiotic stress tolerance
Genetic engineering for abiotic stress toleranceGenetic engineering for abiotic stress tolerance
Genetic engineering for abiotic stress tolerance
 
Drought n heat abiotic stress in plants
Drought n heat abiotic stress  in plantsDrought n heat abiotic stress  in plants
Drought n heat abiotic stress in plants
 
Lecture 6 candidate gene association full
Lecture 6 candidate gene association fullLecture 6 candidate gene association full
Lecture 6 candidate gene association full
 
Lecture 7 gwas full
Lecture 7 gwas fullLecture 7 gwas full
Lecture 7 gwas full
 
Credit seminar abiotic stress tolerance in cucurbits
Credit seminar abiotic stress tolerance in cucurbitsCredit seminar abiotic stress tolerance in cucurbits
Credit seminar abiotic stress tolerance in cucurbits
 
Temperature tolerance
Temperature toleranceTemperature tolerance
Temperature tolerance
 
Abiotic stresses in plant
Abiotic stresses in plantAbiotic stresses in plant
Abiotic stresses in plant
 
ACCASIA PPT
ACCASIA PPTACCASIA PPT
ACCASIA PPT
 
Advances in biotic and abiotic stress tolerance
Advances in biotic and abiotic stress toleranceAdvances in biotic and abiotic stress tolerance
Advances in biotic and abiotic stress tolerance
 
Seminar abiotic stress
Seminar abiotic stressSeminar abiotic stress
Seminar abiotic stress
 
Abiotic stress resistance @ sid
Abiotic stress resistance @ sidAbiotic stress resistance @ sid
Abiotic stress resistance @ sid
 
Plant response to stress
Plant response to stressPlant response to stress
Plant response to stress
 

Similar to Allelic diversity and association analysis for candidate abiotic stress responsive genes with drought tolerance in chickpea

Identification and validation of heat stress responsive genes in chickpea (Ci...
Identification and validation of heat stress responsive genes in chickpea (Ci...Identification and validation of heat stress responsive genes in chickpea (Ci...
Identification and validation of heat stress responsive genes in chickpea (Ci...ICRISAT
 
Identification and validation of heat stress responsive genes in chickpea (Ci...
Identification and validation of heat stress responsive genes in chickpea (Ci...Identification and validation of heat stress responsive genes in chickpea (Ci...
Identification and validation of heat stress responsive genes in chickpea (Ci...ICRISAT
 
Transgenics in vegetable crops.pptx
Transgenics in vegetable crops.pptxTransgenics in vegetable crops.pptx
Transgenics in vegetable crops.pptxDr. Kalpesh Vaghela
 
Breeding for Development of Climate Resilient Chickpea.pptx
Breeding for Development of Climate Resilient Chickpea.pptxBreeding for Development of Climate Resilient Chickpea.pptx
Breeding for Development of Climate Resilient Chickpea.pptxKanshouwaModunshim
 
Biotechnological interventions for improvement of fruit.pptx
Biotechnological interventions for improvement of fruit.pptxBiotechnological interventions for improvement of fruit.pptx
Biotechnological interventions for improvement of fruit.pptxTajamul Wani
 
Research Program Genetic Gains (RPGG) Review Meeting 2021: From Discovery to ...
Research Program Genetic Gains (RPGG) Review Meeting 2021: From Discovery to ...Research Program Genetic Gains (RPGG) Review Meeting 2021: From Discovery to ...
Research Program Genetic Gains (RPGG) Review Meeting 2021: From Discovery to ...ICRISAT
 
Country Status Reports on Agricultural Biotechnology - Pakistan
Country Status Reports on Agricultural Biotechnology - PakistanCountry Status Reports on Agricultural Biotechnology - Pakistan
Country Status Reports on Agricultural Biotechnology - Pakistanapaari
 
16. varietal characterization of tomato cultivars based on rapd markers
16. varietal characterization of tomato cultivars based on rapd markers16. varietal characterization of tomato cultivars based on rapd markers
16. varietal characterization of tomato cultivars based on rapd markersVishwanath Koti
 
Genetic diversification and intensification: Experiences from Kongwa and Kite...
Genetic diversification and intensification: Experiences from Kongwa and Kite...Genetic diversification and intensification: Experiences from Kongwa and Kite...
Genetic diversification and intensification: Experiences from Kongwa and Kite...africa-rising
 
Rice plus magazine,v5 i9 , december 2013
Rice plus magazine,v5 i9 , december 2013Rice plus magazine,v5 i9 , december 2013
Rice plus magazine,v5 i9 , december 2013Riceplus Magazine
 
Rice plus magazine,v5 issue 9 , december 2013
Rice plus magazine,v5 issue 9 , december 2013Rice plus magazine,v5 issue 9 , december 2013
Rice plus magazine,v5 issue 9 , december 2013Riceplus Magazine
 
Applied genomic research in rice genetic improvement (2)
Applied genomic research in rice genetic improvement (2)Applied genomic research in rice genetic improvement (2)
Applied genomic research in rice genetic improvement (2)Lokesh Gour
 
