Advertisement
Allelic diversity and association analysis for candidate abiotic stress responsive genes with drought tolerance in chickpea
Upcoming SlideShare
VEGF-A modified mRNA in diabetic wound healing and future treatment opportuni...VEGF-A modified mRNA in diabetic wound healing and future treatment opportuni...
Loading in ... 3
1 of 1
Advertisement

More Related Content

Slideshows for you(20)

Advertisement

Similar to Allelic diversity and association analysis for candidate abiotic stress responsive genes with drought tolerance in chickpea(20)

More from ICRISAT(20)

Advertisement

Recently uploaded(20)

Allelic diversity and association analysis for candidate abiotic stress responsive genes with drought tolerance in chickpea

  1. Financial support from Department of Biotechnology, Government of India and CGIAR Generation Challenge Programme (GCP) is gratefully acknowledged. Manish Roorkiwal1,2, Spurthi Nayak1,3, Mahendar Thudi1, Hari Upadhyaya1, Rajeev Varshney1,4,*, Prakash Sharma2 1International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Hyderabad, India; 2Guru Gobind Singh Indraprastha University, New Delhi, India; 3University of Florida, Florida, USA; 4CGIAR Generation Challenge Programme, c/o CIMMYT, Mexico DF, Mexico; *Address for correspondence: r.k.varshney@cgiar.org Chickpea is an important food legume crop, for the semi-arid regions including Indian subcontinent. Its productivity is adversely affected by various biotic and abiotic stresses. Identification of candidate genes that are associated with abiotic stress response will help breeding efforts aiming to enhance its productivity. With this objective, eleven abiotic stress responsive candidate genes were selected on the basis of prior knowledge acquired from mutational, biochemical and linkage analysis of the traits. These 11 genes were subjected to allele specific sequencing across chickpea reference set comprising of 300 genotypes including 211 mini-core collection genotypes. In total, 1.3Mbp sequence data was generated. Multiple sequence alignment revealed 79 SNPs and 41 indels in ten candidate genes while, CAP2 gene was found to be conserved across all genotypes. Among ten candidate genes, maximum number of SNPs (34) were observed in ASR gene, amongst which 22 transitions, 11 transversions and one tri-allelic SNP. Nucleotide diversity varied from 0.0004 to 0.0029, while PIC values ranged from 0.01 (AKIN gene) to 0.43 (CAP2 promoter). Association analysis using these candidate genes identified 6 SNPs in ASR, 3 SNPs in Dehydrin and 3 SNPs in DREB associated with different traits like 100-seed weight, delta carbon, plant height, root surface area, root dry weight, pods per plant and yield. Identified marker trait association after further validation may be useful for enhancing drought tolerance in chickpea through molecular breeding. Abstract Gene sequence alignment to identify SNPsBackground ICC1882 ICC2210 ICC2990 ICC6263 ICC6811 ICC7184 ICC8195 ICC8261 ICC8621 ICC9848 ICC11378 ICC12328 ICC12537 ICC13816 ICC14402 Transition (C-T) ‘ATG’ deletion b. ICC9848 TATGGGACCCACAATACAC---GTGG ICC11378 TATGGGACCTACAATACACATGGTGGICC9848 ICC11378 a. GURU GOBIND SINGH INDRAPRASTHA UNIVERSITY Allelic diversity and association analysis for candidate abiotic stress responsive genes with drought tolerance in chickpea  Chickpea (Cicer arietinum L. 2n=16) is an important food legume crop, which ranks third worldwide as a food legume crop  India is the largest producer as well as largest importer of chickpea; Yield and productivity are adversely affected by various biotic and abiotic stresses  Drought alone causes 40-50% reduction in the chickpea yield globally  A holistic approach, combining genomics with breeding and physiology, termed as genomics-assisted breeding (Varshney et al. 2005 Trends Plant Sci 10:621-630) should be used  Identification of abiotic stress responsive genes and determination of genetic diversity among the mini core collection using SNPs identified in these genes will lead to identification of superior alleles of the gene present in chickpea germplasm Sequence quality check using DNA Baser V3.01 to compare the SNP (C/T) and deletion of ATG Candidate gene AKIN AMADH ASR CAP2 CAP2 promoter DHN DREB ERECTA _7 ERECTA _8 Myb SPS Genotypes with successful sequences 208 209 193 227 137 198 191 79 147 200 236 Sequence length (bp) 772 932 621 367 629 381 776 921 1189 335 312 No. of Indels 2 3 2 0 0 7 23 1 0 2 1 Indel frequency 1/386.0 1/310.67 1/310.6 0 0 1/54.4 1/33.7 1/921.0 0 1/167.5 1/312.0 No. of SNPs 2 13 34* 0 1 7 14 13 20 6 3 Transition 2 6 22 0 0 5 8 9 10 1 2 Transversion 0 7 13 0 1 2 6 4 10 5 1 SNP frequency 1/386.0 1/71.7 1/18.3 0 1/629.0 1/54.4 1/55.4 1/70.9 1/69.5 1/55.8 1/104.0 Nucleotide Diversity (Pi) 0.0004 0.002 0.0014 0 0 0.0022 0.0011 0.0029 0.0029 0.002 0.0011 Average PIC of SNP 0.01 0.04 0.1 0 0.43 0.17 0.14 0.27 0.1 0.04 0.01 No. of Haplotypes 3 9 4 1 2 6 33 4 3 6 4 Haplotype Diversity 0.019 0.326 0.833 0 0.438 0.426 0.879 0.372 0.324 0.256 0.034 PIC of Haplotypes 0.019 0.324 0.829 0 0.436 0.424 0.874 0.367 0.322 0.255 0.034 Sequence diversity analysis for biotic stress responsive genes Methodology Gene sequences EST sequences SNP Identification Allele diversity analysis Primer design PCR Amplification Sequencing of purified PCR products Contigs showing match with target gene Contigs Confirmation of gene Chickpea Reference set/ mini core Gene Amplification Amplicons sequencing Gene Amplification Sequence similarity based identification and confirmation of candidate genes in chickpea SNP identification and allele diversity analysis in chickpea mini core collection Asia M East E Africa Euro Asia Europe N Africa N America NE Africa NW Africa S America SE Africa W Africa Unknown Haplotype network of SPS gene Salient features 1. Eleven abiotic stress responsive candidate genes were identified in chickpea based on sequence similarity approach. 2. SNPs were identified for these eleven genes across 300 (211) accessions of chickpea reference set &/or mini core collection 3. A total of 79 SNPs and 41 indels were identified in ten candidate genes while, CAP2 gene was found to be conserved across all genotypes 4. Diversity analysis reveals that ASR gene was most variable with 34 SNPs amongst which 22 transitions, 11 transversions and one tri-allelic 5. PIC values ranged from 0.01 (AKIN gene) to 0.43 (CAP2 promoter) Acknowledgements
Advertisement