THEME – 4 Genomic diversity of domestication in soybean
THEME – 4 Genomic diversity of domestication in soybeanTHEME – 4 Genomic diversity of domestication in soybean
THEME – 4 Genomic diversity of domestication in soybeanICARDA
 
Groundnut improvement: Use of genetic and genomic tools
Groundnut improvement: Use of genetic and genomic toolsGroundnut improvement: Use of genetic and genomic tools
Groundnut improvement: Use of genetic and genomic toolsICRISAT
 
Biosafety issues related to GM crops
Biosafety issues related to GM cropsBiosafety issues related to GM crops
Biosafety issues related to GM cropsMonika Hajong
 
2016. Dandena Gelmesa In vitro Screening of Potato (Solanum tuberosum L.) ...
2016. Dandena Gelmesa In vitro  Screening of  Potato (Solanum tuberosum  L.) ...2016. Dandena Gelmesa In vitro  Screening of  Potato (Solanum tuberosum  L.) ...
2016. Dandena Gelmesa In vitro Screening of Potato (Solanum tuberosum L.) ...FOODCROPS
 
Study of genetic variability in germplasm of common bread wheat
Study of genetic variability in germplasm of common bread wheatStudy of genetic variability in germplasm of common bread wheat
Study of genetic variability in germplasm of common bread wheatYANKEY BHUTIA
 
Biotechnology improvement tools in sugarcane crop improvement
Biotechnology improvement  tools in sugarcane crop improvement Biotechnology improvement  tools in sugarcane crop improvement
Biotechnology improvement tools in sugarcane crop improvement vishwas chaudhari
 
Development and utility of cost-effective SNP genotyping platform for genetic...
Development and utility of cost-effective SNP genotyping platform for genetic...Development and utility of cost-effective SNP genotyping platform for genetic...
Development and utility of cost-effective SNP genotyping platform for genetic...ICRISAT
 

Similar to Allelic diversity and association analysis for candidate abiotic stress responsive genes with drought tolerance in chickpea (20)

Identification and validation of heat stress responsive genes in chickpea (Ci...
Identification and validation of heat stress responsive genes in chickpea (Ci...Identification and validation of heat stress responsive genes in chickpea (Ci...
Identification and validation of heat stress responsive genes in chickpea (Ci...
 
Identification and validation of heat stress responsive genes in chickpea (Ci...
Identification and validation of heat stress responsive genes in chickpea (Ci...Identification and validation of heat stress responsive genes in chickpea (Ci...
Identification and validation of heat stress responsive genes in chickpea (Ci...
 
Transgenics in vegetable crops.pptx
Transgenics in vegetable crops.pptxTransgenics in vegetable crops.pptx
Transgenics in vegetable crops.pptx
 
Breeding for Development of Climate Resilient Chickpea.pptx
Breeding for Development of Climate Resilient Chickpea.pptxBreeding for Development of Climate Resilient Chickpea.pptx
Breeding for Development of Climate Resilient Chickpea.pptx
 
Biotechnological interventions for improvement of fruit.pptx
Biotechnological interventions for improvement of fruit.pptxBiotechnological interventions for improvement of fruit.pptx
Biotechnological interventions for improvement of fruit.pptx
 
Hybrid seed production of pigeonpea
Hybrid seed production of pigeonpea Hybrid seed production of pigeonpea
Hybrid seed production of pigeonpea
 
Research Program Genetic Gains (RPGG) Review Meeting 2021: From Discovery to ...
Research Program Genetic Gains (RPGG) Review Meeting 2021: From Discovery to ...Research Program Genetic Gains (RPGG) Review Meeting 2021: From Discovery to ...
Research Program Genetic Gains (RPGG) Review Meeting 2021: From Discovery to ...
 
Country Status Reports on Agricultural Biotechnology - Pakistan
Country Status Reports on Agricultural Biotechnology - PakistanCountry Status Reports on Agricultural Biotechnology - Pakistan
Country Status Reports on Agricultural Biotechnology - Pakistan
 
16. varietal characterization of tomato cultivars based on rapd markers
16. varietal characterization of tomato cultivars based on rapd markers16. varietal characterization of tomato cultivars based on rapd markers
16. varietal characterization of tomato cultivars based on rapd markers
 
Genetic diversification and intensification: Experiences from Kongwa and Kite...
Genetic diversification and intensification: Experiences from Kongwa and Kite...Genetic diversification and intensification: Experiences from Kongwa and Kite...
Genetic diversification and intensification: Experiences from Kongwa and Kite...
 
Rice plus magazine,v5 i9 , december 2013
Rice plus magazine,v5 i9 , december 2013Rice plus magazine,v5 i9 , december 2013
Rice plus magazine,v5 i9 , december 2013
 
Rice plus magazine,v5 issue 9 , december 2013
Rice plus magazine,v5 issue 9 , december 2013Rice plus magazine,v5 issue 9 , december 2013
Rice plus magazine,v5 issue 9 , december 2013
 
Applied genomic research in rice genetic improvement (2)
Applied genomic research in rice genetic improvement (2)Applied genomic research in rice genetic improvement (2)
Applied genomic research in rice genetic improvement (2)
 
THEME – 4 Genomic diversity of domestication in soybean
THEME – 4 Genomic diversity of domestication in soybeanTHEME – 4 Genomic diversity of domestication in soybean
THEME – 4 Genomic diversity of domestication in soybean
 
Groundnut improvement: Use of genetic and genomic tools
Groundnut improvement: Use of genetic and genomic toolsGroundnut improvement: Use of genetic and genomic tools
Groundnut improvement: Use of genetic and genomic tools
 
Biosafety issues related to GM crops
Biosafety issues related to GM cropsBiosafety issues related to GM crops
Biosafety issues related to GM crops
 
2016. Dandena Gelmesa In vitro Screening of Potato (Solanum tuberosum L.) ...
2016. Dandena Gelmesa In vitro  Screening of  Potato (Solanum tuberosum  L.) ...2016. Dandena Gelmesa In vitro  Screening of  Potato (Solanum tuberosum  L.) ...
2016. Dandena Gelmesa In vitro Screening of Potato (Solanum tuberosum L.) ...
 
Study of genetic variability in germplasm of common bread wheat
Study of genetic variability in germplasm of common bread wheatStudy of genetic variability in germplasm of common bread wheat
Study of genetic variability in germplasm of common bread wheat
 
Biotechnology improvement tools in sugarcane crop improvement
Biotechnology improvement  tools in sugarcane crop improvement Biotechnology improvement  tools in sugarcane crop improvement
Biotechnology improvement tools in sugarcane crop improvement
 
Development and utility of cost-effective SNP genotyping platform for genetic...
Development and utility of cost-effective SNP genotyping platform for genetic...Development and utility of cost-effective SNP genotyping platform for genetic...
Development and utility of cost-effective SNP genotyping platform for genetic...
 

More from ICRISAT

ICRISAT’s soil laboratory registers with FAO’s International Network on Ferti...
ICRISAT’s soil laboratory registers with FAO’s International Network on Ferti...ICRISAT’s soil laboratory registers with FAO’s International Network on Ferti...
ICRISAT’s soil laboratory registers with FAO’s International Network on Ferti...ICRISAT
 
Uzbek delegation explores climate-resilient crop options for arid, degraded e...
Uzbek delegation explores climate-resilient crop options for arid, degraded e...Uzbek delegation explores climate-resilient crop options for arid, degraded e...
Uzbek delegation explores climate-resilient crop options for arid, degraded e...ICRISAT
 
Indian Ambassador to Niger explores opportunities for South-South cooperation
Indian Ambassador to Niger explores opportunities for South-South cooperationIndian Ambassador to Niger explores opportunities for South-South cooperation
Indian Ambassador to Niger explores opportunities for South-South cooperationICRISAT
 
WFP, ICRISAT to partner on climate-resilience, food security, nutrition and l...
WFP, ICRISAT to partner on climate-resilience, food security, nutrition and l...WFP, ICRISAT to partner on climate-resilience, food security, nutrition and l...
WFP, ICRISAT to partner on climate-resilience, food security, nutrition and l...ICRISAT
 
Visit by Sri Lankan Deputy High Commissioner to ICRISAT opens opportunities f...
Visit by Sri Lankan Deputy High Commissioner to ICRISAT opens opportunities f...Visit by Sri Lankan Deputy High Commissioner to ICRISAT opens opportunities f...
Visit by Sri Lankan Deputy High Commissioner to ICRISAT opens opportunities f...ICRISAT
 
UK Ambassador to Niger discusses climate change adaptation and humanitarian i...
UK Ambassador to Niger discusses climate change adaptation and humanitarian i...UK Ambassador to Niger discusses climate change adaptation and humanitarian i...
UK Ambassador to Niger discusses climate change adaptation and humanitarian i...ICRISAT
 
New climate-resilient, disease-resistant chickpea varieties coming farmers’ way
New climate-resilient, disease-resistant chickpea varieties coming farmers’ wayNew climate-resilient, disease-resistant chickpea varieties coming farmers’ way
New climate-resilient, disease-resistant chickpea varieties coming farmers’ wayICRISAT
 
Deputy Collector gets training on agriculture research at ICRISAT Hyderabad
Deputy Collector gets training on agriculture research at ICRISAT HyderabadDeputy Collector gets training on agriculture research at ICRISAT Hyderabad
Deputy Collector gets training on agriculture research at ICRISAT HyderabadICRISAT
 
Cereal-legume value chain stakeholders in WCA meet to develop demand-driven a...
Cereal-legume value chain stakeholders in WCA meet to develop demand-driven a...Cereal-legume value chain stakeholders in WCA meet to develop demand-driven a...
Cereal-legume value chain stakeholders in WCA meet to develop demand-driven a...ICRISAT
 
ICRISAT to share expertise on sorghum production with farmers in Somalia
ICRISAT to share expertise on sorghum production with farmers in SomaliaICRISAT to share expertise on sorghum production with farmers in Somalia
ICRISAT to share expertise on sorghum production with farmers in SomaliaICRISAT
 
4CAST: New digital tool to enhance farmers’ access to modern varieties
4CAST: New digital tool to enhance farmers’ access to modern varieties4CAST: New digital tool to enhance farmers’ access to modern varieties
4CAST: New digital tool to enhance farmers’ access to modern varietiesICRISAT
 
New ‘one-stop shop’ team formed to take ICRISAT’S plant breeding program in W...
New ‘one-stop shop’ team formed to take ICRISAT’S plant breeding program in W...New ‘one-stop shop’ team formed to take ICRISAT’S plant breeding program in W...
New ‘one-stop shop’ team formed to take ICRISAT’S plant breeding program in W...ICRISAT
 
ICRISAT awarded 2021 Africa Food Prize
ICRISAT awarded 2021 Africa Food PrizeICRISAT awarded 2021 Africa Food Prize
ICRISAT awarded 2021 Africa Food PrizeICRISAT
 
Rooting for strong partnerships and participatory extension in Nigeria for ro...
Rooting for strong partnerships and participatory extension in Nigeria for ro...Rooting for strong partnerships and participatory extension in Nigeria for ro...
Rooting for strong partnerships and participatory extension in Nigeria for ro...ICRISAT
 
Understanding consumption preferences for sorghum and millets globally
Understanding consumption preferences for sorghum and millets globallyUnderstanding consumption preferences for sorghum and millets globally
Understanding consumption preferences for sorghum and millets globallyICRISAT
 
ICRISAT introduces an invigorated research structure (The research structure ...
ICRISAT introduces an invigorated research structure (The research structure ...ICRISAT introduces an invigorated research structure (The research structure ...
ICRISAT introduces an invigorated research structure (The research structure ...ICRISAT
 
Training on science communication to engage funders and stakeholders
Training on science communication to engage funders and stakeholdersTraining on science communication to engage funders and stakeholders
Training on science communication to engage funders and stakeholdersICRISAT
 
Virtual training in the use of remote sensing for the agriculture sector in P...
Virtual training in the use of remote sensing for the agriculture sector in P...Virtual training in the use of remote sensing for the agriculture sector in P...
Virtual training in the use of remote sensing for the agriculture sector in P...ICRISAT
 
Icrisat strategic plan 2021 2025
Icrisat strategic  plan 2021  2025Icrisat strategic  plan 2021  2025
Icrisat strategic plan 2021 2025ICRISAT
 
ICRISAT and HarvestPlus to collaborate on mainstreaming nutrition research an...
ICRISAT and HarvestPlus to collaborate on mainstreaming nutrition research an...ICRISAT and HarvestPlus to collaborate on mainstreaming nutrition research an...
ICRISAT and HarvestPlus to collaborate on mainstreaming nutrition research an...ICRISAT
 

More from ICRISAT (20)

ICRISAT’s soil laboratory registers with FAO’s International Network on Ferti...
ICRISAT’s soil laboratory registers with FAO’s International Network on Ferti...ICRISAT’s soil laboratory registers with FAO’s International Network on Ferti...
ICRISAT’s soil laboratory registers with FAO’s International Network on Ferti...
 
Uzbek delegation explores climate-resilient crop options for arid, degraded e...
Uzbek delegation explores climate-resilient crop options for arid, degraded e...Uzbek delegation explores climate-resilient crop options for arid, degraded e...
Uzbek delegation explores climate-resilient crop options for arid, degraded e...
 
Indian Ambassador to Niger explores opportunities for South-South cooperation
Indian Ambassador to Niger explores opportunities for South-South cooperationIndian Ambassador to Niger explores opportunities for South-South cooperation
Indian Ambassador to Niger explores opportunities for South-South cooperation
 
WFP, ICRISAT to partner on climate-resilience, food security, nutrition and l...
WFP, ICRISAT to partner on climate-resilience, food security, nutrition and l...WFP, ICRISAT to partner on climate-resilience, food security, nutrition and l...
WFP, ICRISAT to partner on climate-resilience, food security, nutrition and l...
 
Visit by Sri Lankan Deputy High Commissioner to ICRISAT opens opportunities f...
Visit by Sri Lankan Deputy High Commissioner to ICRISAT opens opportunities f...Visit by Sri Lankan Deputy High Commissioner to ICRISAT opens opportunities f...
Visit by Sri Lankan Deputy High Commissioner to ICRISAT opens opportunities f...
 
UK Ambassador to Niger discusses climate change adaptation and humanitarian i...
UK Ambassador to Niger discusses climate change adaptation and humanitarian i...UK Ambassador to Niger discusses climate change adaptation and humanitarian i...
UK Ambassador to Niger discusses climate change adaptation and humanitarian i...
 
New climate-resilient, disease-resistant chickpea varieties coming farmers’ way
New climate-resilient, disease-resistant chickpea varieties coming farmers’ wayNew climate-resilient, disease-resistant chickpea varieties coming farmers’ way
New climate-resilient, disease-resistant chickpea varieties coming farmers’ way
 
Deputy Collector gets training on agriculture research at ICRISAT Hyderabad
Deputy Collector gets training on agriculture research at ICRISAT HyderabadDeputy Collector gets training on agriculture research at ICRISAT Hyderabad
Deputy Collector gets training on agriculture research at ICRISAT Hyderabad
 
Cereal-legume value chain stakeholders in WCA meet to develop demand-driven a...
Cereal-legume value chain stakeholders in WCA meet to develop demand-driven a...Cereal-legume value chain stakeholders in WCA meet to develop demand-driven a...
Cereal-legume value chain stakeholders in WCA meet to develop demand-driven a...
 
ICRISAT to share expertise on sorghum production with farmers in Somalia
ICRISAT to share expertise on sorghum production with farmers in SomaliaICRISAT to share expertise on sorghum production with farmers in Somalia
ICRISAT to share expertise on sorghum production with farmers in Somalia
 
4CAST: New digital tool to enhance farmers’ access to modern varieties
4CAST: New digital tool to enhance farmers’ access to modern varieties4CAST: New digital tool to enhance farmers’ access to modern varieties
4CAST: New digital tool to enhance farmers’ access to modern varieties
 
New ‘one-stop shop’ team formed to take ICRISAT’S plant breeding program in W...
New ‘one-stop shop’ team formed to take ICRISAT’S plant breeding program in W...New ‘one-stop shop’ team formed to take ICRISAT’S plant breeding program in W...
New ‘one-stop shop’ team formed to take ICRISAT’S plant breeding program in W...
 
ICRISAT awarded 2021 Africa Food Prize
ICRISAT awarded 2021 Africa Food PrizeICRISAT awarded 2021 Africa Food Prize
ICRISAT awarded 2021 Africa Food Prize
 
Rooting for strong partnerships and participatory extension in Nigeria for ro...
Rooting for strong partnerships and participatory extension in Nigeria for ro...Rooting for strong partnerships and participatory extension in Nigeria for ro...
Rooting for strong partnerships and participatory extension in Nigeria for ro...
 
Understanding consumption preferences for sorghum and millets globally
Understanding consumption preferences for sorghum and millets globallyUnderstanding consumption preferences for sorghum and millets globally
Understanding consumption preferences for sorghum and millets globally
 
ICRISAT introduces an invigorated research structure (The research structure ...
ICRISAT introduces an invigorated research structure (The research structure ...ICRISAT introduces an invigorated research structure (The research structure ...
ICRISAT introduces an invigorated research structure (The research structure ...
 
Training on science communication to engage funders and stakeholders
Training on science communication to engage funders and stakeholdersTraining on science communication to engage funders and stakeholders
Training on science communication to engage funders and stakeholders
 
Virtual training in the use of remote sensing for the agriculture sector in P...
Virtual training in the use of remote sensing for the agriculture sector in P...Virtual training in the use of remote sensing for the agriculture sector in P...
Virtual training in the use of remote sensing for the agriculture sector in P...
 
Icrisat strategic plan 2021 2025
Icrisat strategic  plan 2021  2025Icrisat strategic  plan 2021  2025
Icrisat strategic plan 2021 2025
 
ICRISAT and HarvestPlus to collaborate on mainstreaming nutrition research an...
ICRISAT and HarvestPlus to collaborate on mainstreaming nutrition research an...ICRISAT and HarvestPlus to collaborate on mainstreaming nutrition research an...
ICRISAT and HarvestPlus to collaborate on mainstreaming nutrition research an...
 

Recently uploaded

Top Rated Pune Call Girls Hadapsar ⟟ 6297143586 ⟟ Call Me For Genuine Sex Se...
Top Rated  Pune Call Girls Hadapsar ⟟ 6297143586 ⟟ Call Me For Genuine Sex Se...Top Rated  Pune Call Girls Hadapsar ⟟ 6297143586 ⟟ Call Me For Genuine Sex Se...
Top Rated Pune Call Girls Hadapsar ⟟ 6297143586 ⟟ Call Me For Genuine Sex Se...Call Girls in Nagpur High Profile
 
Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…
Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…
Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…nishakur201
 
VIP Kolkata Call Girl Jatin Das Park 👉 8250192130 Available With Room
VIP Kolkata Call Girl Jatin Das Park 👉 8250192130  Available With RoomVIP Kolkata Call Girl Jatin Das Park 👉 8250192130  Available With Room
VIP Kolkata Call Girl Jatin Das Park 👉 8250192130 Available With Roomishabajaj13
 
##9711199012 Call Girls Delhi Rs-5000 UpTo 10 K Hauz Khas Whats Up Number
##9711199012 Call Girls Delhi Rs-5000 UpTo 10 K Hauz Khas  Whats Up Number##9711199012 Call Girls Delhi Rs-5000 UpTo 10 K Hauz Khas  Whats Up Number
##9711199012 Call Girls Delhi Rs-5000 UpTo 10 K Hauz Khas Whats Up NumberMs Riya
 
Item # 4 - 231 Encino Ave (Significance Only).pdf
Item # 4 - 231 Encino Ave (Significance Only).pdfItem # 4 - 231 Encino Ave (Significance Only).pdf
Item # 4 - 231 Encino Ave (Significance Only).pdfahcitycouncil
 
WIPO magazine issue -1 - 2024 World Intellectual Property organization.
WIPO magazine issue -1 - 2024 World Intellectual Property organization.WIPO magazine issue -1 - 2024 World Intellectual Property organization.
WIPO magazine issue -1 - 2024 World Intellectual Property organization.Christina Parmionova
 
CBO’s Recent Appeals for New Research on Health-Related Topics
CBO’s Recent Appeals for New Research on Health-Related TopicsCBO’s Recent Appeals for New Research on Health-Related Topics
CBO’s Recent Appeals for New Research on Health-Related TopicsCongressional Budget Office
 
(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service
(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service
(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Serviceranjana rawat
 
VIP Call Girls Service Bikaner Aishwarya 8250192130 Independent Escort Servic...
VIP Call Girls Service Bikaner Aishwarya 8250192130 Independent Escort Servic...VIP Call Girls Service Bikaner Aishwarya 8250192130 Independent Escort Servic...
VIP Call Girls Service Bikaner Aishwarya 8250192130 Independent Escort Servic...Suhani Kapoor
 
2024 Zoom Reinstein Legacy Asbestos Webinar
2024 Zoom Reinstein Legacy Asbestos Webinar2024 Zoom Reinstein Legacy Asbestos Webinar
2024 Zoom Reinstein Legacy Asbestos WebinarLinda Reinstein
 
Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...
Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...
Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...anilsa9823
 
(TARA) Call Girls Sanghavi ( 7001035870 ) HI-Fi Pune Escorts Service
(TARA) Call Girls Sanghavi ( 7001035870 ) HI-Fi Pune Escorts Service(TARA) Call Girls Sanghavi ( 7001035870 ) HI-Fi Pune Escorts Service
(TARA) Call Girls Sanghavi ( 7001035870 ) HI-Fi Pune Escorts Serviceranjana rawat
 
How the Congressional Budget Office Assists Lawmakers
How the Congressional Budget Office Assists LawmakersHow the Congressional Budget Office Assists Lawmakers
How the Congressional Budget Office Assists LawmakersCongressional Budget Office
 
VIP Russian Call Girls in Indore Ishita 💚😋 9256729539 🚀 Indore Escorts
VIP Russian Call Girls in Indore Ishita 💚😋  9256729539 🚀 Indore EscortsVIP Russian Call Girls in Indore Ishita 💚😋  9256729539 🚀 Indore Escorts
VIP Russian Call Girls in Indore Ishita 💚😋 9256729539 🚀 Indore Escortsaditipandeya
 
Human-AI Collaboration for Virtual Capacity in Emergency Operation Centers (E...
Human-AI Collaborationfor Virtual Capacity in Emergency Operation Centers (E...Human-AI Collaborationfor Virtual Capacity in Emergency Operation Centers (E...
Human-AI Collaboration for Virtual Capacity in Emergency Operation Centers (E...Hemant Purohit
 
2024: The FAR, Federal Acquisition Regulations - Part 28
2024: The FAR, Federal Acquisition Regulations - Part 282024: The FAR, Federal Acquisition Regulations - Part 28
2024: The FAR, Federal Acquisition Regulations - Part 28JSchaus & Associates
 
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...CedZabala
 

Recently uploaded (20)

Top Rated Pune Call Girls Hadapsar ⟟ 6297143586 ⟟ Call Me For Genuine Sex Se...
Top Rated  Pune Call Girls Hadapsar ⟟ 6297143586 ⟟ Call Me For Genuine Sex Se...Top Rated  Pune Call Girls Hadapsar ⟟ 6297143586 ⟟ Call Me For Genuine Sex Se...
Top Rated Pune Call Girls Hadapsar ⟟ 6297143586 ⟟ Call Me For Genuine Sex Se...
 
Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…
Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…
Goa Escorts WhatsApp Number South Goa Call Girl … 8588052666…
 
Call Girls Service Connaught Place @9999965857 Delhi 🫦 No Advance VVIP 🍎 SER...
Call Girls Service Connaught Place @9999965857 Delhi 🫦 No Advance  VVIP 🍎 SER...Call Girls Service Connaught Place @9999965857 Delhi 🫦 No Advance  VVIP 🍎 SER...
Call Girls Service Connaught Place @9999965857 Delhi 🫦 No Advance VVIP 🍎 SER...
 
VIP Kolkata Call Girl Jatin Das Park 👉 8250192130 Available With Room
VIP Kolkata Call Girl Jatin Das Park 👉 8250192130  Available With RoomVIP Kolkata Call Girl Jatin Das Park 👉 8250192130  Available With Room
VIP Kolkata Call Girl Jatin Das Park 👉 8250192130 Available With Room
 
##9711199012 Call Girls Delhi Rs-5000 UpTo 10 K Hauz Khas Whats Up Number
##9711199012 Call Girls Delhi Rs-5000 UpTo 10 K Hauz Khas  Whats Up Number##9711199012 Call Girls Delhi Rs-5000 UpTo 10 K Hauz Khas  Whats Up Number
##9711199012 Call Girls Delhi Rs-5000 UpTo 10 K Hauz Khas Whats Up Number
 
Item # 4 - 231 Encino Ave (Significance Only).pdf
Item # 4 - 231 Encino Ave (Significance Only).pdfItem # 4 - 231 Encino Ave (Significance Only).pdf
Item # 4 - 231 Encino Ave (Significance Only).pdf
 
How to Save a Place: 12 Tips To Research & Know the Threat
How to Save a Place: 12 Tips To Research & Know the ThreatHow to Save a Place: 12 Tips To Research & Know the Threat
How to Save a Place: 12 Tips To Research & Know the Threat
 
9953330565 Low Rate Call Girls In Adarsh Nagar Delhi NCR
9953330565 Low Rate Call Girls In Adarsh Nagar Delhi NCR9953330565 Low Rate Call Girls In Adarsh Nagar Delhi NCR
9953330565 Low Rate Call Girls In Adarsh Nagar Delhi NCR
 
WIPO magazine issue -1 - 2024 World Intellectual Property organization.
WIPO magazine issue -1 - 2024 World Intellectual Property organization.WIPO magazine issue -1 - 2024 World Intellectual Property organization.
WIPO magazine issue -1 - 2024 World Intellectual Property organization.
 
CBO’s Recent Appeals for New Research on Health-Related Topics
CBO’s Recent Appeals for New Research on Health-Related TopicsCBO’s Recent Appeals for New Research on Health-Related Topics
CBO’s Recent Appeals for New Research on Health-Related Topics
 
(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service
(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service
(SUHANI) Call Girls Pimple Saudagar ( 7001035870 ) HI-Fi Pune Escorts Service
 
VIP Call Girls Service Bikaner Aishwarya 8250192130 Independent Escort Servic...
VIP Call Girls Service Bikaner Aishwarya 8250192130 Independent Escort Servic...VIP Call Girls Service Bikaner Aishwarya 8250192130 Independent Escort Servic...
VIP Call Girls Service Bikaner Aishwarya 8250192130 Independent Escort Servic...
 
2024 Zoom Reinstein Legacy Asbestos Webinar
2024 Zoom Reinstein Legacy Asbestos Webinar2024 Zoom Reinstein Legacy Asbestos Webinar
2024 Zoom Reinstein Legacy Asbestos Webinar
 
Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...
Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...
Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...
 
(TARA) Call Girls Sanghavi ( 7001035870 ) HI-Fi Pune Escorts Service
(TARA) Call Girls Sanghavi ( 7001035870 ) HI-Fi Pune Escorts Service(TARA) Call Girls Sanghavi ( 7001035870 ) HI-Fi Pune Escorts Service
(TARA) Call Girls Sanghavi ( 7001035870 ) HI-Fi Pune Escorts Service
 
How the Congressional Budget Office Assists Lawmakers
How the Congressional Budget Office Assists LawmakersHow the Congressional Budget Office Assists Lawmakers
How the Congressional Budget Office Assists Lawmakers
 
VIP Russian Call Girls in Indore Ishita 💚😋 9256729539 🚀 Indore Escorts
VIP Russian Call Girls in Indore Ishita 💚😋  9256729539 🚀 Indore EscortsVIP Russian Call Girls in Indore Ishita 💚😋  9256729539 🚀 Indore Escorts
VIP Russian Call Girls in Indore Ishita 💚😋 9256729539 🚀 Indore Escorts
 
Human-AI Collaboration for Virtual Capacity in Emergency Operation Centers (E...
Human-AI Collaborationfor Virtual Capacity in Emergency Operation Centers (E...Human-AI Collaborationfor Virtual Capacity in Emergency Operation Centers (E...
Human-AI Collaboration for Virtual Capacity in Emergency Operation Centers (E...
 
2024: The FAR, Federal Acquisition Regulations - Part 28
2024: The FAR, Federal Acquisition Regulations - Part 282024: The FAR, Federal Acquisition Regulations - Part 28
2024: The FAR, Federal Acquisition Regulations - Part 28
 
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
 

Allelic diversity and association analysis for candidate abiotic stress responsive genes with drought tolerance in chickpea

  • 1. Financial support from Department of Biotechnology, Government of India and CGIAR Generation Challenge Programme (GCP) is gratefully acknowledged. Manish Roorkiwal1,2, Spurthi Nayak1,3, Mahendar Thudi1, Hari Upadhyaya1, Rajeev Varshney1,4,*, Prakash Sharma2 1International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Hyderabad, India; 2Guru Gobind Singh Indraprastha University, New Delhi, India; 3University of Florida, Florida, USA; 4CGIAR Generation Challenge Programme, c/o CIMMYT, Mexico DF, Mexico; *Address for correspondence: r.k.varshney@cgiar.org Chickpea is an important food legume crop, for the semi-arid regions including Indian subcontinent. Its productivity is adversely affected by various biotic and abiotic stresses. Identification of candidate genes that are associated with abiotic stress response will help breeding efforts aiming to enhance its productivity. With this objective, eleven abiotic stress responsive candidate genes were selected on the basis of prior knowledge acquired from mutational, biochemical and linkage analysis of the traits. These 11 genes were subjected to allele specific sequencing across chickpea reference set comprising of 300 genotypes including 211 mini-core collection genotypes. In total, 1.3Mbp sequence data was generated. Multiple sequence alignment revealed 79 SNPs and 41 indels in ten candidate genes while, CAP2 gene was found to be conserved across all genotypes. Among ten candidate genes, maximum number of SNPs (34) were observed in ASR gene, amongst which 22 transitions, 11 transversions and one tri-allelic SNP. Nucleotide diversity varied from 0.0004 to 0.0029, while PIC values ranged from 0.01 (AKIN gene) to 0.43 (CAP2 promoter). Association analysis using these candidate genes identified 6 SNPs in ASR, 3 SNPs in Dehydrin and 3 SNPs in DREB associated with different traits like 100-seed weight, delta carbon, plant height, root surface area, root dry weight, pods per plant and yield. Identified marker trait association after further validation may be useful for enhancing drought tolerance in chickpea through molecular breeding. Abstract Gene sequence alignment to identify SNPsBackground ICC1882 ICC2210 ICC2990 ICC6263 ICC6811 ICC7184 ICC8195 ICC8261 ICC8621 ICC9848 ICC11378 ICC12328 ICC12537 ICC13816 ICC14402 Transition (C-T) ‘ATG’ deletion b. ICC9848 TATGGGACCCACAATACAC---GTGG ICC11378 TATGGGACCTACAATACACATGGTGGICC9848 ICC11378 a. GURU GOBIND SINGH INDRAPRASTHA UNIVERSITY Allelic diversity and association analysis for candidate abiotic stress responsive genes with drought tolerance in chickpea  Chickpea (Cicer arietinum L. 2n=16) is an important food legume crop, which ranks third worldwide as a food legume crop  India is the largest producer as well as largest importer of chickpea; Yield and productivity are adversely affected by various biotic and abiotic stresses  Drought alone causes 40-50% reduction in the chickpea yield globally  A holistic approach, combining genomics with breeding and physiology, termed as genomics-assisted breeding (Varshney et al. 2005 Trends Plant Sci 10:621-630) should be used  Identification of abiotic stress responsive genes and determination of genetic diversity among the mini core collection using SNPs identified in these genes will lead to identification of superior alleles of the gene present in chickpea germplasm Sequence quality check using DNA Baser V3.01 to compare the SNP (C/T) and deletion of ATG Candidate gene AKIN AMADH ASR CAP2 CAP2 promoter DHN DREB ERECTA _7 ERECTA _8 Myb SPS Genotypes with successful sequences 208 209 193 227 137 198 191 79 147 200 236 Sequence length (bp) 772 932 621 367 629 381 776 921 1189 335 312 No. of Indels 2 3 2 0 0 7 23 1 0 2 1 Indel frequency 1/386.0 1/310.67 1/310.6 0 0 1/54.4 1/33.7 1/921.0 0 1/167.5 1/312.0 No. of SNPs 2 13 34* 0 1 7 14 13 20 6 3 Transition 2 6 22 0 0 5 8 9 10 1 2 Transversion 0 7 13 0 1 2 6 4 10 5 1 SNP frequency 1/386.0 1/71.7 1/18.3 0 1/629.0 1/54.4 1/55.4 1/70.9 1/69.5 1/55.8 1/104.0 Nucleotide Diversity (Pi) 0.0004 0.002 0.0014 0 0 0.0022 0.0011 0.0029 0.0029 0.002 0.0011 Average PIC of SNP 0.01 0.04 0.1 0 0.43 0.17 0.14 0.27 0.1 0.04 0.01 No. of Haplotypes 3 9 4 1 2 6 33 4 3 6 4 Haplotype Diversity 0.019 0.326 0.833 0 0.438 0.426 0.879 0.372 0.324 0.256 0.034 PIC of Haplotypes 0.019 0.324 0.829 0 0.436 0.424 0.874 0.367 0.322 0.255 0.034 Sequence diversity analysis for biotic stress responsive genes Methodology Gene sequences EST sequences SNP Identification Allele diversity analysis Primer design PCR Amplification Sequencing of purified PCR products Contigs showing match with target gene Contigs Confirmation of gene Chickpea Reference set/ mini core Gene Amplification Amplicons sequencing Gene Amplification Sequence similarity based identification and confirmation of candidate genes in chickpea SNP identification and allele diversity analysis in chickpea mini core collection Asia M East E Africa Euro Asia Europe N Africa N America NE Africa NW Africa S America SE Africa W Africa Unknown Haplotype network of SPS gene Salient features 1. Eleven abiotic stress responsive candidate genes were identified in chickpea based on sequence similarity approach. 2. SNPs were identified for these eleven genes across 300 (211) accessions of chickpea reference set &/or mini core collection 3. A total of 79 SNPs and 41 indels were identified in ten candidate genes while, CAP2 gene was found to be conserved across all genotypes 4. Diversity analysis reveals that ASR gene was most variable with 34 SNPs amongst which 22 transitions, 11 transversions and one tri-allelic 5. PIC values ranged from 0.01 (AKIN gene) to 0.43 (CAP2 promoter) Acknowledgements